En konvergerande strategi för generering av ett virtuellt sekvenserat cDNA-bibliotek från orefererade Pacific Oysters

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi beskriver en strategi för hur man använder RNA-prover från orefererade Pacific Oyster-prover, och utvärderar det genetiska materialet i jämförelse med allmänt tillgängliga genomdata för att generera ett virtuellt sekvenserat cDNA-bibliotek.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tillgången till biologiskt material av referens arter, som tidigare använts i viktiga experiment, till exempel vid utveckling av nya cellinjer eller sekvenserings projekt, är ofta svåra att tillhandahålla för ytterligare studier eller tredje parter på grund av provtagens fullänkande karaktär. Även om det nu är vida spridda över Stillahavskusten i Asien, Australien och Nordamerika, är enskilda Pacific ostron exemplar genetiskt ganska varierande och är därför inte direkt lämpade som utgångsmaterial för gen bibliotek. I den här artikeln visar vi användningen av orefererade Pacific Oyster-prover som erhållits från regionala skaldjursmarknader för att generera cDNA-bibliotek. Dessa bibliotek jämfördes sedan med det allmänt tillgängliga ostron genomet, och det närmast relaterade biblioteket valdes med hjälp av mitokondriella referengener cytokrom C oxidas subenhet I (COX1) och NADH dehydrogenas (nd). Det genererade cDNA-bibliotekets lämplighet demonstreras också genom kloning och uttryck av två gener som kodar för enzymerna UDP-glukuronsyra-dehydrogenas (UGD) och UDP-Xylose syntas (UXS), som är ansvariga för biosyntesen av UDP-Xylose från UDP-glukos.

Introduction

Förvärvet av levande refererade biologiskt material kan vara utmanande på grund av långa leveranstider, företagande resonemang, eller landsspecifika tullbestämmelser. Som ett alternativ kan det erforderliga biologiska materialet också samlas in från fenotypiskt identiska prover. Dessa prover kan dock variera betydligt på genotyp nivå, och därför är jämförelser med digitalt lagrade referens genom av samma art ofta förorsakade svåra eller till och med meningslösa på grund av inkompatibilitet hos det nyligen inköpta materialet med befintliga DNA-amplifieringsmetoder. Sekvensering av mycket bevarade gener av enskilda prover är ett allmänt använt och kraftfullt verktyg för att identifiera arter1, såsom bevarade mitokondriella gener som ofta används som referengener för kvalitetsbedömningen av cDNA-bibliotek2 ,3,4,5,6. Den bakomliggande grunden för den här presenterade metoden är att högt bevarande av mitokondriella gensekvenser i enskilda anonyma ostron prov jämfört med motsvarande sekvenser av referensgenomet indikerar att andra gener också kan visa en låg nivå av avvikelser, med tanke på den allmänt snabbare graden av mitokondriell DNA-evolution i förhållande till nukleärt DNA7, vilket möjliggör förstärkning och isolering av ett brett spektrum av vetenskapligt och industriellt relevanta gener genom att helt enkelt använda offentligt tillgängliga sekvenserings data som referens.

Det övergripande målet för häri beskrivna metoden är att presentera ett optimerat arbetsflöde för att generera ett praktiskt taget sekvenserade Oyster cDNA bibliotek som kan användas som mall DNA för kloning av ostron gener. Vid virtuell sekvensering kringgås de Novo genomsekvenseringen. i stället används en känd, digitalt lagrad referenssekvens direkt för att använda eller designa primers för produktion av cDNAs som så småningom kommer att bestå av ett bibliotek (eller läggas till i en befintlig). Målet är att skapa ett konvergent cDNA-bibliotek, vilket innebär att likheter mellan de genererade cDNA-sekvenserna och referenssekvens kan rangordnas från låg till hög avvikelse. En viktig fördel med att använda cytokrom C oxidas subenhet 1 (COX1) och NADH dehydrogenas (nd) som referengener är att även mycket geografiskt det ostron exemplar kan profileras på grund av den höga bevarandet av dessa mitokondriella gener. Efter att ha bevisat tillvägagångssättet med dessa väletablerade markörer, visar vi sedan dess tillämpning på två enzym kandidater som är involverade i socker nukleotidbiosyntes och kan vara av industriell relevans8,9, 10. den biotekniska potentialen i stilla ostron är fortfarande outforskad. Därför anser vi att denna konvergerande metod för att förbereda ett virtuellt sekvenserat cDNA-bibliotek också kommer att vara lämplig för icke-specialiserade forskare som vill generera cDNA från detta relevanta biologiska material.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Anm.: en schematisk översikt visas i figur 1.

1. provtagning

  1. Få ostron prov. Håll ostron på is under Postharvest perioden, transporten och före laboratorieanvändning och process inom 4-7 dagar efter köpet.
    Anmärkning: för detta protokoll köptes ostron från Zhong Cai grossistmarknad i Nanjing (med ursprung från Ningde, Fujian, Kina och Lianyungang, Jiangsu, Kina), Haijie akvatiska produkt företag i Qingdao (kommer från Qingdao, Shandong, Kina), Jucheng Akvatiska produktbolag i Yantai (med ursprung från Yantai, Shandong, Kina) och Jinxiu Aquatic produkt företag i Qingdao (med ursprung från Qingdao, Shandong, Kina)).

2. RNA-isolering av guanidinium tiocyanat-fenolextraktion

  1. Beredning av ostron vävnadsprov
    1. Klipp ut cirka 100 mg homogen mjuk vävnad från den ungefärliga geometriska mitten av varje ostron prov med en steriliserad skalpell, och överföra proverna till flytande kväve.
    2. Euthanize den resterande delen av ostronen genom att frysa vid-80 ° c för 1 h och kassera som biologiskt avfall.
    3. Slipa den Flash-frysta ostron vävnaden till ett fint pulver i en murbruk (200 mL) fylld med 50 mL flytande kväve.
    4. Väg ut 75 mg av varje provets frysta vävnad i ett sterilt 1,5 mL centrifugerör och blanda med 1 mL av guanidinium thiocyanate-fenolextraktionsmedel. Centrifugera provet vid 14 000 x g vid 4 ° c i 15 min.
  2. Överför supernatanten till ett nytt 1,5 mL centrifugeringsrör, tillsätt 200 μL kloroform och blanda grundligt genom att använda en Vortex mixer för 10-15 s tills blandningen blir mjölkvit.
  3. Centrifugera vid 14 000 x g vid 4 ° c i 15 min och överför det övre vattenskiktet försiktigt med en 200 μl pipett utan att störa interfasen i ett nytt 1,5 ml centrifugrör.
  4. Tillsätt 500 μL isopropylalkohol och blanda proverna försiktigt med inversion och lämna sedan proverna i 20 minuter på isen. Centrifugera vid 14 000 x g vid 4 ° c i 8 min och avlägsna supernatanten.
  5. Omsuspendera varje pellets i 1 mL 75% EtOH, och centrifugera vid 14 000 x g vid 4 ° c i 5 min. ta bort alla supernatanten.
  6. Upprepa steg 2,5 en gång. Torka pellets i 6 min vid rumstemperatur. Torka inte längre; Annars kan det vara svårt att lösa upp RNA-pelleten i nästa steg.
  7. Lös den torkade RNA-pelleten i 25 μL DEPC (diethylpyrokarbonat)-behandlat vatten och håll röret på is. Använd RNA-prover inom 24 timmar.

3. cDNA bibliotek generation av omvänd Transkription

  1. Förbered en reaktionsblandning för varje RNA-prov med hjälp av ett kommersiellt omvänd transkriptionssystem med en 10 μL pipett: Tillsätt 4 μL av MgCl2 -lösningen, 2 μl 10X reaktionsbuffert, 2 μl dNTP-lösning, 0,5 μl av rnashämmare, 0,7 μl AMV omvänt Transkriptas, 0,5 μL oligo (dT) 15 primer, 1 μL av det extraherade RNA-provet och 9,3 μL H2O i ett 300 μl PCR-rör.
  2. Inkubera blandningen i en PCR ThermoCycler för 60 min vid 42 ° c, och sedan öka temperaturen till 95 ° c i 5 min.
  3. Förvara det genererade cDNA-biblioteket i upp till 12 månader vid-20 ° c.

4. mitokondriell genamplifiering och rening

  1. Förbered PCR-blandningen med en 10 μL pipett. Tillsätt 0,25 μL (1,25 U) av HiFi-DNA-polymeras, 2 μL dNTP-lösning (2,5 mM från varje dNTP), 0,5 μL av COX1 eller ND Forward primer (100 μM), 0,5 μL av motsvarande COX1 eller ND Reverse primer (100 μM), 1 μL av cDNA-biblioteket 5 μL 5x buffertlösning och 16 μL destillerat H2O till ett 300 μl PCR-rör.
  2. Utför PCR-amplifieringen med hjälp av följande parametrar: efter ett initialt denatureringstesteg vid 95 ° c (varaktighet 5 min), 35 PCR-reaktionscykler bestående av ett glödgningssteg vid 55 ° c (30 s), tupp-steg vid 72 ° c (2 min) och denatureringssteg vid 95 ° c (30 s) utför ett slutförande steg på 5 min vid 72 ° c.
  3. Använd 5 μL av PCR-produkten för att kontrollera med agaros gel elektrofores kvaliteten på den erhållna PCR-produkten. Observera förstärks COX1 eller nd gen som ett enda band vid antingen 759 eller 748 bas par, respektive.
  4. Rena resten av PCR-produkten med en PCR Clean-up kit.
    1. Tillsätt 100 μL lösning "PCR-A" (DNA-bindningsbuffert som innehåller höga koncentrationer av chaotropic salter11) i provet. Vortexta kort för att blanda innehållet.
    2. Placera renings kolonnen i ett 2 mL centrifugerör. Pipettera reaktionsblandningen av 4.4.1. i kolumnen. Centrifugera vid 14 000 x g i 1 min vid rumstemperatur.
    3. Kassera filtratet från centrifugerröret. Returnera kolonnen till 2 mL centrifugertub, tillsätt 700 μL lösning "W2" i kolonnen och centrifugera vid 14 000 x g i 1 min vid rumstemperatur ("W2" är en tvättlösning som innehåller höga halter av etanol för avlägsnande av kvarvarande chaotropic salter från renings kolonnen).
    4. Kassera filtratet och returnera kolonnen till 2 mL centrifugertub. Tillsätt 400 μL lösning "W2" till kolonnen och centrifugera vid 14 000 x g i 1 min vid rumstemperatur.
    5. Förvärm 1 mL avjoniserat vatten till 65 ° c i en metall block värmare. Överför kolonnen till ett nytt 1,5 mL centrifugeringsrör. Pipettera 25 μL av 65 ° c hett förvärmd avjoniserat vatten till mitten av det vita kolonnmembranet. Låt membranet suga i 1 min vid rumstemperatur.
    6. Centrifugera vid 14 000 x g i 1 min vid rumstemperatur och kassera kolonnen.
  5. Förvara den renade PCR-produkten i upp till 12 månader vid-20 ° c.

5. sekvensering och jämförelse av mitokondriell gen

  1. Skicka de renade PCR-proverna från steg 4,5 för Sanger-sekvensering med relevanta COX1 eller ND Forward primers som sekvensering primers. Alternativt kan COX1 eller ND omvänd primers även användas för dubbelriktad sekvensering.
  2. När du har Hämta sekvenserings resultaten jämför du sekvenserna med genomsekvensen i Pacific Oyster referensstam (NCBI taxonomy ID: 29159) med hjälp av NCBI nucleotide BLAST online Tool (blast.ncbi.nlm.nih.gov) (figur 2 och figur 3 ).

6. tillämpning av cDNA-biblioteket för kloning av gener MgUGD och MgUXS

  1. Amplifiera och rena MgUGD och MgUXS gener med hjälp av respektive framåt och bakåt primers av MgUGD och MgUXS genom PCR enligt steg 4,1. till 4,4.
  2. Överför 2 μL digestionsbuffert (10X koncentrerad) och 6 μL avjoniserat vatten till ett 1,5 mL centrifugeringsrör. Tillsätt 10 μL av de renade MgUGD-eller MgUXS PCR-produkterna tillsammans med begränsnings-endonukleaser NDU I och Xho I (1 μL vardera, 20 U). Inkubera vid 37 ° c i 3 timmar.
  3. Förbered den utan pET-30a vektor: överföring 500 ng av PET-30a vektor till en ny 1,5 ml Centrifugera röret och upp volymen till 16 μl med avjoniserat vatten. Tillsätt 2 μL digestionsbuffert (10X koncentrerad) tillsammans med begränsningen endonukleases NDU I och Xho I (1 μL vardera, 20 U).
    1. Tillsätt 1 μL alkaliskt fosfatas (1 U) och inkubera vid 37 ° c i ytterligare en timme efter inkuberingen av blandningen vid 37 ° c i 3 timmar. Inaktivera alkaliskt fosfatas genom upphettning vid 75 ° c i 10 minuter i en förvärmd metall block värmare.
  4. Överför 4 μL av de smälta MgUGD-eller MgUXS-DNA-produkterna till färska 1,5 mL centrifugrör och tillsätt 4 μL av den smälta pET-30a-vektorn. Tillsätt 1 μL Ligationsbuffert (10X), 1 μL T4 Ligase (3 U) och inkubera reaktionsblandningen vid 22 ° c i 3 timmar.
  5. Omvandla elektrokompetenta E. coli Mach1 kompetenta celler genom elektroporation med hjälp av ligering produkter. Sprid de transformerade cellerna på LB-agarplattor som innehåller 50 μg/mL kanamycin. Inkubera cellerna vid 37 ° c i 16 timmar.
  6. Kontrollera kolonier för önskad insättning med Sanger sekvensering med hjälp av plasmid-specifika T7 promotorn och terminatorprimers. Bered plasmider från validerade bakteriella kloner.

7. uttrycks-och aktivitetstest av MgUGD och MgUXS

  1. Omvandla E. coli BL21 (de3) kompetenta celler med plasmider som bär MgUGD-och MgUXS-gener och sprider de transformerade CELLERNA på lb-agar-plattor som innehåller 50 μg/ml kanamycin. Inkubera cellerna vid 37 ° c i 16 timmar.
  2. Odla en enda koloni i 5 mL LB-medium med 50 μg/mL kanamycin över natten. Överför kulturen till 400 mL LB-medium och skaka kontinuerligt vid 200 rpm vid en temperatur på 37 ° c tills den optiska densiteten vid en våglängd på 600 Nm (OD600) når en absorption av cirka 0,5.
    1. Sänk inkubations temperaturen till 20 ° c och tillsätt 400 μL isopropylβ-D-tiogalactopyranosid (koncentration 1 M). Inducera uttrycket av de rekombinanta proteinerna i 3 h.
  3. Skörd celler genom centrifugering vid 4 500 x g i 15 min vid 4 ° c. Suspendera pelletar i 10 mL lyseringsbuffert (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM fenylmetylsulfonylfluorid (PMSF), pH 8,0).
  4. Störa celler genom ultraljudsbehandling för 20 min (40 på/av cykler med 20 μm amplitud för 15 s vid 4 ° c). Centrifugera vid 14 000 x g vid 4 ° c i 20 min och samla supernatanten för aktivitetstestet.
  5. Utför aktivitets analysen av MgUGD genom att ruinera 2 μL av celllysatet med 2 μL UDP-glukos (10 mM), 4 μL av NAD+ (10mm), 4 μl av mgcl2 (10 mm), 2 μl Tris/HCl-buffert (500 mm, pH 7,5) och 6 μl avjoniserat H2O i en ny 1,5 mL Centrifugera tub och inkubera vid 37 ° c i 30 min.
  6. Utför aktivitets analysen av MgUXS genom att ruva in 2 μL av celllysatet med 2 μL UDP-glukuronsyra (10 mM), 2 μL Tris/HCl-buffert (500 mM, pH 7,5) och 14 μL avjoniserat H2O i ett nytt 1,5 ml centrifugertub och inkubera vid 37 ° c i 30 minuter.
  7. Släcka reaktionerna i steg 7,5 och 7,6 genom att tillsätta 20 μL metanol och 40 μL kloroform till varje blandning. Efter vortexa provet blandningar, Centrifugera vid 14 000 x g för 6 min vid 4 ° c och samla det övre vattenskiktet av varje rör.
  8. Analysera reaktionsprodukterna med MALDI-TOF masspektrometri i negativt joniseringsläge i m/z-området från 500-700. Blanda 1 μL prov blandning med 1 μL 2,5-dihydroxybensoesyra prov mat ris (1% w/V i 50% vattenhaltigt acetonitril). Observera de förväntade m/z-värdena vid 579 och 535 för UDP-glukuronsyra respektive UDP-Xylose (figur 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 visar en schematisk översikt över den beskrivna berednings metoden för det konvergent cDNA-biblioteket som kommer från Pacific Oyster-individer. Figur 2 visar SEKVENSER av COX1 och nd gener av ett avlägset besläktat ostron prov med hög avvikelse från COX1 och nd gen sekvenser av referensmaterialet. Figur 3 visar SEKVENSER av COX1 och nd gener av ett närbesläktat ostron prov med låg avvikelse från COX1 och nd gen sekvenser av referensmaterialet. Figur 4 visar den framgångsrika tillämpningen av cDNA biblioteket för att klona industriellt relevanta gener MgUGD och MgUXS.

Figure 1
Figur 1 : Schematisk översikt över den beskrivna analysmetoden för molekylär identifiering av Japanskt ostron prov använda COX1 och nd som referengener. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Sekvens justering av COX1 och nd gen sekvenser av en mycket avvikande prov jämfört med COX1 och nd gensekvenser från referens Japanskt ostron påfrestning. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Sekvens justering av COX1 och nd gen sekvenser av ett närbesläktat preparat jämfört med COX1 och nd gensekvenser från referens Japanskt ostron påfrestning. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Schematisk översikt över molekylär kloning, rekombinant uttryck och detektion av reaktionsprodukter av MgUGD och MgUXS. Vänligen klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det presenterade protokollet tillåter genetisk identifiering av orefererade ostron exemplar med liknande fenotyp från regionala skaldjursmarknader genom jämförelse av COX1 och ND gener med en allmänt tillgänglig Oyster DNA Genome databas. Betydelsen av denna metod ligger i dess enkelhet, eftersom endast en enda PCR-reaktion behövs för utvärderingen av det virtuella cDNA-biblioteket. De två bevarade mitokondrierna COX1 och ND gener förstärkallades från ett cDNA bibliotek som genererades av omvänd Transkription av RNA-extrakt från varje ostron. Metoden för RNA-isolering (steg 2,1) förenklades genom direkt slipning av ostronvävnaden i flytande kväve. Efter sekvensering av COX1 och ND gener av varje prov, sekvens anpassningar visade att vissa prover visar hög likhet med referens stammen. Den närmaste släktingen visade fullständig identitet för både COX1 och ND-genen sekvenser.

De mest kritiska stegen i denna procedur är RNA-extraktionssteget; för att minimera RNA-nedbrytning är det viktigt att minska tiden mellan skörd av ostron vävnad och RNA-extraktion.

Framgångsrik kloning exemplifierades nyligen genom kloning av Oyster UGE Gene12 och häri genom kloning av MgUGD och MgUXS gener13, som validerade det praktiska i det genererade cDNA biblioteket, vilket möjliggör kloning av ett antal gener av intresse utan behov av besvärliga klonings strategier med hjälp av urartade primers. Denna metod för molekylär identifiering genom förstärkning av COX1-och ND-gener för att generera praktiskt taget sekvenserade cDNA-bibliotek kan också användas i framtida tillämpningar för andra biologiska material som inte har fysiska prover av refererade genomer Tillgängliga.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Detta arbete stöddes delvis av Natural Science Foundation i Kina (Grant nummer 31471703, A0201300537 och 31671854 till J.V. och ll, Grant nummer 31470435 till G.Y.), och 100 utländska talanger plan (bidrags nummer JSB2014012 till J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics