En sammenfallende strategi for generering av en nesten sekvensielt cDNA bibliotek fra ubrukte Pacific østers

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi beskriver en strategi for hvordan du bruker RNA prøver fra ubrukte Pacific østers prøver, og evaluere genetisk materiale ved sammenligning med offentlig tilgjengelige Genova data for å generere et tilnærmet sekvensielt cDNA bibliotek.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tilgangen til biologisk materiale av referanse arter, som ble brukt tidligere i viktige eksperimenter som i utviklingen av romanen cellelinjer eller Genova sekvensering prosjekter, er ofte vanskelig å sørge for videre studier eller tredjeparter på grunn av consumptive natur. Selv nå vidt distribuert over Stillehavet kysten av Asia, Australia og Nord-Amerika, individuelle Stillehavet østers prøver er genetisk ganske mangfoldig, og er derfor ikke direkte egnet som utgangspunkt materiale for gen biblioteker. I denne artikkelen viser vi bruken av ubrukte Pacific østers prøver Hentet fra regionale sjømatmarkeder å generere cDNA biblioteker. Disse bibliotekene ble deretter sammenlignet med offentlig tilgjengelige østers Genova, og den nærmeste relaterte biblioteket ble valgt ved hjelp av mitokondrie referanse gener Cytokrom C oksidase delenhet I (COX1) og NADH dehydrogenase (ND). Egnetheten av den genererte cDNA biblioteket er også demonstrert ved kloning og uttrykk for to gener koding av enzymer UDP-glucuronic acid dehydrogenase (UGD) og UDP-xylose syntase (UXS), som er ansvarlig for biosyntesen av UDP-xylose fra UDP-glukose.

Introduction

Oppkjøpet av levende refererte biologisk materiale kan være utfordrende på grunn av lange leveringstider, entreprenør resonnement, eller landsspesifikke tollregler. Som et alternativ kan det nødvendige biologiske materialet også samles inn fra phenotypically identiske prøver. Imidlertid kan disse prøvene variere betydelig på nivået av genotype, og derfor sammenligninger med digitalt lagrede referanse genomer av samme art er ofte gjengitt vanskelig eller fåfengt på grunn av inkompatibilitet av den nylig Hentet materiale med eksisterende metoder for DNA-forsterkning. Sekvensering svært bevarte gener av individuelle prøver er en mye brukt og kraftig verktøy for å identifisere arter1, for eksempel bevarte mitokondrie gener som ofte brukes som referanse gener for kvalitetsvurdering av cDNA biblioteker2 ,3,4,5,6. Den underliggende begrunnelsen for heri presentert metoden er at høy bevaring av mitokondrie gen sekvenser i enkelte anonyme østers prøver i forhold til tilsvarende sekvenser av referansen Genova indikerer at andre gener kan også vise en lavt nivå av avvik, gitt den generelt raskere rate av mitokondrie DNA evolusjon i forhold til kjernefysisk DNA7, slik at forsterkning og isolering av et bredt spekter av vitenskapelig og industrielt relevante gener ved å bruke offentlig tilgjengelige sekvensering-data som en referanse.

Det overordnede målet for det her er beskrevet metoden er å presentere en optimalisert arbeidsflyt for å generere en tilnærmet sekvensert østers cDNA bibliotek som kan brukes som mal DNA for kloning av østers gener. I virtuelle sekvensering, de Novo Genova sekvensering er omgås; stedet, en kjent, digitalt lagret referanse sekvens brukes direkte til å utnytte eller design primere for produksjon av cDNAs som til slutt vil utgjøre et bibliotek (eller legges til en eksisterende en). Målet er å produsere et konvergent cDNA-bibliotek, som betyr at likheter mellom de genererte cDNA-sekvensene og referanse sekvensen kan rangeres fra lav til høy avvik. En viktig fordel ved å bruke Cytokrom C oksidase delenhet 1 (COX1) og NADH dehydrogenase (ND) som referanse gener er at selv svært geografisk endemisk østers prøver kan bli profilert på grunn av den høye bevaring av disse mitokondrie gener. Etter å ha bevist tilnærming med disse veletablerte markører, vi da demonstrere sin søknad til to enzym kandidater som er involvert i sukker nukleotid biosyntesen og kan være av industriell relevans8,9, 10. The bioteknologisk potensialet i Stillehavet østers er fortsatt uutforsket. Derfor tror vi at dette sammenfallende metode for å utarbeide et tilnærmet sekvensielt cDNA biblioteket vil også være hensiktsmessig for ikke-spesialiserte forskere som ønsker å generere cDNA fra denne relevante biologiske materialet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Merk: en skjematisk oversikt er vist i figur 1.

1. samling av eksempler

  1. Skaff østers prøver. Hold østers på isen i kombinasjonen perioden, transport og før laboratoriebruk og prosess innen 4-7 dager etter kjøpet.
    Merk: for denne protokollen, ble østers kjøpt fra Zhong Cai Wholesale Market i Nanjing (stammer fra Ningde, Fujian, Kina og Lianyungang, Jiangsu, Kina), Haijie Aquatic Product Company i Qingdao (kommer fra Qingdao, Shandong, Kina), Jucheng Akvatisk produkt selskap i Yantai (stammer fra Yantai, Shandong, Kina) og Jinxiu Aquatic Product Company i Qingdao (kommer fra Qingdao, Shandong, Kina)).

2. RNA-isolasjon ved guanidiniumklorid ammoniumthiocyanat-ekstraksjon av fenol

  1. Utarbeidelse av østers vev prøve
    1. Skjær ut ca 100 mg av homogen bløtvev fra omtrentlig geometriske sentrum av hver østers prøve med en sterilisert skalpell, og overføre prøvene i flytende nitrogen.
    2. Euthanize den resterende delen av østers ved å fryse ved-80 ° c for 1 time og kast som biologisk avfall.
    3. Grind Flash-frosne østers vev inn i et fint pulver i en mørtel (200 mL) fylt med 50 mL flytende nitrogen.
    4. Veie ut 75 mg av hver prøve ' s frosne vev i et sterilt 1,5 mL sentrifugerør og bland med 1 mL av guanidiniumklorid ammoniumthiocyanat-fenol utvinning reagens. Sentrifuger prøven ved 14 000 x g ved 4 ° c i 15 min.
  2. Overfør supernatanten til et nytt 1,5 mL sentrifugerør, tilsett 200 μL av kloroform og bland godt ved å bruke en Vortex mikser for 10-15 s til blandingen blir melkeaktig-hvit.
  3. Sentrifuger ved 14 000 x g ved 4 ° c i 15 min, og Overfør det øvre, vandige laget forsiktig med en 200 μL pipette uten å forstyrre Interphase til et nytt 1,5 ml sentrifugerør.
  4. Tilsett 500 μL av isopropylalkohol alkohol og bland prøvene forsiktig ved inversjon, deretter la prøvene i 20 min på isen. Sentrifuger ved 14 000 x g ved 4 ° c i 8 min og fjern supernatanten.
  5. Resuspend hver av pellets i 1 mL 75% EtOH, og sentrifuger ved 14 000 x g ved 4 ° c i 5 min. Fjern alle supernatanten.
  6. Gjenta trinn 2,5 én gang. Tørk pellets i 6 minutter ved romtemperatur. Må ikke tørke lenger; ellers kan det være vanskelig å oppløse RNA pellet i neste trinn.
  7. Løs opp den tørkede RNA-pellet-en i 25 μL av DEPC (diethylpyrocarbonate)-behandlet vann og hold slangen på is. Bruk RNA-prøver innen 24 timer.

3. cDNA biblioteket generasjon av omvendt transkripsjon

  1. For hvert RNA-utvalg klargjør du en reaksjons blanding ved hjelp av et kommersielt omvendt transkripsjon-system med en 10 μL pipette: tilsett 4 μL av MgCl2 -løsning, 2 μL av 10X reaksjons buffer, 2 μL av dNTP-oppløsning, 0,5 μL av RNase-hemmer, 0,7 ΜL av AMV reverse Transkriptase, 0,5 μL av oligo (dT) 15 primer, 1 μL av den utpakkede RNA-prøven og 9,3 μL av H2O i en 300 μL PCR-tube.
  2. Ruge blanding i en PCR-Thermocycler for 60 min ved 42 ° c, og deretter øke temperaturen til 95 ° c i 5 min.
  3. Oppbevar det genererte cDNA-biblioteket i opptil 12 måneder ved-20 ° c.

4. mitokondrie gen forsterkning og rensing

  1. Klargjør PCR-blandingen med 10 μL pipette. Tilsett 0,25 μL (1,25 U) av høykvalitets DNA-polymerase, 2 μL av dNTP-oppløsning (2,5 mM av hver dNTP), 0,5 μL av COX1 eller ND forover primer (100 μM), 0,5 μL av tilsvarende COX1 eller ND revers (100 μM), 1 μL av cDNA-biblioteket , 5 μL av 5x buffer løsning og 16 μL av destillert H2O i en 300 μL PCR tube.
  2. Utfør PCR-forsterkningen ved hjelp av følgende parametre: etter et innledende denaturering trinn ved 95 ° c (varighet 5 min), 35 PCR reaksjons sykluser bestående av et annealing trinn ved 55 ° c (30 s), forlengelse trinn ved 72 ° c (2 min), og denaturering trinn ved 95 ° c (30 s) , utføre en fullfører forlengelse trinn i 5 min ved 72 ° c.
  3. Bruk 5 μL av PCR-produktet for å verifisere ved agarose gel elektroforese kvaliteten på det oppnådde PCR-produktet. Observer forsterket COX1 eller ND genet som et enkelt bånd på enten 759 eller 748 base parene, henholdsvis.
  4. Rens resten av PCR-produktet med et PCR oppryddings sett.
    1. Tilsett 100 μL av oppløsning "PCR-A" (DNA binding buffer som inneholder høye konsentrasjoner av chaotropic alter11) til prøven. Vortex en kort stund for å blande innholdet.
    2. Plasser rense Kol onnen i et 2 mL sentrifugerør. Pipetter reaksjonsblandingen av 4.4.1. inn i kolonnen. Sentrifuger ved 14 000 x g i 1 min ved romtemperatur.
    3. Kast Filtrer fra sentrifuge røret. Returner kolonnen til 2 mL sentrifuge røret, tilsett 700 μL av løsningen "W2" inn i kolonnen og sentrifuger ved 14 000 x g i 1 min ved romtemperatur ("W2" er en vaskeløsning som inneholder høye konsentrasjoner av etanol for fjerning av gjenværende chaotropic salter fra rense søylen).
    4. Kast Filtrer og returner kolonnen til 2 mL sentrifuge slangen. Tilsett 400 μL av løsningen "W2" til kolonnen og sentrifuger ved 14 000 x g i 1 min ved romtemperatur.
    5. Pre-Heat 1 mL deionisert vann til 65 ° c i en metall blokk Varmeapparat. Overfør kolonnen til et nytt 1,5 mL sentrifugerør. Pipetter 25 μL av 65 ° c varm forvarmet deionisert vann til midten av den hvite Kol onne membranen. La membranen suge i 1 min ved romtemperatur.
    6. Sentrifuger på 14 000 x g for 1 min ved romtemperatur og kast kolonnen.
  5. Oppbevar renset PCR-produktet i opptil 12 måneder ved-20 ° c.

5. mitokondrie gen sekvensering og sammenligning

  1. Send renset PCR prøvene fra trinn 4,5 for sanger sekvensering bruker relevante COX1 eller ND fremover primere som sekvensering primere. Alternativt kan COX1 eller ND omvendt grunning også brukes for toveis sekvensering.
  2. Etter henting av sekvensering resultater, sammenligne sekvenser med Genova sekvensen av Stillehavet østers referanse belastning (NCBI taksonomi ID: 29159) ved hjelp av NCBI nukleotid BLAST online verktøyet (blast.ncbi.nlm.nih.gov) (figur 2 og Figur 3 ).

6. Bruk av cDNA biblioteket for kloning av gener MgUGD og MgUXS

  1. Forsterke og rense MgUGD og MgUXS gener ved hjelp av de respektive fremover og omvendt grunning av MgUGD og MgUXS av PCR følgende trinn 4,1. til 4,4.
  2. Overfør 2 μL av fordøyelses buffer (10x konsentrert) og 6 μL av deionisert vann i et 1,5 mL sentrifugerør. Tilsett 10 μL av renset MgUGD eller MgUXS PCR-produkter sammen med begrensningen endonucleases NDE I og Xho I (1 μL hver, 20 U). Ruge ved 37 ° c for 3 h.
  3. Forbered predigested pET-30A vektor: Overfør 500 ng av pET-30A-vektoren til et nytt 1,5 mL sentrifugerør og fylle opp volumet til 16 μL ved hjelp av deionisert vann. Tilsett 2 μL av fordøyelsen buffer (10x konsentrert) sammen med begrensningen endonucleases NDE I og Xho I (1 μL hver, 20 U).
    1. Etter incubating av blandingen ved 37 ° c i 3 h, tilsett 1 μL alkalisk fosfatase (1 U) og ruge ved 37 ° c i en ekstra time. Deaktiver alkalisk fosfatase ved oppvarming ved 75 ° c i 10 min i en forvarmet metall blokk varmer.
  4. Overfør 4 μL av de fordøyd MgUGD-eller MgUXS DNA-produktene til friske 1,5 mL sentrifugerør og tilsett 4 μL av den fordøyd pET-30A-vektoren. Tilsett 1 μL av ligation buffer (10x), 1 μL av T4 ligase (3 U) og ruge reaksjonsblandingen ved 22 ° c i 3 timer.
  5. Transform electrocompetent E. coli Mach1 kompetente celler ved electroporation ved hjelp av ligation produkter. Spre transformert cellene på LB agar plater som inneholder 50 μg/mL kanamycin. Ruge celler ved 37 ° c i 16 timer.
  6. Verifisere kolonier for ønsket innsetting av sanger sekvensering ved hjelp av plasmider-spesifikke T7 promoter og Terminator primere. Forbered plasmider fra de validerte bakterielle kloner.

7. uttrykks-og aktivitets tester av MgUGD og MgUXS

  1. Transform E. coli BL21 (DE3) kompetente celler med plasmider bærer MgUGD og MgUXS gener og spre transformert celler på lb agar plater inneholder 50 μg/ml kanamycin. Ruge celler ved 37 ° c i 16 timer.
  2. Dyrke en enkelt koloni i 5 mL LB medium med 50 μg/mL kanamycin over natten. Overfør kulturen til 400 mL LB medium og kontinuerlig rist ved 200 RPM ved en temperatur på 37 ° c til den optiske tettheten ved en bølgelengde på 600 NM (OD600) når en absorpsjon på ca 0,5.
    1. Reduser inkubasjons temperatur til 20 ° c og tilsett 400 μL av isopropylalkohol β-D-thiogalactopyranoside (konsentrasjon 1 M). Indusere uttrykket av rekombinant proteiner for 3 t.
  3. Harvest celler ved sentrifugering ved 4 500 x g i 15 min ved 4 ° c. Suspendere pellets i 10 mL lyseringsbuffer (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl-fluor (PMSF), pH 8,0).
  4. Forstyrre celler ved sonikering i 20 min (40 av/på-sykluser med 20 μm amplitude i 15 s ved 4 ° c). Sentrifuger ved 14 000 x g ved 4 ° c i 20 min og samle supernatanten for aktivitets testen.
  5. Utfør aktivitets analysen av MgUGD ved incubating 2 μL av celle lysat med 2 μL av UDP-glukose (10 mM), 4 μL av NAD+ (10mm), 4 μL av MgCl2 (10 mm), 2 μL av Tris/HCL buffer (500 mm, pH 7,5), og 6 μL av deionisert H2O i en ny 1,5 mL sentrifugerør og ruge ved 37 ° c i 30 min.
  6. Utfør aktivitets analysen av MgUXS ved å incubating 2 μL av celle lysat med 2 μL UDP-glucuronic-syre (10 mM), 2 μL av Tris/HCl-buffer (500 mM, pH 7,5) og 14 μL av deionisert H2O i et nytt 1,5 ml sentrifugerør og ruge ved 37 ° c i 30 min.
  7. Slukke reaksjonene i trinn 7,5 og 7,6 ved å tilsette 20 μL av metanol og 40 μL av kloroform til hver blanding. Etter virvlingen prøven blandinger, sentrifuge ved 14 000 x g for 6 min ved 4 ° c og samle øvre vandige lag av hvert rør.
  8. Analyser reaksjons produktene ved hjelp av MALDI-TOF masse massespektrometri i negativ ionisering modus i m/z-området fra 500-700. Bland 1 μL av prøve blandingen med 1 μL 2, 5-dihydroxybenzoic syre prøve matrise (1% w/V i 50% vandig acetonitril). Observer de forventede m/z-verdiene på 579 og 535 for henholdsvis UDP-glucuronic acid og UDP-xylose (Figur 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 viser en skjematisk oversikt over de beskrevne forberedelse metoden for konvergent cDNA biblioteket avledet fra Stillehavet østers individer. Figur 2 viser SEKVENSER av COX1 og nd gener av en fjernt relatert østers prøve med høy avvik fra COX1 og nd gen sekvenser av referansematerialet. Figur 3 viser SEKVENSER av COX1 og nd gener av et nært beslektet østers prøve med lav avvik fra COX1 og nd gen sekvenser av referansematerialet. Figur 4 viser vellykket anvendelse av cDNA biblioteket for å klone industrielt relevante gener MgUGD og MgUXS.

Figure 1
Figur 1 : Skjematisk oversikt over den beskrevne analysemetoden for molekylær identifisering av Pacific østers prøven bruke COX1 og nd som referanse gener. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Sekvens justering av COX1 og nd gen sekvenser av en høyt avvikende prøve sammenlignet med COX1 og nd gen sekvenser fra referansen Pacific østers belastning. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Sekvens justering av COX1-og nd-genet sekvenser av et nært beslektet eksemplar sammenlignet med COX1 og nd gen sekvenser fra referansen Pacific østers belastning. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Skjematisk oversikt over molekylær kloning, rekombinant uttrykk og påvisning av reaksjons produkter av MgUGD og MgUXS. Vennligst klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det forevist protokollen innrømmer det genetisk legitimasjonen av ubrukte østers prøver med lignende fenotype fra område Seafood marked av sammenligningen av det COX1 og ND gener med en offentlig anvendelig østers DNA Genova data bank. Betydningen av denne metoden ligger i sin enkelhet, som bare en enkelt PCR reaksjon er nødvendig for evalueringen av den virtuelle cDNA biblioteket. De to bevarte mitokondrie COX1 og ND gener ble forsterket fra en cDNA bibliotek som ble generert av omvendt transkripsjon av RNA ekstrakter fra hver østers. Metoden for RNA-isolering (trinn 2,1) ble forenklet ved å slipe østers vevet i flytende nitrogen direkte. Etter sekvensering av COX1 og ND gener av hver prøve, sekvens justeringer avdekket at noen prøver viser høy likhet med referanse belastningen. Den nærmeste slektning viste fullstendig identitet for både COX1 og ND gen sekvensene.

De mest kritiske trinnene i denne prosedyren er RNA utvinning trinn; for å minimere RNA-degradering er det viktig å redusere tiden mellom høsting av østers vev og RNA-ekstraksjon.

Vellykket kloning ble nylig et eksempel på ved kloning av østers UGE genet12 og heri ved kloning av MgUGD og MgUXS gener13, som validerte den praktiske av den genererte cDNA biblioteket, slik at kloning av en rekke gener av interesse uten behov for tungvint kloning strategier ved hjelp av utartet primere. Denne metoden for molekylær identifisering av forsterkning av COX1 og ND gener for å generere tilnærmet sekvensielt cDNA bibliotekene kan også brukes i fremtidige søknader om andre biologiske materialer som ikke har fysiske prøver av refererte genomer Tilgjengelig.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Dette arbeidet ble støttet delvis av Natural Science Foundation i Kina (gi tall 31471703, A0201300537 og 31671854 til J.V. og ll, gi nummer 31470435 til G.Y.), og den 100 Foreign talenter plan (Grant nummer JSB2014012 til J.V.).

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics