Brug af CRISPR/Cas9 til at udskære GM-CSF i bil-T-celler

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her præsenterer vi en protokol til genetisk redigering af bil-T-celler via et CRISPR/Cas9 system.

Cite this Article

Copy Citation | Download Citations

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimeric antigen receptor T (bil-T) celleterapi er en banebrydende og potentielt revolutionerende nye behandlingsmulighed for kræft. Men, der er betydelige begrænsninger for dens udbredte anvendelse i behandlingen af kræft. Disse begrænsninger omfatter udvikling af unikke toksiciteter såsom cytokinfrigivelsessyndrom (CRS) og neurotoksicitet (NT) og begrænset ekspansion, Effector funktioner, og anti-tumor aktivitet i solide tumorer. En strategi til forbedring af bil-T effekt og/eller kontrol toksiciteter af bil-T-celler er at redigere genomet af de bil-T-celler selv under bil-T celle produktion. Her beskriver vi brugen af CRISPR/Cas9 genredigering i bil-T-celler via transduktion med en lentiviral konstruktion, der indeholder en guide RNA til granulocytmakrofag kolonistimulerende faktor (GM-CSF) og Cas9. Som et eksempel beskriver vi crispr/Cas9 medieret knockout af GM-CSF. Vi har vist, at disse GM-CSFk/o bil-T celler effektivt producerer mindre GM-CSF samtidig bevare kritisk T celle funktion og resultere i øget anti-tumor aktivitet in vivo i forhold til vilde type bil-T-celler.

Introduction

Chimeric antigen receptor T (bil-T) celleterapi udviser store løfter i behandlingen af kræft. 1 , 2 to bil-T celle terapier rettet mod CD19 (CART19) blev for nylig godkendt i Det Forenede erklærede og i Europa for anvendelse i B-celle maligniteter efter at have påvist slående resultater i multicenter kliniske forsøg. 3 , 4 , 5 barrierer for mere udbredt anvendelse af bil-T-celler er begrænset aktivitet i solide tumorer og tilknyttede toksiciteter, herunder cytokinfrigivelsessyndrom (CRS) og neurotoksicitet (NT). 3 , 5 , 6 , 7 , 8 , 9 for at forbedre det terapeutiske indeks for Car-t-celleterapi anvendes genom-ingeniør værktøjer såsom zink finger-nukleaser, talens og crispr til yderligere at modificere bil-t-celler i et forsøg på at generere mindre giftige eller mere effektive bil-t-celler. 10 , 11

I denne artikel beskriver vi en metode til at generere CRISPR/Cas9 redigerede bil-T-celler. Det specifikke mål med denne metode er at genetisk modificere bil-T-celler under bil-T-celle fremstilling via CRISPR/Cas9 til at generere mindre giftige eller mere effektive bil-T-celler. Begrundelsen for at udvikle denne metode bygger på erfaringerne fra klinisk erfaring med CAR-T-celleterapi, som indikerer et presserende behov for nye strategier for at øge det terapeutiske vindue i CAR-T-celleterapi og for at udvide applikationen til andre tumorer og understøttes af de seneste fremskridt inden for syntetisk biologi tillader flere ændringer af bil-T-celler, der er begyndt at komme ind i klinikken. Mens flere genomingeniør værktøjer udvikles og anvendes i forskellige indstillinger, såsom zink finger nucleaser, TALENs og CRISPR, beskriver vores metodologi CRISPR/Cas9 modifikation af bil-T-celler. 10 , 11 crispr/Cas9 er en RNA-baseret bakteriel forsvarsmekanisme, der er designet til at eliminere udenlandsk DNA. CRISPR er afhængig af endonukleaser for at kløve en målsekvens, der identificeres gennem et guide-RNA (gRNA). Crispr-redigering af bil-T-celler giver flere fordele i forhold til andre genom Engineering værktøjer. Disse omfatter præcision af gRNA sekvens, enkelhed til at designe en gRNA målretning af genet af interesse, høj gen redigering effektivitet, og evnen til at målrette flere gener, da flere gRNAs kan bruges på samme tid.

Specifikt i de metoder, der er beskrevet her, brugte vi en lentivirus encoding CRISPR guide RNA og Cas9 til at forstyrre et gen under BILTRANSDUKTION af T-celler. Ved valg af en passende teknik til at redigere bil-T-celler, foreslår vi den teknik, der er beskrevet her, er en effektiv mekanisme til at generere forskning grade bil-T-celler, men fordi den langsigtede effekt af permanent integration af Cas9 i genomet er ukendt, vi foreslå denne metode til at udvikle bevis for koncept forskning grade bil-T-celler, men ikke for at producere god fremstillingspraksis grade bil-T-celler.

Især her beskriver vi generationen af granulocyt makrofag kolonistimulerende faktor (GM-CSF) knockout bil-T-celler rettet mod human CD19. Disse bil-T-celler blev genereret ved transduktion med lentiviral partikler, der koder en guide RNA specifik for GM-CSF (gen navn CSF2) og Cas9. Vi har tidligere konstateret, at GM-CSF neutralisering Amelio CRS og NT i en xenograft model. 12 GM-CSFk/o bil-t-celler giver mulighed for hæmning af GM-CSF under fremstillingsprocessen, effektivt at reducere produktionen af GM-CSF samtidig øge bil-t celle anti-tumor aktivitet og overlevelse in vivo sammenlignet med dværg bil-t-celler. 12 således, her giver vi en metodologi til at GENERERE crispr/CAS9 redigeret bil-T-celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne protokol følger retningslinjerne fra Mayo Clinic ' institutionelle revisions bestyrelse (IRB) og den institutionelle Komité for Biosikkerhed (IBC).

1. CART19 celle produktion

  1. T celle isolation, stimulation, og ex-vivo kultur
    1. Udfør al cellekultur arbejde i en cellekultur hætte udnytte passende personlige værnemidler. Høst perifert blod mononukleære celler (PBMCs) fra de-identificerede normale donorblod kegler indsamlet under aferese, da disse er kendt for at være en levedygtig kilde til PBMCs.13
    2. For at isolere PBMCs tilsættes 15 mL af en massefylde gradient medium til en 50 mL tæthed gradient separations slange. Donor blodet fortyndes med et tilsvarende volumen fosfat-bufferet saltvand (PBS), der indeholder 2% føtal bovint serum (FBS) for at undgå celle diffusering.
      1. Tilsæt det fortyndede donorblod fra keglen i separations røret, pas på ikke at forstyrre grænsefladen mellem blodet og tætheden gradient medium. Centrifugeres ved 1.200 x g i 10 minutter ved rt.
      2. Supernatanten omdannes til en ny 50 mL konisk vask med PBS + 2% FBS ved at bringe op til 40 mL, centrifuge ved 300 x g i 8 minutter ved rt, Aspirér supernatanten, resuspension i 40 ml buffer, og Tæl celler.
    3. Isoler T-celler fra PBMCs via en negativ udvælgelse magnetisk perle kit ved hjælp af en fuldautomatisk celle separator i henhold til producentens protokol.
    4. Til kultur de isolerede T-celler, forberede T celle medium (TCM), der består af 10% humant AB serum (v/v), 1% penicillin-streptomycin-glutamin (v/v), og serum-fri hæmatopoietisk celle medium. Steriliser mediet ved at filtrere gennem et 0,45 μm sterilt vakuum filter og derefter med et 0,22 μm sterilt vakuum filter.
    5. På dag 0 (dagen for T-celle stimulation) vaskes CD3/CD28 perler før stimulering af T-celler. At vaske, placere den nødvendige mængde af perler (brug nok CD3/CD28 perler for et forhold på 3:1 perler: T-celler; Bemærk koncentrationen af perler kan være variabel) i et sterilt 1,5 mL mikrocentrifuge glas og resuspension i 1 mL TCM.
    6. Sted i kontakt med en magnet.
    7. Efter 1 min, Aspirér TCM og resuspension i 1 mL frisk TCM til at vaske perlerne.
    8. Gentag denne procedure for i alt tre skyller.
    9. Efter den tredje vask, resuspension perlerne i 1 mL TCM.
    10. Tæl T-cellerne.
    11. Overfør perler til T-cellerne i et forhold på 3:1 perler: celler.
    12. Cellerne fortyndes til en endelig koncentration på 1 x 106 celler/ml.
    13. Inkubere ved 37 °C, 5% CO2 i 24 timer.
  2. T-celle transfektering og transduktion
    1. Udføre lentiviral arbejde ved hjælp af BSL-2 + forholdsregler, herunder cellekultur emhætter, personlige værnemidler, og desinfektion af brugte materialer med blegemiddel før bortskaffelse.
    2. Erhverve en CART19 konstruktion i en lentiviral vektor.
      Bemærk: den CART19 konstruktion udnyttet her blev designet og derefter syntetiseret de Novo ved hjælp af en kommercielt tilgængelig proteinsyntese leverandør. BILKONSTRUKTIONEN blev efterfølgende klonet til en tredje generation af lentivirus under kontrol af en EF-1α-promotor. Den enkelte kæde variabel region fragment er afledt af FMC63 klon og genkender menneskelig CD19. Den CAR19 konstruktion besidder en anden generation 4-1BB costimulatory domæne og CD3ζ stimulation (FMC63-41BBz). 12
    3. Udføre lentiviral produktion som tidligere beskrevet. 12
      1. Kort sagt, at producere lentivirus, udnytte 293T celler, der har nået 70-90% confluency.
      2. Inkubation i 30 min ved stuetemperatur af transfektering reagenser, herunder 15 μg af lentiviral plasmid af interesse, 18 μg af en gag/pol/TAT/rev emballage vektor, 7 μg af en VSV-G konvolut vektor, 111 μl af præ-complexing reagens, 129 μl af transfektering reagens, og 9,0 ml transfektering medium før tilsætning til 293t celler. Derefter kultur de transficeret celler ved 37 °c, 5% Co2.
      3. Høst, centrifuge (900 x g i 10 min), filter (0,45 μM nylon filter), og koncentrer supernatanten ved 24 og 48 h med ultracentrifugering ved enten 13.028 x g for 18 h eller 112.700 x g for 2 timer.
      4. Fryse ved-80 °C til fremtidig brug.
    4. På dag 1 skal du forsigtigt resuspendere T-cellerne for at opdele de rosetter af T-celler, der var blevet stimuleret ved 1 x 106/ml på dag 0.
    5. Under passende BSL-2 + forholdsregler for alt lentiviral arbejde tilsættes fersk eller frosset høstet virus til de stimulerede T-celler ved en mangfoldighed af infektion (MOI) af 3,0.
  3. BIL-T-celle udvidelse
    1. Under ekspansionsfasen fortsættes med at inkubere de transducerede T-celler ved 37 °C, 5% CO2. Tæl bil-T-celler på dag 3 og 5, og tilsæt frisk, præ-varmet TCM til kulturen for at opretholde en bil-T celle koncentration på 1 x 106/ml.
    2. Fjern perler fra de transducerede T-celler 6 dage efter stimulation (dag 6) ved hjælp af en magnet. Høst, resuspension, og Placer T-celler i 50 mL koniske rør i en magnet i 1 min. Saml derefter supernatanten (indeholder bil-T-cellerne), og kassér perlerne.
    3. Placer de indsamlede bil-T-celler tilbage i kulturen i en koncentration på 1 x 106 celler/ml for at genoptage ekspansion.
    4. På dag 6, Vurder overflade ekspression af bilen ved flow cytometri.
      Bemærk: flere metoder kan bruges til at detektere overflade ekspression af bil, såsom farvning med en ged anti-mus IgG (H + L) kryds adsorbede sekundære antistof eller ved farvning med et CD19 specifikt peptid, konjugeret til en fluorchrom. Her skal du tage en alikvot (ca. 100.000 T celler) fra kulturen og vaske med strømnings buffer, som er tilberedt med dulbecco's fosfatbuffer, 2% føtal kvægserum og 1% natriumazid. Plette cellerne med anti-BILANTISTOF og vask to gange. Plette cellerne med levende/døde pletter og CD3 monoklonalt antistof (OKT3). Vask cellerne og resuspender i flow buffer. Erhverve på en flowcytometer at bestemme transduktiviteten.
  4. Bil-T celle kryopræservering
    1. At høste og embryonog bil-T celler 8 dage efter stimulation (dag 8 af T celle ekspansion), høst cellerne fra kultur.
    2. Spin ned i 5 min ved 300 x g.
    3. Resuspension i fryse middel ved 10.000.000 celler pr. mL pr. hætteglas i fryse medium bestående af 10% dimethylsulfoxid og 90% føtal bovint serum.
    4. Fryse i en fryse beholder for at opnå en afkølingshastighed på-1 °C/min i a-80 °C fryser og derefter overføres til flydende nitrogen efter 48 h.
    5. Før de anvendes til in vitro-eller in vivo-forsøg, skal de tø-T-celler i varm
    6. Cellerne vaskes for at fortynde og fjerne dimethylsulfoxid og resuspenderes til en koncentration på 2 x 106 celler/ml i varm TCM. Hvil natten over ved 37 °C, 5% CO2.

2. GM-CSF k/o CART19 produktion

  1. At forstyrre GM-CSF, udnytte en guide RNA (gRNA) målretning exon 3 af human GM-CSF (CSF2) valgt via screening gRNAs tidligere rapporteret at have høj effektivitet for CSF2 genet, der koder for human cytokin GM-CSF. 14
    NOTE: en kommercielt syntetiseret forsknings grad Cas9 tredje generation af lentiviral konstruktion indeholdende denne gRNA (under en U6 promotor) blev anvendt. Konstruktionen indeholder et puromycin-resistens-gen. Sekvensen af gRNA er GACCTGCCTACAGACCCGCC. 12
  2. At producere lentivirus, udnytte 293T celler, der har nået 70-90% confluency.
  3. Der tillades 15 μg lentiviral plasmid af interesse, 18 μg gag/pol/TAT/rev-emballage vektor, 7 μg en VSV-G-konvolut vektor, 111 μl af det præ-complexing-reagens, 129 μl af transfektering-reagenset og 9,0 ml af transfektering-mediet til Inkubér i 30 min på værelset te mperatur.
  4. Tilsæt transfektering reagenser til 293t cellerne. Derefter kultur ved 37 °C, 5% CO2.
  5. Høst, centrifuge (900 x g i 10 min), filter (0,45 μM nylon filter) og koncentrat supernatanten ved 24 og 48 h ved ultracentrifugering ved enten 13.028 x g for 18 h eller 112.700 x g for 2 h og fryse ved-80 °c til fremtidig brug.
  6. På dag 1 skal du forsigtigt resuspendere T-cellerne for at opdele rosetter.
  7. I et BSL-2 + godkendt laboratorium tilsættes frossen eller frisk høstet virus til de stimulerede T-celler for at generere bil-T-celler. Transduce T celler med både CAR19 lentivirus og GM-CSF målretning CRISPR lentivirus. Tilføj CAR19 lentivirus ved et MOI på 3. Da titrering af CRISPR lentivirus ikke var mulig, anvendes viruspartikler genereret fra en 15 ug plasmid præparat til at transduce 10 x 106 T celler.
  8. Se de resterende trin i T-celle stimulation, ekspansion og kryopræservering som beskrevet i trin 1.
  9. For lentiCRISPR-redigerede T-celler, der transporterer puromycin-resistens, Behandl celler med puromycin dihydrochlorid i en koncentration på 1 μg puromycin pr. 1 mL på dag 3 og dag 5.

3. GM-CSF afbrydelse effektivitet og funktionel vurdering af GM-CSF k/o CART19

  1. GM-CSF afbrydelse effektivitet: sporing af indeler ved nedbrydning (TIDE) sekventering og analyse
    1. For at sekvens exon af interesse i GM-CSF genet, bruge følgende primere. Brug en Forward primer-sekvens for GM-CSF (CSF2) af TGACTACAGAGAGGCACAGA og en omvendt primer-sekvens af TCACCTCTGACCTCATTAACC.
    2. Udpak DNA fra op til 5.000.000 bil-T-celler med et genomisk ekstraktions udstyr. For PCR-reaktionen skal der anvendes 25 μL af en Taq-mastermix pr. reaktion med en slutkoncentration af hver primer i PCR-reaktionen på μM, 0,1-0,5 μg skabelon-DNA, og et samlet volumen af PCR-reaktionen bragt op til 50 μL med nuklease frit vand.
    3. Se de PCR-cykelforhold, der er beskrevet i tabel 1.
    4. Kør PCR-prøver på en 1-2% agopstået gel ved 100 V i 30 minutter og uddrag ved hjælp af et gel ekstraktions udstyr.
    5. Sekvens PCR amplicons. Beregn allel-modifikations frekvensen ved at uploade rå data til en passende tidevands software. 15
  2. GM-CSF-produktion og funktionel vurdering af GM-CSFk/o CART19
    1. For at bestemme cytokin produktion af bil-T-celler, der inkuberes ved vildtype CART19 celler og GM-CSFk/o CART19 med CD19 udtrykker akut lymfoblastær leukæmi cellelinje NALM6 ved en 1:5 ratio for 4 h ved 37 °c, 5% Co2 i nærværelse af monensin løsning, anti-Human CD49d, anti-Human CD28, og anti-Human CD107a.
    2. Høst celler fra kultur for strømnings cytometri. Vask cellerne med flow cytometri buffer. Plette cellerne med et levende/dødt farvnings sæt. Inkuber i mørket ved stuetemperatur i 15 min. Fastgør cellerne med et fikserings medium og Inkuber i mørket ved stuetemperatur i 15 minutter.
    3. Efter vask, plette cellerne intracellulært med permeabilization medium i kombination med anti-humant IFNγ monoklonale antistof, anti-Human GM-CSF, anti-humant MIP-1β, anti-Human IL-2, og anti-Human CD3 og inkubere i mørket ved stuetemperatur for 30 min. vask og resuspension af prøverne. Erhverve prøver på en flow flowcytometer og analyseret for procent af intracellulære GM-CSF udtryk.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 viser reduktion af GM-CSF i GM-CSFk/o CART19 celler. For at verificere, at genomet af T-cellerne blev ændret til knockout GM-CSF, blev TIDEVANDS sekvensering anvendt i GM-CSFk/o CART19 cellerne (figur 1a). BIL-T celleoverflade farvning kontrollerer, at T-cellerne med succes udtrykker bilens overflade receptor in vitro ved at gating på levende CD3 + celler (figur 1b). Intracellulær farvning af GM-CSF ved flow cytometri viser nedsat ekspression af GM-CSF i GM-CSFk/o CART19 celler ved gating på levende CD3 + celler, kontrol af funktionel succes af knockout (figur 1c). GM-CSFk/o Car-t-celler udviser et fald i GM-CSF sammenlignet med dværg anti-CD19 Car-t-celler (CART19) via intracellulær farvning (figur 1b). Derudover har vi tidligere vist, at GM-CSFk/o bil-t-celler reducere produktionen af GM-CSF samtidig øge anti-tumor aktivitet og overlevelse i forhold til dværg bil-t celler in vivo. 12 

Trin Temp (°C) Tid Cykler
Indledende denaturering 94 3 min 1
Denaturering 94 45 sek 35
Udglødning 60 30 sek
Udvidelse 72 2 min
Post-forlængelse 72 10 min 1
4

Tabel 1: PCR-cykel betingelser for TIDEVANDS sekvensering af GM-CSFk/o CART19-celler.

Figure 1
Figur 1 : GM-CSFk/o CART19 celler viser reduktion i GM-CSF. A) en repræsentativ tidevands sekvens verificerer genomændring af GM-CSF Crispr/Cas9 GM-CSFk/o CART19 celler med en forstyrrelse effektivitet på ~ 71%. B) repræsentative flow plots skildrer vellykket bil-T celle produktion med lignende bil udtryk på vilde type CART19 og GM-CSFk/o CART19. C) som analyseret af intracellulær farvning, GM-CSFk/o CART19 celler viser reduceret GM-CSF sammenlignet med vildtype CART19, når stimuleret med CD19 positiv alle cellelinje NALM6. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denne rapport beskriver vi en metode til at udnytte CRISPR/Cas9-teknologien til at inducere sekundære modifikationer i bil-T-celler. Specifikt, dette påvises ved hjælp af lentiviral transduktion med en viral vektor, der indeholder grna rettet mod genet af interesse og Cas9 til at generere GM-CSFk/o CART19 celler. Vi havde tidligere vist, at GM-CSF neutralisering Amelio CRS og NT i en xenograft model. 12 som tidligere beskrevet, GM-CSFk/o bil-T-celler giver mulighed for HÆMNING af GM-CSF under fremstillingsprocessen, effektivt reducere produktionen af GM-CSF samtidig bevare andre kritiske T celle funktioner, og resultere i øget anti-tumor aktivitet in vivo sammenlignet med dværg bil-T-celler. 12

Da permanent integration af Cas9 i genomet kunne være forbundet med uønskede virkninger, når de oversættes til et klinisk levedygtigt produkt, foreslår vi denne specifikke metode som en måde at generere forskning grade CRISPR/Cas9 modificeret CART19 for proof of concept Eksperimenter.

Mens bil-T celler holder løfte i kræftbehandling,1,2 deres virkning kan fortsætte med at blive forbedret og deres tilknyttede toksiciteter bedre kontrolleret. CRISPR/Cas9 teknologi giver en strategi til direkte at målrette genomet af bil-T-celler til ingeniørløsninger på aktuelle kliniske mangler. I denne artikel beskriver vi genereringen af GM-CSFk/o CART19 celler.

GM-CSFk/o Car-t-celler blev genereret ved transduktion med en lentiviral VEKTOR for Car-t celle plasmid og en lentivirus konstruktion indeholdende en guide RNA til GM-CSF og Cas9. For at generere GM-CSFk/o, en tredje generation lentivirus konstruere (lentiCRISPRv2) indeholdende Cas9 og en rapporteret højeffektiv guide RNA (grna) rettet mod exon 3 af human GM-CSF (CSF2)14 under kontrol af en U6 Promoter blev udnyttet. Der bør udvises særlig omhu under procedurens transduktionstrin, da disse er de mest kritiske for udviklingen af de modificerede bil-T-celler. Udskærings effektivitet kan verificeres og vurderes via sporing af indels ved nedbrydning (TIDE) sekvenser. Den funktionelle aktivitet af CAR-T-celler undersøges gennem den antigen specifikke stimulering af bilkonstruktionen med CD19 + målceller efterfulgt af måling af forskellige T-celle funktioner, herunder produktion af GM-CSF. 12 af note, farvning for bil udtryk med en ged anti-museantistof bør forekomme før andre antistof farvning med to skyller, der opstår før overfladefarvning på grund af den enkelte kæde variabel region FRAGMENT af CART19 er af mus oprindelse. Dette er et punkt af vægt i problemer med at skyde, hvis god bil udtryk er ikke i første omgang observeret.

Disse modificerede bil-T-celler kan anvendes i in vitro-studier og in vivo xenograft-modeller til dokumentation af koncept eksperimenter. En fordel ved denne teknik er, at bil-T celle produktion og genetisk manipulation kan både forekomme i et trin med god effektivitet i forhold til andre teknikker. 10 , 11 mens dual lentiviral transduktion er en bekvem og effektiv metode til at generere forskning grade GM-CSFk/o CART19 celler, er DNA indarbejdet i genomet og langvarig Cas9 udtryk kan destabilisere genomet og øge risiko for off-Target effekter. En begrænsning af denne teknik er, at god fremstillingspraksis kvalitet knockouts ville kræve modifikation af teknikken til en ribonucleoprotein CRISPR/Cas9 system, da denne metode ikke resulterer i permanent inkorporering af Cas9 i genomet og reducerer potentialet for off-Target effekter. Den metode, der er beskrevet i protokollen her, kan potentielt anvendes på en række gener til genetisk modificerer bil-T-celler via CRISPR/Cas9 for at hjælpe med at generere mindre giftige eller mere effektive bil-T-celler.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK er en opfinder på patenter inden for bil T-celleterapi, der er licenseret til Novartis (i henhold til en aftale mellem Mayo Clinic, University of Pennsylvania, og Novartis). Disse undersøgelser blev delvist finansieret af et stipendium fra Humanigen (SSK). RMS, MJC, RS, og SSK er opfindere på patenter i forbindelse med dette arbejde. Laboratoriet (SSK) modtager støtte fra Tolero, Humanigen, kite, Lentigen, Morphosys og actinium.

Acknowledgments

Dette arbejde blev støttet gennem tilskud fra K12CA090628 (SSK), national Comprehensive Cancer Network (SSK), Mayo Clinic Center for individualiseret medicin (SSK), Predolin Foundation (SSK), Mayo Clinic Office of Translation til Practice (SSK), og Mayo Clinic Medical Scientist Trænings program Robert L. Howell læge-videnskabsmand Scholarship (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics