Bruke CRISPR/Cas9 å Knock Out GM-CSF i CAR-T celler

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi en protokoll til genetisk redigere CAR-T-celler via en CRISPR/Cas9 system.

Cite this Article

Copy Citation | Download Citations

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimeric antigen reseptor T (CAR-T) celle terapi er en cutting edge og potensielt revolusjonerende ny behandling alternativ for kreft. Det er imidlertid betydelige begrensninger på utbredt bruk i behandling av kreft. Disse begrensninger inkludere utviklingen av enestående toksisitet som cytokin løslate Syndrome (CRS) og nevrotoksisitet (NT) og begrenset ekspansjon, effektor funksjonene, og anti-svulst aktivitet inne robust svulst. En strategi for å forbedre CAR-T effekt og/eller kontroll toksisitet av CAR-T-celler er å redigere Genova av CAR-T cellene selv under CAR-T celle produksjon. Her beskriver vi bruken av CRISPR/Cas9 genredigering i CAR-T-celler via Transduction med en lentiviral konstruksjon som inneholder en guide RNA for å granulocytt macrophage koloni-stimulerende faktor (GM-CSF) og Cas9. Som et eksempel, beskriver vi CRISPR/Cas9 mediert knockout av GM-CSF. Vi har vist at disse GM-CSFk/o Car-T-celler effektivt produsere mindre GM-CSF samtidig opprettholde kritisk T celle funksjon og resultere i forbedret anti-tumor aktivitet in vivo i forhold til vill type Car-t-celler.

Introduction

Chimeric antigen reseptor T (CAR-T) celle terapi utstillinger store løftet i behandling av kreft. 1 den andre , 2 to bil-T celle terapier rettet mot CD19 (CART19) ble nylig godkjent i United uttalte og i Europa for bruk i B-cellen ondartet etter å ha vist slående resultater i multisenter kliniske studier. 3 andre priser , 4 andre priser , 5 barrierer for mer utbredt bruk av Car-T-celler er begrenset aktivitet i solide svulster og tilhørende toksisitet inkludert cytokin Release syndrom (CRS) og NEVROTOKSISITET (NT). 3 andre priser , 5 andre priser , 6 andre priser , 7 andre er , 8 på alle , 9 for å forbedre den terapeutiske indeks av Car-t celle terapi, er Genova tekniske verktøy som sink finger Nukleaser, TALENS og CRISPR ansatt for ytterligere å endre Car-t-celler i et forsøk på å generere mindre giftige eller mer effektive Car-t-celler. 10 andre , 11 flere

I denne artikkelen beskriver vi en metode for å generere CRISPR/Cas9 redigerte CAR-T-celler. Det konkrete målet med denne metoden er å genetisk modifisere CAR-T-celler under CAR-T celle produksjon via CRISPR/Cas9 å generere mindre giftige eller mer effektive CAR-T-celler. Begrunnelsen for å utvikle denne metodikken er bygget på erfaringene fra klinisk erfaring med CAR-T celle terapi, som indikerer et presserende behov for romanen strategier for å øke den terapeutiske vinduet i CAR-T celle terapi og å utvide programmet til andre svulster og støttes av den nylige fremskritt i syntetisk biologi slik at flere modifikasjoner av CAR-T-celler som har begynt å gå inn i klinikken. Mens flere Genova tekniske verktøy utvikles og brukes i forskjellige innstillinger, for eksempel sink finger nukleaser, TALENs og CRISPR, beskriver vår metodikk CRISPR/Cas9 modifikasjon av CAR-T-celler. 10 andre , 11 CRISPR/Cas9 er en RNA-basert bakteriell forsvarsmekanisme som er designet for å ELIMINERE utenlandsk DNA. CRISPR baserer på endonucleases på å holde en mål sekvens identifisert gjennom en guide RNA (gRNA). CRISPR redigering av CAR-T-celler tilbyr flere fordeler fremfor andre tekniske verktøy for Genova. Disse inkluderer presisjon av gRNA sekvensen, enkelhet å designe en gRNA rettet mot genet av interesse, høy genredigering effektivitet, og evnen til å målrette flere gener siden flere gRNAs kan brukes på samme tid.

Spesielt i metodene beskrevet her, brukte vi en lentivirus koding CRISPR guide RNA og Cas9 å forstyrre et gen under CAR Transduction av T-celler. I å velge en hensiktsmessig teknikk for å redigere CAR-T-celler, foreslår vi at teknikken som er beskrevet her er en effektiv mekanisme for å generere forskning grade CAR-T-celler, men fordi den langsiktige effekten av permanent integrering av Cas9 i Genova er ukjent, vi foreslå denne metodikken for å utvikle bevis på konseptet forskning grade CAR-T-celler, men ikke for å produsere god produksjon praksis grade CAR-T-celler.

Spesielt her beskriver vi generering av granulocytt macrophage koloni stimulerende faktor (GM-CSF) knockout CAR-T-celler rettet mot menneskelig CD19. Disse CAR-T celler ble generert av Transduction med lentiviral partikler koding en guide RNA spesifikke for GM-CSF (Gen navn CSF2) og Cas9. Vi har tidligere funnet ut at GM-CSF nøytralisering ameliorates CRS og NT i en xenograft modell. 12 GM-CSFk/o Car-T-celler tillater HEMMING av GM-CSF under produksjonsprosessen, effektivt redusere PRODUKSJONEN av GM-CSF samtidig forbedre Car-t celle anti-tumor aktivitet og overlevelse in vivo sammenlignet med wildtype Car-T-celler. 12 derfor, her gir vi en metodikk for å generere CRISPR/CAS9 redigert Car-T-celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne protokollen følger retningslinjene for Mayo Clinic ' s institusjonelle gjennomgang Board (IRB) og institusjonelle biosafety Committee (IBC).

1. CART19 celle produksjon

  1. T celle isolering, stimulering, og ex-vivo kultur
    1. Utføre all cellekultur arbeid i en cellekultur hette utnytte egnet personlig verneutstyr. Harvest perifere blod mononukleære celler (Pbmc) fra de-identifiserte normal donorblod kjegler samlet under aferese som disse er kjent for å være en levedyktig kilde til Pbmc.13
    2. For å isolere Pbmc, tilsett 15 mL av en tetthet gradient medium til en 50 mL tetthet gradient skille tube. Fortynne donorblod med et likt volum av fosfat-bufret saltvann (PBS) som inneholder 2% fosterets storfe serum (FBS) for å unngå celle fangst.
      1. Tilsett fortynnet donorblod fra membranen inn i separasjon røret, forsiktig så du ikke forstyrrer grensesnittet mellom blodet og tettheten gradient medium. Sentrifuger på 1 200 x g for 10 min ved RT.
      2. Dekanter supernatanten inn i en ny 50 mL konisk, vask med PBS + 2% FBS ved å bringe opp til 40 mL, sentrifuge ved 300 x g for 8 min ved RT, aspirer supernatanten, resuspend i 40 ml buffer, og telle celler.
    3. Isoler T-celler fra Pbmc via et negativt utvalg magnetisk perle sett med et helautomatisk celle skille i henhold til produsentens protokoll.
    4. Til kultur de isolerte T-cellene, forberede T Cell medium (TCM) som består av 10% humant AB serum (v/v), 1% penicillin-Streptomycin-glutamin (v/v), og serum-fri blodkreft celle medium. Sterilisere mediet ved å filtrere gjennom et sterilt vakuum filter på 0,45 μm og deretter med et sterilt vakuum filter på 0,22 μm.
    5. På dag 0 (dagen for T celle stimulering), vask CD3/CD28 perler før stimulering av T-celler. For å vaske, plassere det nødvendige volumet av perler (bruk nok CD3/CD28 perler for et forhold på 3:1 perler: T celler; Merk konsentrasjonen av perler kan være variabel) i en steril 1,5 mL mikrosentrifugen rør og resuspend i 1 mL TCM.
    6. Plasser i kontakt med en magnet.
    7. Etter 1 min, aspirer TCM og resuspend i 1 mL fersk TCM for å vaske perlene.
    8. Gjenta denne fremgangsmåten for totalt tre vasker.
    9. Etter den tredje vasken, resuspend perlene i 1 mL TCM.
    10. Tell T-cellene.
    11. Overfør perler til T-cellene i forholdet 3:1 perler: celler.
    12. Fortynne celler til en endelig konsentrasjon av 1 x 106 celler/ml.
    13. Ruge ved 37 ° c, 5% CO2 for 24 h.
  2. T celle transfeksjoner og Transduction
    1. Utfør lentiviral arbeid ved hjelp av BSL-2 + forholdsregler, inkludert cellekultur hetter, personlig verneutstyr, og desinfeksjon av brukte materialer med blekemiddel før avhending.
    2. Tilegne seg en CART19 konstruere i en lentiviral vektor.
      Merk: CART19 konstruere utnyttet her ble designet og deretter syntetisert de Novo ved hjelp av en kommersielt tilgjengelig protein syntese leverandøren. BILEN konstruere ble senere klonet til en tredje generasjons lentivirus under kontroll av en EF-1 α promoter. Den enkelt kjeden variable regionen fragment er avledet fra FMC63 klone og gjenkjenner menneskelige CD19. Den CAR19 konstruere besitter en andre generasjon 4-1BB costimulatory domene og CD3ζ stimulering (FMC63-41BBz). 12 flere
    3. Utfør lentiviral produksjon som beskrevet tidligere. 12 flere
      1. I korte trekk, for å produsere lentivirus, utnytte 293T celler som har nådd 70-90% confluency.
      2. Tillat inkubasjons i 30 minutter ved romtemperatur på transfeksjoner reagenser, inkludert 15 μg av lentiviral plasmider, 18 μg av en gag/Pol/, 7 μg av en VSV-G konvolutt vektor, 111 μL av pre-kompleks reagens, 129 μL av transfeksjoner reagens, og 9,0 mL av transfeksjoner medium før du legger til 293T cellene. Deretter kultur transfekterte cellene ved 37 ° c, 5% CO2.
      3. Harvest, sentrifuger (900 x g i 10 min), filter (0,45 μM nylon filter), og konsentrere supernatanten ved 24 og 48 h ved ultracentrifugation på enten 13 028 x g for 18 t eller 112 700 x g for 2 t.
      4. Frys ved-80 ° c for fremtidig bruk.
    4. På dag 1, forsiktig resuspend T-celler for å bryte opp rosetter av T-celler som hadde blitt stimulert til 1 x 106/ml på dag 0.
    5. Under passende BSL-2 + forholdsregler for alle lentiviral arbeid, legge til fersk eller frossen høstet virus til stimulert T cellene på et mangfold av smitte (MOI) av 3,0.
  3. BIL-T celle ekspansjon
    1. Under utvidelsesfasen fortsetter du å ruge transduced T-cellene ved 37 ° c, 5% CO2. Tell CAR-T-cellene på dag 3 og 5, og Legg til frisk, forvarmet TCM til kulturen for å opprettholde en bil-T celle konsentrasjon på 1 x 106/ml.
    2. Fjern perler fra transduced T-cellene 6 dager etter stimulering (dag 6) ved hjelp av en magnet. Harvest, resuspend og plassere T-celler i 50 mL koniske rør i en magnet i 1 min. Deretter samle supernatanten (inneholder CAR-T-celler), og kast perlene.
    3. Plasser de innsamlede CAR-T-cellene tilbake i kultur ved en konsentrasjon på 1 x 106 celler/ml for å gjenoppta ekspansjonen.
    4. På dag 6, vurdere overflaten uttrykk for bilen ved flyt flowcytometri.
      Merk: flere metoder kan brukes til å oppdage overflaten uttrykk for bil, for eksempel farging med en geit anti-mus IgG (H + L) adsorberes sekundære antistoff eller ved farging med en CD19 spesifikke peptid, bøyd til en fluorokromkonjugert. Her, ta en alikvot (ca 100 000 T-celler) fra kulturen og vask med Flow buffer tilberedt med Dulbecco ' s fosfat-bufret saltvann, 2% fosterets storfe serum, og 1% natrium Natriumazid. Stain cellene med anti-bil antistoff og vask to ganger. Stain cellene med levende/Dead beis og CD3 monoklonale antistoff (OKT3). Vask cellene og resuspend i strømnings buffer. Skaff deg en flowcytometer for å bestemme Transduction effektivitet.
  4. BIL-T celle kryonisk bevaring
    1. Å høste og lagre nedfryste CAR-T celler 8 dager etter stimulering (dag 8 av T celle ekspansjon), høste cellene fra kultur.
    2. Spinn ned i 5 min på 300 x g.
    3. Resuspend i frysing medium på 10 000 000 celler per mL per hetteglass i frysing medium bestående av 10% dimethyl sulfoxide og 90% fosterets storfe serum.
    4. Frys i en fryse beholder for å oppnå en avkjølings hastighet på-1 ° c/min i en-80 ° c fryser og deretter overføres til flytende nitrogen etter 48 h.
    5. Før deres bruk i in vitro-eller in vivo-eksperimenter, Tin CAR-T-cellene i varm TCM.
    6. Vask cellene for å fortynne og fjerne dimethyl sulfoxide og resuspend til en konsentrasjon på 2 x 106 celler/ml i varm TCM. Rest overnatter ved 37 ° c, 5% CO2.

2. GM-CSF k/o CART19 produksjon

  1. For å forstyrre GM-CSF, bruke en guide RNA (gRNA) målretting ekson 3 av menneskelig GM-CSF (CSF2) valgt via screening gRNAs tidligere rapportert å ha høy effektivitet for CSF2 genet som koder for den menneskelige cytokin GM-CSF. 14 priser og priser
    Merk: en kommersielt syntetisert forskning grade Cas9 tredje generasjon lentiviral konstruere inneholder denne gRNA (under en U6 promoter) ble brukt. Konstruksjonen inneholder et puromycin motstands gen. Sekvensen av gRNA er GACCTGCCTACAGACCCGCC. 12 flere
  2. Hvis du vil produsere lentivirus, kan du bruke 293T-celler som har nådd 70-90% confluency.
  3. Tillat 15 μg av lentiviral plasmider, 18 μg av en gag/Pol/TAT/rev emballasje vektor, 7 μg av en VSV-G konvolutt vektor, 111 μL av pre-kompleks reagens, 129 μL av transfeksjoner reagens, og 9,0 mL av transfeksjoner medium til ruge i 30 min ved rom te mperature.
  4. Legg til transfeksjoner reagenser i 293T-cellene. Deretter kultur ved 37 ° c, 5% CO2.
  5. Innhøsting, sentrifuge (900 x g i 10 min.), filter (0,45 μM nylon filter) og konsentrat supernatanten ved 24 og 48 h ved ultracentrifugation ved enten 13 028 x g for 18 timer eller 112 700 x g for 2 timer og Frys ved-80 ° c for fremtidig bruk.
  6. På dag 1, forsiktig resuspend T-cellene for å bryte opp rosetter.
  7. I en BSL-2 + godkjent laboratorium, tilsett frosne eller fersk høstet virus til stimulert T-celler til å generere CAR-T-celler. Overfører T-celler med både CAR19 lentivirus og GM-CSF målretting CRISPR lentivirus. Legg CAR19 lentivirus på en MOI av 3. Siden titrering av CRISPR lentivirus var ikke gjennomførbart, bruk virus partikler generert fra en 15 UG plasmider forberedelse til å overfører 10 x 106 T celler.
  8. Se de resterende trinnene av T celle stimulering, ekspansjon, og kryonisk bevaring som beskrevet i trinn 1.
  9. For lentiCRISPR-redigerte T-celler som bærer puromycin motstand, skal du behandle celler med puromycin dihydrochloride ved en konsentrasjon på 1 mikrogram puromycin per 1 mL på dag 3 og dag 5.

3. GM-CSF avbrudd effektivitet og funksjonell vurdering av GM-CSF k/o CART19

  1. GM-CSF avbrudd effektivitet: sporing av indeler ved nedbryting (TIDE) sekvensering og analyse
    1. For å sekvens ekson av interesse for GM-CSF genet, bruk følgende primere. Bruk en sekvens for videre primer for GM-CSF (CSF2) av TGACTACAGAGAGGCACAGA, og en omvendt primer sekvens av TCACCTCTGACCTCATTAACC.
    2. Trekk ut DNA fra opptil 5 000 000 CAR-T-celler med et genomisk avsugs sett. For PCR-reaksjonen, bruk 25 μL av en Taq mastermix per reaksjon med en endelig konsentrasjon av hver primer i PCR-reaksjonen til μM, 0,1-0,5 μg av mal-DNA, og et samlet volum av PCR-reaksjonen brakt opp til 50 μL med nuklease fritt vann.
    3. Se vilkårene for PCR-sykling beskrevet i tabell 1.
    4. Kjør PCR-prøver på en 1-2% agarose gel ved 100 V i 30 min og pakk ut med et gel Extraction Kit.
    5. Sekvens PCR-amplicons. Beregn allel modifikasjon frekvens ved å laste opp rådata til en passende TIDE programvare. 15 priser og
  2. GM-CSF produksjon og funksjonell vurdering av GM-CSFk/o CART19
    1. For å bestemme cytokin produksjon av CAR-T-celler, ruge vill type CART19 celler og GM-CSFk/o CART19 med CD19 uttrykker akutt lymfatisk leukemi cellelinje NALM6 på en 1:5 ratio for 4 h ved 37 ° c, 5% co2 i nærvær av monensin løsning, anti-menneskelige CD49d, anti-menneskelige CD28, og anti-menneskelige CD107a.
    2. Høste celler fra kultur for flyt flowcytometri. Vask cellene med strømnings flowcytometri buffer. Stain cellene med en levende/Dead farging Kit. Ruge i mørket ved romtemperatur i 15 min. Fest cellene med et festemiddel og ruge i mørket ved romtemperatur i 15 minutter.
    3. Etter vask, beis cellene intracellulært med permeabilization medium i kombinasjon med anti-menneskelige IFNγ monoklonale antistoff, anti-menneskelige GM-CSF, anti-menneskelige MIP-1β, anti-menneskelige IL-2, og anti-menneskelige CD3 og ruge i mørket ved romtemperatur i 30 min. vask og resuspend prøvene. Anskaffe prøver på en flyt flowcytometer og analysert for prosentandel av intracellulære GM-CSF uttrykk.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 viser reduksjon av GM-CSF i GM-CSFk/o CART19 celler. For å kontrollere at Genova av T-cellene ble endret til knockout GM-CSF, ble TIDEVANNS sekvensering brukt i GM-CSFk/o CART19 celler (figur 1a). CAR-T celleoverflaten farging bekrefter at T cellene vellykket uttrykke bilen overflaten reseptor in vitro av gating på Live CD3 + celler (figur 1B). Intracellulære farging av GM-CSF av Flow flowcytometri demonstrerer redusert uttrykk for GM-CSF i GM-CSFk/o CART19 celler ved gating på Live CD3 + celler, verifisere funksjonell suksess av knockout (figur 1C). GM-CSFk/o Car-T-celler viser en NEDGANG i GM-CSF sammenlignet med wildtype anti-CD19 Car-t-celler (CART19) via intracellulære farging (figur 1B). I tillegg har vi tidligere vist at GM-CSFk/o Car-T-celler redusere PRODUKSJONEN av GM-CSF samtidig forbedre anti-tumor aktivitet og overlevelse sammenlignet med wildtype Car-t celler in vivo. 12 flere 

Trinn Temp (° c) Tid Sykluser
Innledende denaturering 94 3 min 1
Denaturering 94 45 sek 35
Annealing 60 30 sek
Forlengelsen 72 2 min
Post-forlengelse 72 10 min 1
4

Tabell 1: PCR sykkelforhold for TIDE sekvensering av GM-CSFk/o CART19 celler.

Figure 1
Figur 1 : GM-CSFk/o CART19 celler viser reduksjon i GM-CSF. A) en representativ tide sekvens verifiserer Genova endring av GM-CSF CRISPR/Cas9 GM-CSFk/o CART19 celler med avbrudd effektiviteten av ~ 71%. B) representative flyt tomter SKILDRER vellykket Car-T celle produksjon med lignende Car uttrykk på Wild type CART19 og GM-CSFk/o CART19. C) som analyseres av intracellulære FARGING, GM-CSFk/o CART19 celler viser redusert GM-CSF forhold til vill type CART19 når STIMULERT med CD19 positive all cellelinje NALM6. Vennligst klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denne rapporten beskriver vi en metodikk for å utnytte CRISPR/Cas9-teknologi for å indusere sekundære modifikasjoner i CAR-T-celler. Nærmere bestemt er dette demonstrert ved hjelp lentiviral Transduction med en viral vektor som inneholder gRNA rettet mot genet av interesse og Cas9 å generere GM-CSFk/o CART19 celler. Vi hadde tidligere vist at GM-CSF nøytralisering ameliorates CRS og NT i en xenograft modell. 12 som tidligere beskrevet, GM-CSFk/o Car-T-celler tillater HEMMING av GM-CSF under produksjonsprosessen, effektivt redusere PRODUKSJONEN av GM-CSF samtidig opprettholde andre kritiske T celle funksjoner, og resultere i forbedret anti-tumor aktivitet in vivo sammenlignet med wildtype CAR-T-celler. 12 flere

Siden permanent integrering av Cas9 i Genova kan være forbundet med uønskede effekter når oversatt til et klinisk levedyktig produkt, foreslår vi denne konkrete metodikk som en måte å generere forskning grade CRISPR/Cas9 endret CART19 for bevis på konseptet Eksperimenter.

Mens Car-T celler holder løftet i kreft terapi,1,2 deres effekt kan fortsette å være forbedret og deres tilknyttede toksisitet bedre kontrollert. CRISPR/Cas9 teknologien skaffer en strategi å direkte mål det Genova av bil-T celler å ingeniør løsninger å aktuelle klinisk mangler. I denne artikkelen beskriver vi generering av GM-CSFk/o CART19 celler.

GM-CSFk/o Car-t-celler ble generert av Transduction med en lentiviral VEKTOR for Car-t celle plasmider og en lentivirus konstruere inneholder en guide RNA til GM-CSF og Cas9. For å generere GM-CSFk/o, en tredje generasjons lentivirus konstruere (lentiCRISPRv2) som inneholder Cas9 og en rapportert høy effektivitet guide RNA (gRNA) målretting ekson 3 av menneskelig GM-CSF (CSF2)14 under kontroll av en U6 arrangøren ble utnyttet. Spesiell forsiktighet bør utvises under de Transduction trinnene i prosedyren da disse er de mest kritiske til utviklingen av de modifiserte CAR-T-cellene. Knockout effektivitet kan verifiseres og vurderes via sporing av indeler ved nedbryting (TIDE) sekvenser. Funksjonell aktivitet av CAR-T-celler er undersøkt gjennom antigen spesifikke stimulering av CAR konstruere med CD19 + målceller, etterfulgt av måling av ulike T celle funksjoner, inkludert produksjon av GM-CSF. 12 av notatet, FARGING for Car uttrykk med en geit anti-mus antistoff bør skje før andre antistoff flekker med to vasker oppstår før overflaten farging på grunn av enkelt kjede variabel region fragment av CART19 være av musen opprinnelse. Dette er et punkt i vekt i trøbbel skyting hvis god bil uttrykket ikke er i utgangspunktet observert.

Disse modifiserte CAR-T-cellene kan brukes i in vitro studier og in vivo xenograft modeller for bevis på konsept eksperimenter. En fordel med denne teknikken er at CAR-T celle produksjon og genetisk manipulasjon kan både forekomme i ett trinn med god effektivitet i forhold til andre teknikker. 10 andre , 11 mens dual lentiviral Transduction er en praktisk og effektiv metode for å generere forskning karakteren GM-CSFk/o CART19 celler, er DNA innlemmet i Genova og langvarig Cas9 uttrykk kan destabilisere de Genova og øke risikoen for bivirkninger utenfor målet. En begrensning av denne teknikken er at god-produksjon praksis grade Knockouts ville kreve modifikasjon av teknikken til en ribonucleoprotein CRISPR/Cas9 system som denne metodikken ikke resulterer i permanent inkorporering av Cas9 inn i Genova og reduserer faren for effekter utenfor målet. Metodikken beskrevet i protokollen her kan potensielt brukes på en rekke gener til genetisk modifisere CAR-T-celler via CRISPR/Cas9 å bidra til å generere mindre giftige eller mer effektive CAR-T-celler.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK er en oppfinner på patenter innen CAR T-celle terapi som er lisensiert til Novartis (under en avtale mellom Mayo Clinic, University of Pennsylvania, og Novartis). Disse studiene ble finansiert delvis av et stipend fra Humanigen (SSK). RMS, MJC, RS, og SSK er oppfinnere på patenter knyttet til dette arbeidet. Laboratoriet (SSK) mottar midler fra Tolero, Humanigen, kite, Lentigen, Morphosys, og Actinium.

Acknowledgments

Dette arbeidet ble støttet gjennom tilskudd fra K12CA090628 (SSK), National Comprehensive Cancer Network (SSK), den Mayo Clinic Center for individualisert medisin (SSK), den Predolin Foundation (SSK), den Mayo Clinic Office of Translation til Practice (SSK), og den Mayo Clinic medisinsk forsker Training program Robert L. Howell lege-forsker stipend (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics