Referansta bulunmadığı Pasifik Istiridyeleri neredeyse sıralı cDNA Kütüphanesi üretimi için bir converging stratejisi

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Başvurulmayan Pasifik Oyster örneklerinden RNA örneklerinin nasıl kullanılacağı ve neredeyse sıralı bir cDNA Kütüphanesi oluşturmak için kamuya açık genom verileriyle karşılaştırıldığında genetik malzemeyi değerlendirmek için bir strateji tarif ediyoruz.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Yeni hücre hatları veya genom sıralama projelerinin geliştirilmesi gibi önemli deneylerde daha önce kullanılan referans türlerinin biyolojik malzemesine erişim, genellikle daha fazla çalışmalar veya üçüncü şahıslar için sağlamak zordur numunelerin tüketici doğası. Şimdi yaygın Asya, Avustralya ve Kuzey Amerika 'nın Pasifik kıyılarında dağıtılan rağmen, bireysel Pasifik Oyster örnekleri genetik olarak oldukça çeşitlidir ve bu nedenle doğrudan gen kütüphaneler için başlangıç malzemesi olarak uygun değildir. Bu yazıda, cDNA kitaplıkları oluşturmak için bölgesel deniz ürünleri pazarlarından elde edilen başvurulmayan Pasifik Oyster örneklerinin kullanımını gösteriyoruz. Bu kütüphaneler daha sonra halka açık istiridye genomu ile karşılaştırıldığında ve en yakın ilgili Kütüphane mitokondriyal referans genler sitokrom C oksidaz altbirim ı (COX1) ve NADH dehydrogenase (ND) kullanılarak seçildi. Oluşturulan cDNA kütüphanesinin uygunluğu Ayrıca, UDP-Xylose ' in biyosentezi için sorumlu olan, UDP-glukuronik asit dehidrojenaz (UGD) ve UDP-Xylose sentaz (uxs) enzimlerini kodlayan iki genin klonlanması ve ifadesiyle gösterilmiştir. UDP-glikoz.

Introduction

Yaşam referanslı biyolojik materyalin satın alınması, uzun teslimat süreleri, girişimci mantık veya ülkeye özgü gümrük yönetmeliklerine bağlı olarak zor olabilir. Alternatif olarak, gerekli biyolojik malzeme de fenotipik olarak özdeş örneklerden toplanan olabilir. Ancak, bu örnekler genotip düzeyinde önemli ölçüde değişebilir, ve bu nedenle aynı türlerin dijital olarak saklanan referans genomlar ile karşılaştırmalar genellikle zor veya hatta boşuna yeni kaynaklı malzemenin uyumsuzluğu nedeniyle işlenir Mevcut DNA amplifikasyon yöntemleri. Bireysel numunelerin son derece sağlam genleri sıralaması, cDNA kütüphanelerinin kalite değerlendirmesi için sıkça referans genleri olarak kullanılan, kayıtlı mitokondriyal genler gibi türler1' i tanımlamak için yaygın olarak kullanılan ve güçlü bir araçtır2 ,3,4,5,6. Burada sunulan yöntemin temel gerekçesi, atıf genomunun karşılık gelen dizilerine kıyasla bireysel anonim istiridye örneklerinde mitokondrial gen sıralarının yüksek korunmasında diğer genlerin de bir nükleer DNA7' ye göre mitokondriyal DNA evriminin genel olarak daha hızlı oranı verildiğinde, bilimsel ve endüstriyel olarak ilgili genlerin geniş bir yelpazede amplifikasyon ve yalıtımına izin vererek, sadece kamuya açık bir şekilde kullanarak başvuru olarak kullanılabilir sıralama verileri.

Burada açıklanan yöntemin genel amacı, istiridye genlerinin klonlanması için şablon DNA 'Sı olarak kullanılabilecek neredeyse sıralı bir istiridye cDNA Kütüphanesi oluşturmak için optimize edilmiş bir iş akışı sunabilmenizi sağlamaktır. Sanal sıralamanın içinde, de Novo genom sıralamasının kaçınması; Bunun yerine, bilinen, dijital olarak saklanan referans sırası, sonunda bir kitaplık (veya önceden var olan bir tane eklenir) oluşturan cDNAs üretimi için astar kullanmak veya tasarlamak için doğrudan kullanılır. Amaç, bir yakınsak cDNA Kütüphanesi üretmektir, yani oluşturulan cDNA dizileri ve referans sırası arasındaki benzerlikler düşük yüksek divergence sıralanmış olabilir. Referans genler olarak sitokrom C oksidaz altbirim 1 (COX1) ve NADH dehidrogenaz (ND) kullanmanın önemli bir avantajı, bu mitokondriyal genlerin yüksek korunması nedeniyle coğrafi olarak çok sayıda istiridye numunelerinin profillenmiş olabileceği anlamına gelmiştir. Bu iyi kurulan işaretçileri ile yaklaşımı kanıtlanmış olan, daha sonra şeker nüklerotid biyosentezi katılan iki enzim adayları için uygulama göstermek ve endüstriyel alaka olabilir,8,9, 10. Pasifik istiridye biyoteknolojik potansiyeli hala keşfedilmemiş. Böylece, neredeyse sıralı cDNA Kütüphanesi hazırlamak için bu yakınma yöntemi de bu ilgili biyolojik malzeme cDNA oluşturmak isteyen uzman olmayan araştırmacılar için uygun olacağına inanıyoruz.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Not: Şekil 1' de şematik bir genel bakış gösterilir.

1. örnek toplama

  1. İstiridye numuneleri alın. İstiridyeler sırasında buz üzerinde istiridye tutun, taşıma ve laboratuar kullanımı ve işlem öncesinde 4-7 gün içinde satın aldıktan sonra.
    Not: Bu protokol Için, istiridye, Nanjing (Ningde, Fujian, Çin ve Lianyungang, Jiangsu, Çin), Haijie Aquatic ürün şirketi Qingdao (Qingdao, Shandong, Çin kökenli), Jucheng kaynaklanan Zhong Cai toptan Market satın alındı Aquatic ürün şirketi-Yantai (Yantai, Shandong, China) ve Jinxiu Aquatic ürün şirketi Qingdao (Qingdao, Shandong, China) kaynaklanan).

2. guanidinyum Thiocyanate tarafından RNA yalıtımı-fenol ekstraksiyon

  1. İstiridye dokusu numunesi hazırlanması
    1. Her bir istiridye örneğinin yaklaşık geometrik merkezinden sterilize edilmiş bir neşter ile yaklaşık 100 mg homojen yumuşak doku çıkarın ve numuneleri sıvı nitrojen haline aktarın.
    2. 1 saat için-80 °C ' de donma ve biyolojik atık olarak atmak için istiridyelerin kalan kısmını ötenize etme.
    3. Bir harç (200 mL) sıvı azot 50 mL ile dolu bir ince toz içine flaş dondurulmuş istiridye dokusu grind.
    4. Tartmak 75 her numunenin dondurulmuş dokusunun mg steril bir 1,5 ml Santrifüjlü tüp içine ve 1 ml guanidinyum Thiocyanate-fenol ekstraksiyon reaktif ile karıştırın. Numuneyi 14.000 x g 'de 4 °c ' de 15 dakika boyunca santrifüjün.
  2. Yeni bir 1,5 ml Santrifüjü tüpüne süpernatant aktarın, 200 μL kloroform ekleyin ve mix Sütlü-beyaz döner kadar 10-15 s için bir Vortex Mikser kullanarak iyice karıştırın.
  3. 14.000 x g 'de 15 dakika boyunca 4 °c ' de santrifüjün ve üst sulu tabakası, 200 μL pipet ile dikkatle yeni bir 1,5 ml Santrifüjlü tüpüne interfaz rahatsız etmeden aktarın.
  4. 500 μL isoproses alkol ekleyin ve örnekleri hafifçe inversion ile karıştırın, sonra örnekleri buzda 20 dakika boyunca bırakın. 14.000 x g 'de 4 °c ' de 8 dk 'da santrifüjün ve süpernatant çıkarın.
  5. % 75 EtOH 1 mL içinde Pelet her resuspend ve 5 dk için 4 °C 14.000 x g Santrifüjü tüm supernatant kaldırın.
  6. 2,5 adımı bir kez yineleyin. Oda sıcaklığında 6 dk için Pellet kuru. Daha uzun süre kurumayın; Aksi takdirde, bir sonraki adımda RNA Pelet çözülür zor olabilir.
  7. Kuru RNA Pelet 25 μL DEPC (dietylpyrocarbonate)-tedavi su ve buz üzerinde tüp tutmak çözülür. RNA örneklerini 24 saat içinde kullanın.

3. Ters transkripsiyon tarafından cDNA Kütüphanesi üretimi

  1. Her RNA örneği için, 10 μL pipet kullanarak bir ticari Ters transkripsiyon sistemini kullanarak bir reaksiyon karışımı hazırlayın: 4 μL MgCl2 çözeltisi, 2 μL 10X reaksiyon tamponu, 2 μL dntp çözeltisi, 0,5 μL RNase inhibitörü, 0,7 ΜL AMV Reverse Transcriptase, 0,5 μL oligo (dT) 15 astar, 1 μL ayıklanan RNA örneği ve 9,3 μL H2O bir 300 ΜL PCR tüp içine.
  2. 42 °C ' de 60 dk için bir PCR Termocycler içinde karıştır ve sonra sıcaklığı 5 dakika için 95 °C ' ye yükseltin.
  3. Oluşturulan cDNA kütüphanesini-20 °C ' de 12 aya kadar saklayın.

4. mitokondriyal gen amplifikasyon ve arıtma

  1. 10 μL pipet kullanarak PCR karışımını hazırlayın. 0,25 μL (1,25 U) yüksek doğruluk DNA Polymerase, 2 μL dNTP çözeltisi (2,5 mM her dNTP), 0,5 μL COX1 veya ND ileri astar (100 μM), 0,5 μL karşılık gelen COX1 veya ND ters astar (100 μM), 1 μL cDNA Kütüphanesi ekleyin , 5 μL 5x tampon çözeltisi ve 16 μL a 300 μL PCR tüpüne H2O damıtılmış.
  2. Aşağıdaki parametreleri kullanarak PCR amplifikasyonu gerçekleştirin: 95 °C ' de (süre 5 dk) ilk denatürasyon adımından sonra 35, 55 °C ' de (30 s) bir tavlama aşamadan oluşan PCR reaksiyon döngüleri, 72 °C ' de (2 dk) uzama adımı ve 95 °C ' de (30 s) denatürasyon adım , 72 °C ' de 5 dakika boyunca bir sonlandırılması uzama adımını gerçekleştirin.
  3. Elde edilen PCR ürününün kalitesini agaroz jel elektroforezi ile doğrulamak için PCR ürününün 5 μL değerini kullanın. 759 ya da 748 temel çiftleri sırasıyla tek bir bant olarak amplifikatörleşmiş COX1 veya ND geni gözlemlemek.
  4. PCR ürününün geri kalanını bir pck Temizleme Kiti ile temizler.
    1. Numune için 100 μL ' PCR-A ' (yüksek konsantrasyonlarda kaotropik tuzları11içeren DNA bağlama tamponu) ekleyin. İçeriği karıştırmak için kısaca Vortex.
    2. Arıtma sütununu 2 mL santrifüj tüpüne yerleştirin. 4.4.1 reaksiyon karışımı pipet. sütuna. 14.000 x g , oda sıcaklığında 1 dakika Santrifüjü.
    3. Santrifüj tüpünden filtrat atın. Sütunu 2 mL Santrifüjlü tüpe döndür, 700 μL ' W2 ' çözümünü sütun içine ekleyin ve 14.000 x g 'de 1 dakika oda sıcaklığında Santrifüjü (' W2 ', kalıntı chaotropik çıkarılması için yüksek konsantrasyonlarda etanol içeren bir yıkama çözümüdür Arıtma sütunundan tuzları).
    4. Süzyünü atın ve sütunu 2 mL Santrifüjü tüpüne geri dönün. 400 μL ' W2 ' solüsyonu sütununa ekleyin ve oda sıcaklığında 1 dakika için 14.000 x g 'de santrifüjün.
    5. 1 mL deiyonize su ön ısı 65 °C ' de metal blok ısıtıcısına kadar. Yeni bir 1,5 mL santrifüj tüpüne sütun aktarın. 65 °C ' den 25 μL pipet, beyaz sütun membranın merkezine sıcak ön ısıtmalı deiyonize su. Membranın oda sıcaklığında 1 dakika bekletine izin verin.
    6. 14.000 x g 'de Santrifüjü oda sıcaklığında 1 dakika boyunca çıkarın ve sütunu atın.
  5. Temizleşmiş PCR ürününü-20 °C ' de 12 aya kadar saklayın.

5. mitokondriyal gen sıralaması ve karşılaştırma

  1. Uygun COX1 veya ND ileri astar kullanarak Sanger sıralamalar için adım 4,5 ' dan arındırılmış PCR örneklerini sıralı astar olarak gönderin. İsteğe bağlı olarak, COX1 veya ND ters astar çift yönlü sıralama için de kullanılabilir.
  2. Sıralama sonuçlarını aldıktan sonra, NCBı nüklotide BLAST online aracını (blast.ncbi.nlm.nih.gov) kullanarak (NCBı taksonomi kimliği: 29159) Pasifik Oyster referans gerinim genom dizisi ile dizileri karşılaştırın (Şekil 2 ve Şekil 3 ).

6. genleri MgUGD ve MgUXS klonlama için cDNA kütüphanesi uygulanması

  1. Yükseltmek ve mgugd ve mguxs genleri ilgili ileri ve ters astarlar mgugd ve mguxs tarafından PCR tarafından 4,1 adımları aşağıdaki kullanarak arındırmak. 4,4 için.
  2. 1,5 mL santrifüj tüpüne 2 μL sindirim tamponu (10X konsantre) ve 6 μL deiyonize su aktarın. Yan ı ve Xho ı (1 μL her biri, 20 U) kısıtlama endonükleases ile birlikte saf MgUGD veya MgUXS PCR ürünleri 10 μL ekleyin. 37 °C ' de 3 saat boyunca kulküt atın.
  3. Önceden sindirilmiş pET-30A vektörünü hazırlayın: pET-30A vektörünün 500 ng 'yi yeni bir 1,5 mL Santrifüjlü tüpüne aktarın ve sesi deiyonize su kullanarak 16 μL 'ye yerleştirin. 2 μL sindirim tamponu (10X konsantre) ile birlikte, nde ı ve Xho ı (1 μL her, 20 U) kısıtlama restriksiyon endonükleazlarına benzer ekleyin.
    1. Karışım 37 °C ' de 3 saat boyunca inküden sonra, 1 μL alkalin fosfataz (1 U) ekleyin ve 37 °C ' de ek bir saat boyunca Inküye yapın. Önceden ısıtılan metal blok ısıtıcısına 10 dakika boyunca 75 °C ' de ısıtarak alkalin fosfataz ısınmaya hazır hale getirin.
  4. Sindirilmiş MgUGD veya MgUXS DNA ürünlerinin 4 μL 'sini taze 1,5 mL Santrifüjlü tüplere aktarın ve 4 μL sindirilmiş pET-30A vektörünü ekleyin. 1 μL ligasyon tamponu (10X), 1 μL T4 ligaz (3 U) ekleyin ve reaksiyon karışımını 22 °C ' de 3 saat boyunca inkübasyon yapın.
  5. Elektroyetkin E. coli Mach1 yetkili hücreleri, ligasyon ürünlerini kullanarak Elektroporasyon ile dönüştürün. Dönüştürülmüş hücreleri 50 μg/mL kanamycin içeren LB agar plakalarına yayın. 37 °C ' de hücreler için 16 h.
  6. Plasmid özgü T7 organizatör ve Terminator astar kullanarak Sanger sıralama tarafından istenen ekleme kolonileri doğrulayın. Onaylanmış bakteriyel klonlar plazmidler hazırlayın.

7. MgUGD ve MgUXS ifade ve aktivite testleri

  1. Dönüşüm E. coli bl21 (de3) MgUGD ve MgUXS genler taşıyan plazmids Ile yetkili hücreler ve 50 μg/ml kanamycin içeren lb agar plakaları üzerinde dönüştürülmüş hücreler yayıldı. 37 °C ' de hücreler için 16 h.
  2. 50 μg/ml kanamisin ile birlikte 5 ml lb orta olarak tek bir koloni geliştirin. Kültürü 400 mL LB orta seviyeye aktarın ve 200 rpm 'de 37 °C ' de sürekli olarak titremesi, 600 Nm (OD600) dalga boyunda optik yoğunluğa kadar yaklaşık 0,5 emilimine ulaşır.
    1. İnkübasyon sıcaklığını 20 °C ' ye azaltın ve 400 μL isopropresl β-D-thiogalactopyranoside (konsantrasyon 1 M) ekleyin. Rekombinant proteinlerin ifadesine 3 h.
  3. 4.500 x g 'de santrifüjleme Ile 4 °c ' de 15 dakika hasat hücreleri. 10 ml lizis tampon (100 mm NaCl, 50 mm Tris/HCL, 1% Triton X-100, 1 mm phenylmethylsulfonyl-fluorid (PMSF), pH 8,0) içinde Pelet askıya.
  4. Hücreleri sonication ile 20 dk (40, 4 °C ' de 15 s için 20 μm genlik açık/kapalı döngüleri) ile bozar. 14.000 x g 'de 4 °c ' de 20 dakika santrifüjün ve aktivite testi için süpernatant toplayın.
  5. 2 μL ' lik UDP-glikoz (10 mM) ile 2 μL hücre lysate inkükleştirici ile MgUGD 'nin aktivite tahlili gerçekleştirin, 4 μL NAD+ (10mm), 4 μL MgCl2 (10 mm), 2 μL Tris/HCL tampon (500 mm, pH 7,5) ve 6 μL deiyonize H2O yeni bir 1,5 mL santrifüjli tüp ve 37 °C ' de 30 dakika boyunca inküye.
  6. 2 μL (10 mM) UDP-glukuronik asit ile 2 μL hücre lysate kuluçkaya tarafından MgUXS aktivite tahlil gerçekleştirin, 2 μL Tris/HCl tampon (500 mM, pH 7,5), ve 14 μL deiyonize H2O yeni bir 1,5 ml santrifüjli tüp içinde ve inküser 37 °c 30 dakika.
  7. Her karışımı için 20 μL metanol ve 40 μL kloroform ekleyerek, adım 7,5 ve 7,6 reaksiyonları gidermek. Örnek karışımları vortekslenir sonra, 4 °c ' de 6 dakika için 14.000 x g Santrifüjü ve her tüpün üst sulu tabakası toplayın.
  8. 500-700 den m/z aralığında negatif iyonizasyon modunda MALDı-TOF Kütle spektrometresi kullanarak reaksiyon ürünlerini analiz edin. 1 μL 2, 5-dihiddroxybenzoic asit numune matris (1% w/V 50% sulu acetonitrile) ile örnek karışımı Mix. Beklenen m/z değerleri 579 ve 535 UDP-glukuronik asit ve UDP-Xylose için sırasıyla gözlemlemek (Şekil 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1 , Pasifik Oyster bireylerinden türetilen yakınsak cDNA kütüphanesinin açıklanan hazırlık yönteminin şematik bir özetini gösterir. Şekil 2 , referans malzemenin COX1 ve ND gen dizilerinden yüksek sapma sahip, uzaktan ilgili bir istiridye örneğinin COX1 ve ND genlerinin sıralarını gösterir. Şekil 3 , referans materyalinin COX1 ve ND gen dizilerinden düşük sapma sahip, yakından ilgili bir istiridye örneğinin COX1 ve ND genlerinin dizisini gösterir. Şekil 4 endüstriyel Ilgili genler MgUGD ve MgUXS klon cDNA kütüphanesi başarılı bir uygulama gösterir.

Figure 1
Şekil 1 : Açıklanan analiz yönteminin şematik genel bakış moleküler teşhis Pasifik Oyster numune referans genler olarak COX1 ve ND kullanarak. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2 : COX1 ve ND gen dizileri, COX1 ve ND gen dizileri ile karşılaştırıldığında, yüksek derecede Divergent bir numunenin sıralı hizalaması Pasifik istiridye gerilme. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 3
Şekil 3 : COX1 ve ND gen dizileri, COX1 ve ND gen dizileri ile karşılaştırıldığında, yakından ilgili bir numunenin sıralı hizalaması Pasifik istiridye gerilme. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 4
Şekil 4 : Şematik genel bakış moleküler klonlama, rekombinant ifade ve MgUGD ve MgUXS reaksiyon ürünlerinin tespiti. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sunulan protokol, COX1 ve ND genlerinin genel olarak kullanılabilen bir istiridye DNA genomu veritabanı ile karşılaştırılması yoluyla bölgesel deniz ürünleri piyasalarının benzer fenotipi ile başvurulmayan istiridye örneklerinin genetik tanımlaması sağlar. Bu yöntemin önemi, sadece tek bir PCR reaksiyonu sanal cDNA kütüphanesinin değerlendirilmesi için gerekli olduğu için basitliği içinde yatıyor. İki adet üretilen mitokondriyal COX1 ve ND genleri, her bir istiridye tarafından RNA ekstrelerinin ters transkripsiyonu ile oluşturulan bir cDNA kütüphanesinden güçlendiriliyor. RNA yalıtım yöntemi (adım 2,1), doğrudan sıvı nitrojen içinde istiridye dokusu taşlama tarafından basitleştirilmiştir. Her bir numunenin COX1 ve ND genlerini sıralamasından sonra, dizi hizalama bazı numunelerin referans gerilime yüksek benzerlik gösterdikten sonra ortaya çıktı. En yakın akrabası hem COX1 hem de ND gen dizilerinin tam kimliğini gösterdi.

Bu prosedürün en kritik adımları RNA ayıklama adımıdır; RNA bozulmasını en aza indirmek için, istiridye dokusunu ve RNA ekstraksiyonu arasındaki süreyi azaltmak önemlidir.

Başarılı klonlama, son zamanlarda Oyster UGE gen12 klonlayarak ve burada MgUGD ve MgUXS genler13klonlayarak, hangi faiz genler herhangi bir sayıda klonlama izin oluşturulan cDNA kütüphanesinin pratiklik doğrulandı tarafından örneklenmiş oldu dejenere Primers kullanarak hantal klonlama stratejileri için gerek kalmadan. COX1 ve ND genlerinin amplifikasyonunda, neredeyse sıralı cDNA kütüphaneleri oluşturmak için bu moleküler kimlik yöntemi, başvurulan genomlarının fiziksel örneklerine sahip olmayan diğer biyolojik materyaller için gelecekteki uygulamalarda da kullanılabilir Kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların ifşa etmesi gereken hiçbir şey yok.

Acknowledgments

Bu çalışma kısmen Çin doğal Bilim Vakfı (Grant numaraları 31471703, A0201300537 ve 31671854 için L.L., Grant numarası 31470435 G.Y.) ve 100 yabancı yetenekler planı (Grant numarası JSB2014012 için) tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics