En konvergerende strategi for generering af et næsten Sekvenserede cDNA-bibliotek fra ikke-refererede stillehavsøsters

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi beskriver en strategi for, hvordan man bruger RNA-prøver fra ikke-refererede stillehavsøsters prøver, og evaluerer det genetiske materiale i forhold til offentligt tilgængelige genomdata for at generere et næsten sekvenserede cDNA-bibliotek.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Adgang til biologisk materiale af reference arter, som tidligere blev anvendt i vigtige eksperimenter, såsom udvikling af nye cellelinjer eller genomsekvensering af projekter, er ofte vanskelige at give for yderligere undersøgelser eller tredjeparter på grund af af prøvernes forbruger karakter. Selv om de nu er bredt fordelt over Stillehavs kysterne i Asien, Australien og Nordamerika, er individuelle stillehavsøsters prøver genetisk meget forskellige og er derfor ikke direkte egnede som udgangsmateriale til genbiblioteker. I denne artikel viser vi brugen af ikke-refererede stillehavsøsters prøver opnået fra regionale fiskemarkeder for at generere cDNA-biblioteker. Disse biblioteker blev derefter sammenlignet med det offentligt tilgængelige østers genom, og det nærmeste relaterede bibliotek blev valgt ved hjælp af mitokondrie reference gener cytochrom C oxidase underenhed I (COX1) og NADH dehydrogenase (ND). Egnetheden af det genererede cDNA-bibliotek er også demonstreret ved kloning og ekspression af to gener, der koder enzymerne UDP-glucuronsyre dehydrogenase (UGD) og UDP-xylose syntase (UXS), som er ansvarlige for biosyntesen af UDP-xylose fra UDP-glucose.

Introduction

Erhvervelse af levende refereret biologisk materiale kan være udfordrende på grund af lange leveringstider, iværksætter tænkning eller landespecifikke toldbestemmelser. Alternativt kan det påkrævede biologiske materiale også indsamles fra fænotypiske identiske prøver. Disse prøver kan dog variere betydeligt med hensyn til genotype, og derfor bliver sammenligninger med digitalt lagrede reference genomer af samme art ofte vanskelige eller endda forgæves på grund af uforeneligheden af det nyindkøbte materiale med eksisterende DNA-forstærknings metoder. Sequencing meget bevaret gener af individuelle prøver er et meget anvendt og kraftfuldt værktøj til at identificere arter1, såsom bevaret mitokondrie gener, der ofte anvendes som reference gener for Kvalitetsvurderingen af cDNA-biblioteker2 ,3,4,5,6. Den tilgrundliggende begrundelse for den heri præsenterede metode er, at høj bevaring af mitokondrie-gensekvenser i individuelle anonyme østers prøver sammenlignet med de tilsvarende sekvenser af reference genomet indikerer, at andre gener også kan vise en lav grad af divergens, i betragtning af den generelt hurtigere rate af mitokondrie DNA evolution i forhold til nukleare DNA7, tillader forstærkning og isolering af en bred vifte af videnskabeligt og industrielt relevante gener ved blot at bruge offentligt tilgængelige sekvensering af data som reference.

Det overordnede mål med den heri beskrevne metode er at præsentere en optimeret arbejdsgang for at generere en næsten sekvenseret Oyster cDNA bibliotek, som kan bruges som skabelon DNA til kloning af østers gener. I virtuel sekvensering omgås de Novo genom sekvensering; i stedet bruges en kendt, digitalt lagret referencesekvens direkte til at udnytte eller designe primere til produktion af cdnas, der i sidste ende vil omfatte et bibliotek (eller blive føjet til en allerede eksisterende). Målet er at skabe et konvergerende cDNA-bibliotek, hvilket betyder, at ligheder mellem de genererede cDNA-sekvenser og reference sekvensen kan rangeres fra lav til høj divergens. En vigtig fordel ved at bruge cytochrom C oxidase underenhed 1 (COX1) og NADH dehydrogenase (ND) som reference gener er, at selv meget geografisk disjunct østers prøver kan profileret på grund af den høje bevaring af disse mitokondrie gener. Efter at have bevist tilgangen med disse veletablerede markører viser vi derefter dens anvendelse på to enzym kandidater, der er involveret i sukker nukleotid biosyntese og kan være af industriel relevans8,9, 10. det bioteknologiske potentiale i stillehavsøsters er stadig uudforsket. Derfor mener vi, at denne konvergerende metode til forberedelse af et næsten sekvenserede cDNA-bibliotek også vil være hensigtsmæssig for ikke-specialiserede forskere, der ønsker at generere cDNA fra dette relevante biologiske materiale.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bemærk: der vises en skematisk oversigt i figur 1.

1. indsamling af prøver

  1. Få østers prøver. Hold østers på is i løbet af perioden, transport og før laboratoriebrug og proces inden for 4-7 dage efter købet.
    Bemærk: for denne protokol blev østers købt fra Zhong Cai Wholesale Market i Nanjing (som kommer fra Ningde, Fujian, Kina og Lianyungang, Jiangsu, Kina), Haijie Aquatic Product Company i Qingdao (som kommer fra Qingdao, Shandong, China), Jucheng Vand produkt selskab i Yantai (stammer fra Yantai, Shandong, Kina) og Jinxiu akvatiske produkt selskab i Qingdao (med oprindelse i Qingdao, Shandong, Kina)).

2. RNA-isolation ved guanidinium-thiocyanat-phenol-ekstraktion

  1. Fremstilling af østers vævsprøve
    1. Skær ca. 100 mg homogen blødt væv ud fra det omtrentlige geometriske centrum for hver østers prøve med en steriliseret skalpel, og Overfør prøverne til flydende nitrogen.
    2. Euthanize den resterende del af østers ved frysning ved-80 °C i 1 time og kassér som biologisk affald.
    3. Sliber det flamme frosne østers væv i et fint pulver i en mørtel (200 mL) fyldt med 50 mL flydende nitrogen.
    4. 75 mg af hver prøvens frosne væv vejes ud i et sterilt 1,5 mL centrifugeglas, og der blandes med 1 mL guanidinium thiocyanat-phenol-ekstraktions reagens. Prøven centrifugeres ved 14.000 x g ved 4 °c i 15 minutter.
  2. Supernatanten overføres til et nyt 1,5 mL centrifugeglas, der tilsættes 200 μL chloroform og blandes grundigt ved hjælp af en vortex-mixer til 10-15 s, indtil blandingen bliver mælkeagtig-hvid.
  3. Der centrifugeres ved 14.000 x g ved 4 °c i 15 minutter, og det øvre vandige lag overføres forsigtigt med en 200 μl pipette uden at forstyrre interfasen i et nyt 1,5 ml centrifugeglas.
  4. Tilsæt 500 μL isopropylalkohol og bland prøverne forsigtigt ved inversion, og Efterlad derefter prøverne i 20 minutter på is. Centrifugeres ved 14.000 x g ved 4 °c i 8 min., og supernatanten fjernes.
  5. Resuspendér hver af pillerne i 1 mL 75% EtOH, og centrifugeres ved 14.000 x g ved 4 °c i 5 min. Fjern alle supernatanten.
  6. Gentag trin 2,5 én gang. Tør pillerne i 6 minutter ved stuetemperatur. Må ikke tørre i længere tid; ellers kan det være svært at opløse RNA-pellet i næste trin.
  7. Den tørrede RNA-pellet opløses i 25 μL DEPC-behandlet vand (diethylpyrocarbonat), og røret holdes på is. Brug RNA-prøver inden for 24 timer.

3. cDNA bibliotek generation ved reverse transskription

  1. For hver RNA-prøve forberedes en reaktionsblanding ved hjælp af et kommercielt omvendt transkriptionssystem med en pipette på 10 μL: Tilsæt 4 μL MgCl2 -opløsning, 2 μl 10x-reaktions buffer, 2 μl dntp-opløsning, 0,5 μl rnasehæmmer, 0,7 ΜL AMV-bagside Transkriptase, 0,5 μL oligo (dT) 15 primer, 1 μL af den ekstraherede RNA-prøve og 9,3 μL H2O til et 300 μl PCR-rør.
  2. Inkuber blandingen i en PCR-termocycler i 60 min ved 42 °C, og øg derefter temperaturen til 95 °C i 5 minutter.
  3. Opbevar det genererede cDNA-bibliotek i op til 12 måneder ved-20 °C.

4. mitokondrie genforstærkning og rensning

  1. Klargør PCR-blandingen ved hjælp af en pipette på 10 μL. Tilsæt 0,25 μL (1,25 U) high-fidelity DNA Polymerase, 2 μL dNTP opløsning (2,5 mM af hver dNTP), 0,5 μL af COX1 eller ND Forward primer (100 μM), 0,5 μL af den tilsvarende COX1 eller ND reverse primer (100 μM), 1 μL af cDNA-biblioteket , 5 μL 5x bufferopløsning og 16 μL destilleret H2O til et 300 μl PCR-rør.
  2. PCR-amplificeringen udføres ved hjælp af følgende parametre: efter et indledende Denaturerings trin ved 95 °C (varighed 5 min), 35 PCR-reaktions cyklusser bestående af et udglødnings trin ved 55 °C (30 s), forlænget trin ved 72 °C (2 min) og Denaturerings trin ved 95 °C (30 s) , Udfør et afslutnings trin i 5 minutter ved 72 °C.
  3. Brug 5 μL af PCR-produktet til at verificere med agrose gel elektroforese kvaliteten af det opnåede PCR-produkt. Overhold det forstærkede COX1 eller ND-gen som et enkelt bånd på henholdsvis 759 eller 748 basepar.
  4. Rengør resten af PCR-produktet med et PCR-oprydnings sæt.
    1. Der tilsættes 100 μL opløsning ' PCR-A ' (DNA-bindings buffer, som indeholder høje koncentrationer af chaotropic salte11) til prøven. Vortex kort for at blande indholdet.
    2. Placer rense søjlen i et 2 mL centrifugeglas. Afpipettere reaktionsblandingen af 4.4.1. i kolonnen. Centrifugeres ved 14.000 x g i 1 min. ved stuetemperatur.
    3. Filtratet kasseres fra centrifugeglasset. Kolonnen returneres til 2 mL centrifugerør, der tilsættes 700 μL opløsning ' W2 ' i kolonnen og centrifugeres ved 14.000 x g i 1 min ved stuetemperatur (' W2 ' er en vaskeopløsning, som indeholder høje koncentrationer af ethanol til fjernelse af rest- salte fra rense søjlen).
    4. Filtratet kasseres, og kolonnen returneres til 2 mL centrifugeglasset. Tilsæt 400 μL opløsning ' W2 ' til kolonnen og centrifugeres ved 14.000 x g i 1 min ved stuetemperatur.
    5. Forvarm 1 mL deioniseret vand til 65 °C i et metalblok varmelegeme. Kolonnen overføres til et nyt 1,5 mL centrifugeglas. Afpipetteres 25 μL af 65 °C varmt foropvarmet deioniseret vand til midten af den hvide søjle membran. Lad membranen suge i 1 minut ved stuetemperatur.
    6. Centrifuge ved 14.000 x g i 1 min ved stuetemperatur og kassér søjlen.
  5. Det rensede PCR-produkt opbevares i op til 12 måneder ved-20 °C.

5. mitokondrie-gensekvensering og sammenligning

  1. Send de rensede PCR-prøver fra trin 4,5 til sanger sekvensering ved hjælp af de relevante COX1 eller nd Forward primere som sekventering primere. Eventuelt kan COX1 eller nd reverse primere også bruges til tovejs sekvensering.
  2. Når du har hentet sekvens resultaterne, Sammenlign sekvenserne med genom-sekvensen af Pacific Oyster-reference stammen (NCBI-taksonomi-id: 29159) ved hjælp af NCBI nucleotid blast online Tool (blast.NCBI.NLM.NIH.gov) (figur 2 og figur 3 ).

6. anvendelse af cDNA-biblioteket til kloning af gener MgUGD og MgUXS

  1. Amplificere og rense MgUGD og MgUXS gener ved hjælp af de respektive Forward og reverse primere af MgUGD og MgUXS ved PCR efter trin 4,1. til 4,4.
  2. Der overføres 2 μL fordøjelses buffer (10x koncentreret) og 6 μL deioniseret vand til et 1,5 mL centrifugeglas. Tilsæt 10 μL af de rensede MgUGD-eller MgUXS PCR-produkter sammen med restriktionen endonukleaser NDE I og Xho I (1 μL hver, 20 e). Inkuber ved 37 °C i 3 timer.
  3. Forbered den fordigtede pET-30A-vektor: Overfør 500 ng af pET-30A-vektoren til et nyt 1,5 mL centrifugeglas, og Skru op for lydstyrken til 16 μL med deioniseret vand. Tilsæt 2 μL fordøjelses buffer (10x koncentreret) sammen med restriktionen endonukleaser NDE I og Xho I (1 μL hver, 20 e).
    1. Efter inkubatering af blandingen ved 37 °C i 3 timer tilsættes 1 μL alkalisk fosfatase (1 e) og Inkuber ved 37 °C i en ekstra time. Inaktivér alkalisk fosfatase ved opvarmning ved 75 °C i 10 minutter i en forvarmet metalblok varmer.
  4. 4 μL af de Ford øjede MgUGD-eller MgUXS-DNA-produkter overføres til friske 1,5 mL centrifugeglas og tilsættes 4 μL af den fordøjet pET-30A-vektor. Tilsæt 1 μL Ligations buffer (10x), 1 μL T4-ubiquitinligase (3 e) og Inkubér reaktionsblandingen ved 22 °C i 3 timer.
  5. Transformere elektro kompetente E. coli Mach1 kompetente celler ved elektroporation ved hjælp af ligations produkterne. De transformerede celler spredes på LB-agarplader indeholdende 50 μg/mL kanamycin. Inkubatceller ved 37 °C i 16 timer.
  6. Bekræft kolonierne for den ønskede indsættelse af sanger sekvensering ved hjælp af plasmid-specifikke T7 promoter og Terminator Primers. Forbered plasmider fra de validerede bakterielle kloner.

7. udtryks-og aktivitets tests af MgUGD og MgUXS

  1. Omdanne E. coli BL21 (DE3) kompetente celler med plasmider, der bærer MgUGD og MgUXS gener og sprede de transformerede celler på lb agar plader indeholdende 50 μg/ml kanamycin. Inkubatceller ved 37 °C i 16 timer.
  2. Dyrke en enkelt koloni i 5 mL LB medium med 50 μg/mL kanamycin natten over. Kulturen overføres til 400 mL LB-medium og rystes kontinuerligt ved 200 rpm ved en temperatur på 37 °C, indtil den optiske tæthed ved en bølgelængde på 600 nm (OD600) når en absorption på ca. 0,5.
    1. Inkubations temperaturen skal reduceres til 20 °C, og 400 μL isopropyl β-D-thiogalactopyranosid (koncentration 1 M) tilsættes. Inducerer de rekombinante proteiner i 3 timer.
  3. Høst cellerne ved centrifugering ved 4.500 x g i 15 min ved 4 °c. Træpiller suspenderes i 10 mL lysisbuffer (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl-fluorid (PMSF), pH 8,0).
  4. Forstyrre celler ved sonikering i 20 min (40 on/off cyklusser med 20 μm amplitude for 15 s ved 4 °C). Centrifugeres ved 14.000 x g ved 4 °c i 20 minutter og opsamles supernatanten til aktivitets testen.
  5. Udføre aktivitets analysen af MgUGD ved at inkube 2 μL af celle lysatet med 2 μL UDP-glucose (10 mM), 4 μL NAD+ (10mm), 4 μl mgcl2 (10 mm), 2 μl Tris/HCL buffer (500 mm, pH 7,5) og 6 ΜL deioniseret H2O i en ny 1,5 mL centrifugeglas og Inkuber ved 37 °C i 30 min.
  6. Udfør aktivitets analysen af MgUXS ved at inkubere 2 μL af celle lysatet med 2 μL UDP-glucuronsyre (10 mM), 2 μL Tris/HCl-buffer (500 mM, pH 7,5) og 14 μL deioniseret H2O i et nyt 1,5 ml centrifugeglas og inkuber ved 37 °c i 30 min.
  7. Reaktionen slukkes i trin 7,5 og 7,6 ved tilsætning af 20 μL methanol og 40 μL chloroform til hver blanding. Efter vortexning af prøve blandingerne centrifugeres ved 14.000 x g i 6 minutter ved 4 °c og opsamles det øvre vandige lag af hvert rør.
  8. Analysér reaktionsprodukterne ved hjælp af MALDI-TOF massespektrometri i negativ ioniserings tilstand i m/z-intervallet fra 500-700. 1 μL prøveblanding blandes med 1 μL 2,5-dihydroxybenzoesyre prøve matrix (1% w/V i 50% vandig acetonitril). Overhold de forventede m/z-værdier ved 579 og 535 for henholdsvis UDP-glucuronsyre og UDP-xylose (figur 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 viser en skematisk oversigt over den beskrevne tilberedningsmetode for det konvergerende cDNA-bibliotek afledt af stillehavsøsters individer. Figur 2 viser sekvenser af COX1 og nd-gener fra en fjernt beslægtet østers prøve med stor divergens fra referencematerialets COX1-og nd-gensekvenser. Figur 3 viser SEKVENSER af COX1 og nd-gener fra en nært beslægtet østers prøve med lav afvigelse fra referencematerialets COX1-og nd-gensekvenser. Figur 4 viser den vellykkede anvendelse af cDNA-biblioteket for at klone de industrielt relevante gener MgUGD og MgUXS.

Figure 1
Figur 1 : Skematisk oversigt over den beskrevne analysemetode for Molekylær identifikation af Stillehavsøsters model ved hjælp af COX1 og nd som reference gener. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Sekvens justering af COX1-og nd-gensekvensen af en meget divergerende prøve sammenlignet med de COX1-og nd-gensekvenser fra reference Pacific Oyster stamme. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Sekvens justering af COX1-og nd-gensekvensen af en nært beslægtet enhed sammenlignet med de COX1 og nd-gensekvenser fra reference Pacific Oyster stamme. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Skematisk oversigt over Molekylær kloning, rekombinant udtryk og påvisning af reaktionsprodukter af MgUGD og MgUXS. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den præsenterede protokol giver mulighed for genetisk identifikation af ikke-refererede østers prøver med lignende fænotype fra regionale fiskemarkeder ved sammenligning af COX1 og ND-gener med en offentligt tilgængelig Oyster DNA-genom-database. Betydningen af denne metode ligger i dens enkelhed, da kun en enkelt PCR-reaktion er nødvendig for evalueringen af det virtuelle cDNA-bibliotek. De to bevaret mitokondrie COX1 og ND gener blev forstærket fra et cDNA-bibliotek, som blev genereret ved omvendt transskription af RNA-ekstrakter fra hver østers. Metoden til RNA-isolation (trin 2,1) blev forenklet ved direkte slibning af østers vævet i flydende nitrogen. Efter sekventering af COX1 og ND-generne i hver prøve viste sekvens justeringer, at nogle prøver udviser stor lighed med reference stammen. Den nærmeste relative viste fuldstændig identitet af både COX1 og ND gen sekvenser.

De mest kritiske trin i denne procedure er RNA-ekstraktions trinnet. for at minimere RNA nedbrydning er det vigtigt at reducere tiden mellem høst af østers vævet og RNA ekstraktion.

Vellykket kloning blev for nylig eksemplificeret ved at klone østers UGE gene12 og heri ved at klone MgUGD og MgUXS Genes13, som validerede det praktiske i det genererede cDNA-bibliotek, hvilket tillod kloning af et vilkårligt antal gener af interesse uden behov for besværlige klonings strategier ved hjælp af degenererede primere. Denne metode til molekylær identifikation ved forstærkning af de COX1 og ND gener til at generere næsten sekvenserede cDNA-biblioteker kan også anvendes i fremtidige anvendelser for andre biologiske materialer, der ikke har fysiske prøver af refererede genomer Tilgængelige.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Dette arbejde blev delvist støttet af Kinas naturvidenskabelige fundament (tilskudsnummer 31471703, A0201300537 og 31671854 til J.V. og L.L., tilskudsnummer 31470435 til G.Y.) og 100-planen for udenlandske talenter (tilskuds nummeret JSB2014012 til J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics