CAR-T सेल में जीएम-सीएसएफ को नॉक आउट करने के लिए CRISPR/Cas9 का उपयोग करना

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहाँ, हम एक CRISPR/Cas9 प्रणाली के माध्यम से सीएआर-टी कोशिकाओं को आनुवंशिक रूप से संपादित करने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimeric प्रतिजन रिसेप्टर टी (सीएआर-टी) सेल थेरेपी कैंसर के लिए एक अत्याधुनिक और संभावित क्रांतिकारी नए उपचार विकल्प है. हालांकि, कैंसर के उपचार में इसके व्यापक उपयोग की महत्वपूर्ण सीमाएं हैं। इन सीमाओं में साइटोकिन रिलीज सिंड्रोम (सीआरएस) और न्यूरोटॉक्सिसिटी (एनटी) और सीमित विस्तार, प्रभावक कार्य, और ठोस ट्यूमर में एंटी-ट्यूमर गतिविधि जैसे अद्वितीय विषाक्तता का विकास शामिल है। सीएआर-टी कोशिकाओं की सीएआर-टी प्रभावकारिता और/या नियंत्रण विषाक्तता को बढ़ाने के लिए एक रणनीति सीएआर-टी सेल विनिर्माण के दौरान स्वयं सीएआर-टी कोशिकाओं के जीनोम को संपादित करना है। यहाँ, हम एक lentiviral निर्माण के साथ transduction के माध्यम से CAR-T कोशिकाओं में CRISPR/Cas9 जीन संपादन के उपयोग का वर्णन एक गाइड आरएनए दानेदार मैक्रोफेज कॉलोनी-उत्तेजक कारक (जीएम-सीएसएफ) और Cas9 युक्त. एक उदाहरण के रूप में, हम GM-CSF के CRISPR/Cas9 मध्यस्थता नॉकआउट का वर्णन करते हैं। हमने दिखाया है कि इन जीएम-सीएसएफk/o कार-टी कोशिकाओं को प्रभावी ढंग से कम जीएम-सीएसएफ का उत्पादन करते हुए महत्वपूर्ण टी सेल समारोह को बनाए रखने और जंगली प्रकार सीएआर-टी कोशिकाओं की तुलना में विवो में बढ़ाया विरोधी ट्यूमर गतिविधि में परिणाम।

Introduction

Chimeric प्रतिजन रिसेप्टर टी (सीएआर-टी) सेल थेरेपी कैंसर के उपचार में महान वादा दर्शाती है. 1 , 2 दो कार-टी सेल चिकित्सा CD19 को लक्षित (CART19) हाल ही में संयुक्त राज्य अमेरिका में अनुमोदित किया गया और यूरोप में बहुकेंद्र नैदानिक परीक्षणों में हड़ताली परिणामों का प्रदर्शन करने के बाद बी सेल द्रोह में उपयोग के लिए. 3 , 4 , 5 सीएआर-टी कोशिकाओं के अधिक व्यापक उपयोग के लिए बाधाओं ठोस ट्यूमर में सीमित गतिविधि और साइटोकिन रिलीज सिंड्रोम (सीआरएस) और neurotoxicity (NT) सहित जुड़े toxicities हैं। 3 , 5 , 6 , 7 , 8 , 9 सीएआर-टी सेल थेरेपी के चिकित्सीय सूचकांक को बढ़ाने के लिए, जीनोम इंजीनियरिंग उपकरण जैसे जस्ता उंगली न्यूक्लेस, टैलेन, और CRISPR कम विषाक्त या अधिक प्रभावी सीएआर-टी कोशिकाओं को उत्पन्न करने के प्रयास में सीएआर-टी कोशिकाओं को और संशोधित करने के लिए कार्यरत हैं। 10 , 11

इस आलेख में, हम CRISPR/Cas9 संपादित CAR-T कक्ष जनरेट करने के लिए एक विधि का वर्णन करें। इस विधि का विशिष्ट लक्ष्य कम विषाक्त या अधिक प्रभावी सीएआर-टी कोशिकाओं को उत्पन्न करने के लिए CRISPR/Cas9 के माध्यम से सीएआर-टी सेल विनिर्माण के दौरान सीएआर-टी कोशिकाओं को आनुवंशिक रूप से संशोधित करना है। इस पद्धति को विकसित करने के लिए तर्क कार-टी सेल थेरेपी के नैदानिक अनुभव से सीखा सबक पर बनाया गया है, जो उपन्यास रणनीतियों के लिए एक तत्काल जरूरत को इंगित करता है कार-टी सेल थेरेपी की चिकित्सीय खिड़की बढ़ाने के लिए और में आवेदन का विस्तार अन्य ट्यूमर और क्लिनिक में प्रवेश करने के लिए शुरू कर दिया है कि कार-टी कोशिकाओं के कई संशोधनों की अनुमति सिंथेटिक जीव विज्ञान में हाल ही में अग्रिम द्वारा समर्थित है। जबकि कई जीनोम इंजीनियरिंग उपकरण विकसित किए जा रहे हैं और विभिन्न सेटिंग्स में लागू किए जा रहे हैं, जैसे जस्ता उंगली न्यूक्लेस, टैलेन, और CRISPR, हमारी कार्यप्रणाली में CAR-T कोशिकाओं के CRISPR/Cas9 संशोधन का वर्णन किया गया है। 10 , 11 CRISPR/Cas9 एक आरएनए आधारित जीवाणु रक्षा तंत्र है कि विदेशी डीएनए को खत्म करने के लिए डिज़ाइन किया गया है. CRISPR एक गाइड आरएनए (GRNA) के माध्यम से पहचान की एक लक्ष्य अनुक्रम को छोड़ने के लिए endonucleases पर निर्भर करता है। CAR-T कोशिकाओं के CRISPR संपादन अन्य जीनोम इंजीनियरिंग उपकरणों पर कई फायदे प्रदान करता है. ये gRNA अनुक्रम की परिशुद्धता शामिल हैं, एक gRNA ब्याज के जीन को लक्षित डिजाइन करने के लिए सादगी, उच्च जीन संपादन दक्षता, और कई gRNAs के बाद से कई जीन को लक्षित करने की क्षमता एक ही समय में इस्तेमाल किया जा सकता है.

विशेष रूप से यहाँ वर्णित तरीकों में, हम टी कोशिकाओं के कार transduction के दौरान एक जीन को बाधित करने के लिए एक lentivirus एन्कोडिंग CRISPR गाइड आरएनए और Cas9 इस्तेमाल किया. कार-टी कोशिकाओं को संपादित करने के लिए एक उपयुक्त तकनीक का चयन करने में, हम सुझाव है कि यहाँ वर्णित तकनीक अनुसंधान ग्रेड सीएआर-टी कोशिकाओं को उत्पन्न करने के लिए एक कुशल तंत्र है, लेकिन क्योंकि जीनोम में Cas9 के स्थायी एकीकरण के दीर्घकालिक प्रभाव अज्ञात है, हम अवधारणा अनुसंधान ग्रेड सीएआर-टी कोशिकाओं का सबूत विकसित करने के लिए इस पद्धति का प्रस्ताव है, लेकिन अच्छा विनिर्माण अभ्यास ग्रेड सीएआर-टी कोशिकाओं के उत्पादन के लिए नहीं।

विशेष रूप से, यहाँ हम दानेदार मैक्रोफेज कॉलोनी उत्तेजक कारक (जीएम-सीएसएफ) नॉकआउट कार-टी कोशिकाओं मानव CD19 को लक्षित करने की पीढ़ी का वर्णन. इन कार-टी कोशिकाओं को lentiviral कणों जीएम-सीएसएफ (जीन नाम CSF2) और Cas9 के लिए विशिष्ट आरएनए एन्कोडिंग के साथ transduction द्वारा उत्पन्न किया गया. हमने पहले पाया था कि जीएम-सीएसएफ तटस्थीकरण एक विदेशी ग्राफ्ट मॉडल में सीआरएस और एनटी को सुधारता है। 12 जीएम-सीएसएफk/o कार-टी कोशिकाओं विनिर्माण प्रक्रिया के दौरान जीएम-सीएसएफ के निषेध के लिए अनुमति देते हैं, प्रभावी ढंग से जीएम-सीएसएफ के उत्पादन को कम करने, जबकि कार-टी सेल विरोधी ट्यूमर गतिविधि और वाइल्डटाइप सीएआर-टी कोशिकाओं की तुलना में विवो में अस्तित्व को बढ़ाने। 12 इस प्रकार, यहाँ हम CRISPR/Cas9 संपादित कार-टी कोशिकाओं को उत्पन्न करने के लिए एक पद्धति प्रदान करते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

यह प्रोटोकॉल मेयो क्लिनिक के संस्थागत समीक्षा बोर्ड (आईआरबी) और संस्थागत जैव सुरक्षा समिति (आईबीसी) के दिशानिर्देशों का पालन करता है।

1. CART19 सेल उत्पादन

  1. टी सेल अलगाव, उत्तेजना, और पूर्व vivo संस्कृति
    1. उपयुक्त व्यक्तिगत सुरक्षात्मक उपकरण का उपयोग एक सेल संस्कृति हुड में सभी सेल संस्कृति काम बाहर ले. एफेरेसिस के दौरान एकत्र किए गए सामान्य दाता रक्त शंकु से फसल परिधीय रक्त मोनोन्यूक्लियर कोशिकाओं (पीबीएमसी) को पीबीएमसी का एक व्यवहार्य स्रोत माना जाता है।13
    2. PBMCs को अलग करने के लिए, एक घनत्व ग्रेडिएंट माध्यम के 15 एमएल को 50 एमएल घनत्व ढाल जुदाई ट्यूब में जोड़ें। सेल ट्रैपिंग से बचने के लिए 2% भ्रूण गोजातीय सीरम (एफबीएस) युक्त फॉस्फेट-बफर नमकीन (पीबीएस) की एक समान मात्रा के साथ दाता रक्त को पतला करें।
      1. कोन से पतला दाता रक्त जुदाई ट्यूब में जोड़ें, रक्त और घनत्व ढाल माध्यम के बीच इंटरफेस को परेशान करने के लिए सावधान नहीं। आरटी में 10 मिनट के लिए 1,200 x ग्राम पर सेंट्रीफ्यूज।
      2. एक नया 50 एमएल शंकु में supernatant, पीबीएस के साथ धोने + 2% FBS 40 एमएल तक लाने के द्वारा, आरटी में 8 मिनट के लिए 300 x ग्राम पर centrifuge, aspirate supernatant, बफर के 40 एमएल में resuspend, और गिनती कोशिकाओं.
    3. निर्माता के प्रोटोकॉल के अनुसार एक पूरी तरह से स्वचालित सेल विभाजक का उपयोग कर एक नकारात्मक चयन चुंबकीय मनका किट के माध्यम से PBMCs से टी कोशिकाओं को अलग करें।
    4. अलग टी कोशिकाओं को संस्कृति के लिए, टी सेल माध्यम (टीसीएम) तैयार करें जिसमें 10% मानव एबी सीरम (v/v), 1% पेनिसिलिन-स्ट्रेप्टोमाइसिन-ग्लूटामाइन (v/v), और सीरम-मुक्त हेमेटोपोइटिक सेल माध्यम शामिल हैं। एक 0.45 मीटर बाँझ वैक्यूम फिल्टर के माध्यम से छानने के द्वारा और फिर एक 0.22 m बाँझ वैक्यूम फिल्टर के साथ माध्यम बाँझ.
    5. 0 दिन (टी सेल उत्तेजना के दिन), टी कोशिकाओं की उत्तेजना से पहले CD3/CD28 मोती धोने. धोने के लिए, मोती की आवश्यक मात्रा जगह (के अनुपात के लिए पर्याप्त CD3/CD28 मोती का उपयोग करें 3:1 मोती: टी कोशिकाओं; ध्यान दें मोती की एकाग्रता चर हो सकता है) एक बाँझ 1.5 एमएल microcentrifuge ट्यूब में और TCM के 1 एमएल में resuspend.
    6. चुंबक के संपर्क में रखें।
    7. 1 मिनट के बाद, TCM aspirate और ताजा TCM के 1 एमएल में resuspend मोती धोने के लिए.
    8. कुल तीन washes के लिए इस प्रक्रिया को दोहराएँ.
    9. तीसरे धोने के बाद, TCM के 1 एमएल में मोती resuspend.
    10. T कक्षों की गणना करें.
    11. 3:1 मोती: कक्षों के अनुपात में टी कोशिकाओं को मोतियों को स्थानांतरित करें.
    12. 1 x 106 कोशिकाओं/एमएल की अंतिम सांद्रता के लिए कोशिकाओं को विलेय ित करें।
    13. 37 डिग्री सेल्सियस पर इनक्यूबेट, 24 ज के लिए 5% सीओ2।
  2. टी सेल ट्रांसेक्शन और ट्रांसडक्शन
    1. बीएसएल-2 + सावधानियों का उपयोग कर के बाहर lentiviral काम ले, सेल संस्कृति hoods, व्यक्तिगत सुरक्षा उपकरण, और निपटान से पहले ब्लीच के साथ इस्तेमाल किया सामग्री के कीटाणुशोधन सहित.
    2. एक lentiviral वेक्टर में एक CART19 निर्माण प्राप्त करें।
      नोट: यहाँ का उपयोग किया CART19 निर्माण डिजाइन किया गया था और फिर एक व्यावसायिक रूप से उपलब्ध प्रोटीन संश्लेषण विक्रेता का उपयोग कर de नोवो संश्लेषित. कार निर्माण बाद में एक EF-1 $ प्रमोटर के नियंत्रण में एक तीसरी पीढ़ी lentivirus में क्लोन किया गया था. एकल श्रृंखला चर क्षेत्र टुकड़ा FMC63 क्लोन से ली गई है और मानव CD19 पहचानता है. CAR19 निर्माण एक दूसरी पीढ़ी के पास 4-1BB costimulatory डोमेन और CD3 - उत्तेजना (FMC63-41BBz). 12
    3. पहले वर्णित के रूप में lentiviral उत्पादन प्रदर्शन. 12
      1. संक्षेप में, lentivirus का उत्पादन करने के लिए, 293T कोशिकाओं है कि 70-90% संगम तक पहुँच चुके हैं का उपयोग करें.
      2. ट्रांसफेक्शन अभिकर्मकों के कमरे के तापमान पर 30 मिनट के लिए इनक्यूबेशन की अनुमति दें, जिसमें ब्याज की 15 डिग्री ग्राम, एक गैग/पोल/टैट/रेव पैकेजिंग वेक्टर का 18 ग्राम, वीएसवी-जी एनवेलियाव वेक्टर का 7 ग्राम, पूर्व-जटिल अभिकर्मक के 111 डिग्री एल, 129 डिग्री एल के एल शामिल हैं। 293T कोशिकाओं को जोड़ने से पहले transfection अभिकर्मक, और transfection माध्यम के 9.0 एमएल. फिर 37 डिग्री सेल्सियस, 5% सीओ2पर transfected कोशिकाओं संस्कृति।
      3. हार्वेस्ट, अपकेंद्रित्र (900 x ग्राम के लिए 10 मिनट), फिल्टर (0.45 डिग्री सेल्सियस नायलॉन फिल्टर), और 24 और 48 एच पर ultracentrifugation द्वारा या तो 13,028 x g के लिए 18 एच या 112,700 x के लिए 2 एच.
      4. भविष्य के उपयोग के लिए -80 डिग्री सेल्सियस पर फ्रीज करें।
    4. 1 दिन, धीरे टी कोशिकाओं को फिर से शुरू करने के लिए टी कोशिकाओं है कि 1 x 106/ mL पर प्रेरित किया गया था के rosettes तोड़ने के लिए दिन 0 पर.
    5. सभी lentiviral काम के लिए उपयुक्त बीएसएल-2 + सावधानियों के तहत, 3.0 के संक्रमण (एमओआई) की बहुलता में प्रेरित टी कोशिकाओं के लिए ताजा या जमे हुए काटा वायरस जोड़ें।
  3. कार-टी सेल विस्तार
    1. विस्तार के चरण के दौरान, 37 डिग्री सेल्सियस, 5% सीओ2पर ट्रांसड्यूस्ड टी कोशिकाओं को इनक्यूबेट करना जारी रखें। दिन 3 और 5 पर कार-टी कोशिकाओं की गणना करें, और 1 x 106/mL की एक कार-टी सेल एकाग्रता बनाए रखने के लिए संस्कृति के लिए ताजा, पूर्व-गर्म TCM जोड़ें।
    2. ट्रांसड्यूस टी कोशिकाओं से मोती निकालें 6 उत्तेजना के बाद दिन (दिन 6) एक चुंबक का उपयोग कर. फसल, पुन: निलंबित, और 1 मिनट के लिए एक चुंबक में 50 एमएल शंकु ट्यूबों में टी कोशिकाओं जगह है। फिर supernatant इकट्ठा (कार-टी कोशिकाओं को शामिल है), और मोती त्यागें.
    3. एकत्र सीएआर-टी कोशिकाओं को 1 x 106 कोशिकाओं/एमएल की सांद्रता में वापस संस्कृति में रखें ताकि विस्तार फिर से शुरू किया जा सके।
    4. 6 दिन, प्रवाह साइटोमेट्री द्वारा कार की सतह अभिव्यक्ति का आकलन.
      नोट: कई तरीकों CAR की सतह अभिव्यक्ति का पता लगाने के लिए इस्तेमाल किया जा सकता है, इस तरह के एक बकरी विरोधी माउस IgG (एच + एल) के साथ धुंधला के रूप में पार adsorbed माध्यमिक एंटीबॉडी या एक CD19 विशिष्ट पेप्टाइड के साथ धुंधला द्वारा, एक fluorochrome के लिए संयुग्मी. यहाँ, संस्कृति से एक alicot (लगभग 100,000 टी कोशिकाओं) ले और प्रवाह बफर Dulbecco फॉस्फेट-बफर नमकीन, 2% भ्रूण गोजातीय सीरम, और 1% सोडियम azide के साथ तैयार के साथ धोने. विरोधी कार एंटीबॉडी के साथ कोशिकाओं को दाग और दो बार धोने. लाइव/मृत दाग और CD3 मोनोक्लोनल एंटीबॉडी (OKT3) के साथ कोशिकाओं को दाग। कोशिकाओं को धो लें और प्रवाह बफर में फिर से निलंबित करें। transduction दक्षता निर्धारित करने के लिए एक साइटोमीटर पर प्राप्त करें।
  4. कार-टी सेल क्रायोप्रेक्षण
    1. फसल और cryopreserve कार-टी कोशिकाओं उत्तेजना के बाद 8 दिन (टी सेल विस्तार के दिन 8), संस्कृति से कोशिकाओं फसल.
    2. 300 x ग्रामपर 5 मिनट के लिए नीचे स्पिन .
    3. ठंड माध्यम में 10 लाख कोशिकाओं प्रति एमएल प्रति एमएल पर ठंड माध्यम में पुन: निलंबित 10% dimethyl suloxide और 90% भ्रूण गोजातीय सीरम से मिलकर.
    4. एक ठंड कंटेनर में फ्रीज -80 डिग्री सेल्सियस फ्रीजर में -1 डिग्री सेल्सियस/मिनट की दर को प्राप्त करने और फिर 48 एच के बाद तरल नाइट्रोजन के लिए स्थानांतरण।
    5. इन विट्रो में या विवो प्रयोगों में उनके उपयोग से पहले, गर्म TCM में कार-टी कोशिकाओं thaw.
    6. डाइमेथिल सल्फोक्साइड को पतला करने और हटाने के लिए कोशिकाओं को धोएं और गर्म टीसीएम में 2 x 106 कोशिकाओं/ 37 डिग्री सेल्सियस पर रात भर आराम करो, 5% सीओ2|

2. जीएम-सीएसएफ k/o CART19 उत्पादन

  1. जीएम-सीएसएफ को बाधित करने के लिए, स्क्रीनिंग के माध्यम से चयनित मानव जीएम-सीएसएफ (CSF2) के एक्सऑन 3 को लक्षित करने वाले एक गाइड आरएनए (जीआरएनए) का उपयोग करें, जो पहले मानव साइटोकिन जीएम-सीएसएफ के लिए एनकोड करने वाले सीएसएफ 2 जीन के लिए उच्च दक्षता की सूचना दी थी। 14
    नोट: एक व्यावसायिक संश्लेषित अनुसंधान ग्रेड Cas9 तीसरी पीढ़ी lentiviral इस gRNA युक्त निर्माण (एक U6 प्रमोटर के तहत) इस्तेमाल किया गया था. निर्माण एक puromycin प्रतिरोध जीन शामिल हैं. GRNA के अनुक्रम GACCTGCCTACAGACCCCCCहै. 12
  2. lentivirus का उत्पादन करने के लिए, 293T कोशिकाओं है कि 70-90% संगम तक पहुँच चुके हैं का उपयोग करें.
  3. ब्याज की lentiviral प्लाज्मिड के 15 डिग्री ग्राम की अनुमति दें, एक गैग/पोल/टट/रेव पैकेजिंग वेक्टर का 18 डिग्री ग्राम, वीएसवी-जी लिफाफा वेक्टर का 7 डिग्री, पूर्व जटिल अभिकर्मक का 111 डिग्री सेल्सियस, ट्रांसफेक्शन रिएजेंट का 129 डिग्री सेल्सियस, और ट्रांसफेक्शन मीडियम के 9.0 एमएल को 30 मिनट के लिए प्रवेश कक्ष में प्रवेश करने के लिए अनुमति दें। mperature.
  4. 293T कोशिकाओं में ट्रांसफेलेशन अभिकर्मक जोड़ें. फिर 37 डिग्री सेल्सियस पर संस्कृति, 5% सीओ2.
  5. हार्वेस्ट, अपकेंद्रित्र (900 x ग्राम 10 मिनट के लिए), फिल्टर (0.45 डिग्री सेल्सियस नायलॉन फिल्टर) और 24 और 48 एच पर ultracentrifugation द्वारा या तो 13,028 x g के लिए 18 h या 112,700 x ग्राम 2 एच के लिए और भविष्य के उपयोग के लिए -80 डिग्री सेल्सियस पर फ्रीज पर जमा.
  6. 1 दिन, धीरे से roseettes को तोड़ने के लिए टी कोशिकाओं को फिर से निलंबित.
  7. एक बीएसएल-2 + अनुमोदित प्रयोगशाला में, सीएआर-टी कोशिकाओं को उत्पन्न करने के लिए प्रेरित टी कोशिकाओं में जमे हुए या ताजा काटा वायरस जोड़ें। दोनों CAR19 lentivirus और जीएम-सीएसएफ CRISPR lentivirus को लक्षित के साथ टी कोशिकाओं transduce. 3 के एक MOI में CAR19 lentivirus जोड़ें. चूंकि CRISPR lentivirus का अनुमापन संभव नहीं था, इसलिए 10 x 106 T कोशिकाओं को ट्रांसड्यूस करने के लिए 15 ug प्लाज्मिड तैयारी से उत्पन्न वायरस कणों का उपयोग करें।
  8. टी सेल उत्तेजना, विस्तार, और cryopservation के शेष चरणों के रूप में चरण 1 में चर्चा देखें.
  9. परोमाइसिसिन प्रतिरोध ले जाने वाली मसूरीक्रिस्पर-संपादित टी कोशिकाओं के लिए, 3 दिन और दिन 5 पर प्रति 1 एमएल पर प्यूरोमाइसिन के 1 डिग्री ग्राम की एकाग्रता पर प्यूरोमाइसिन डाइहाइड्रोक्लोराइड के साथ कोशिकाओं का इलाज करें।

3. जीएम-सीएसएफ व्यवधान दक्षता और जीएम-सीएसएफ k/

  1. जीएम-सीएसएफ व्यवधान दक्षता: अपघटन (TIDE) अनुक्रमण और विश्लेषण द्वारा indels की ट्रैकिंग
    1. GM-CSF जीन में ब्याज की exon अनुक्रम करने के लिए, निम्नलिखित प्राइमर का उपयोग करें. TGACTACAGAGAGA के जीएम-सीएसएफ (CSF2) के लिए एक आगे प्राइमर अनुक्रम का उपयोग करें, और TCACCTCTGACCATTAACC के एक रिवर्स प्राइमर अनुक्रम।
    2. एक जीनोमिक निष्कर्षण किट के साथ अप करने के लिए 5 लाख कार-टी कोशिकाओं से डीएनए निकालें। पीसीआर प्रतिक्रिया के लिए, $M की पीसीआर प्रतिक्रिया में प्रत्येक प्राइमर की अंतिम एकाग्रता के साथ प्रतिक्रिया के प्रति एक Tak mastermix के 25 डिग्री एल का उपयोग करें, 0.1-0.5 टेम्पलेट डीएनए की डिग्री, और पीसीआर प्रतिक्रिया की कुल मात्रा nuclease मुक्त पानी के साथ 50 डिग्री सेल्सियस तक लाया.
    3. तालिका 1में वर्णित PCR साइकिल चालन की स्थिति देखें।
    4. 30 मिनट के लिए 100 वी पर एक 1-2% agarose जेल पर पीसीआर नमूने चलाने के लिए और एक जेल निष्कर्षण किट का उपयोग कर निकालने।
    5. अनुक्रम पीसीआर amplicons. एक उपयुक्त TIDE सॉफ्टवेयर में कच्चे डेटा अपलोड करके allele संशोधन आवृत्ति की गणना. 15
  2. जीएम-सीएसएफ उत्पादन और जीएम-सीएसएफk/
    1. कार-टी कोशिकाओं के cytokine उत्पादन निर्धारित करने के लिए, इनक्यूबेट जंगली प्रकार CART19 कोशिकाओं और CD19 के साथ जीएम-CSFk/o CART19 तीव्र लिम्फोब्लास्टिक ल्यूकेमिया सेल लाइन NALM6 पर एक 1:5 अनुपात पर 4 एच के लिए 37 डिग्री सेल्सियस, मोनेसिन की उपस्थिति में 5% सीओ2 व्यक्त समाधान, विरोधी मानव CD49d, विरोधी मानव CD28, और विरोधी मानव CD107a.
    2. प्रवाह साइटोमेट्री के लिए संस्कृति से हार्वेस्ट कोशिकाओं. प्रवाह साइटोमेट्री बफर के साथ कोशिकाओं को धो लें। एक जीवित / मृत धुंधला किट के साथ कोशिकाओं को दाग. 15 मिनट के लिए कमरे के तापमान पर अंधेरे में इनक्यूबेट करें। कोशिकाओं को स्थिरण माध्यम के साथ ठीक करें और 15 मिनट के लिए कमरे के तापमान पर अंधेरे में इनक्यूबेट करें।
    3. धोने के बाद, विरोधी मानव IFN के साथ संयोजन में permeabilization माध्यम के साथ intracellularly कोशिकाओं दाग, विरोधी मानव जीएम-सीएसएफ, विरोधी मानव एमआईपी-1], विरोधी मानव आईएल -2, और विरोधी मानव CD3 और 30 के लिए कमरे के तापमान पर अंधेरे में इनक्यूबेट मि. धो लें और नमूनों को फिर से निलंबित करें। एक प्रवाह साइटोमीटर पर नमूने प्राप्त और intracellular जीएम-सीएसएफ अभिव्यक्ति के प्रतिशत के लिए विश्लेषण किया.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

चित्र 1 जीएम-सीएसएफ के जीएम-सीएसएफ की कमी को दर्शाता है। यह सत्यापित करने के लिए कि टी कोशिकाओं के जीनोम को जीएम-सीएसएफ को नॉकआउट करने के लिए परिवर्तित किया गया था, टीईडी अनुक्रमण का उपयोग जीएम-सीएसएफk/o CART19 कोशिकाओं में किया गया था (चित्र 1A)। कार-टी सेल सतह धुंधला पुष्टि करता है कि टी कोशिकाओं को सफलतापूर्वक लाइव CD3 + कोशिकाओं पर gating द्वारा इन विट्रो में कार सतह रिसेप्टर व्यक्त (चित्र 1B) . प्रवाह साइटोमेट्री द्वारा जीएम-सीएसएफ के इंट्रासेल्यूलर दाग जीएम-सीएसएफ के जीएम-सीएसएफ की कम अभिव्यक्ति को दर्शाता है जीएम-सीएसएफk/o CART19 कोशिकाओं पर लाइव CD3 + कोशिकाओं पर gating द्वारा, नॉकआउट की कार्यात्मक सफलता की पुष्टि (चित्र 1C)। GM-CSFk/o CAR-T सेल इंट्रासेल्यूलर धुंधलाकेमाध्यम से वाइल्डटाइप एंटी-CD19 CAR-T कोशिकाओं (CART19) की तुलना में जीएम-सीएसएफ में कमीदर्शातीहै। इसके अलावा, हमने पहले यह दिखाया है कि जीएम-सीएसएफk/o CAR-T सेल जीएम-सीएसएफ के उत्पादन को कम करते हुए विवो में वाइल्डटाइप सीएआर-टी कोशिकाओं की तुलना में एंटी-ट्यूमर गतिविधि और अस्तित्व को बढ़ाते हैं। 12 

चरण अस्थायी (जेडसी) समय चक्र
प्रारंभिक विकृतीकरण 94 3 मिनट 1
विकृतीकरण 94 45 सेकंड 35
अनीलन 60 30 सेकंड
एक्सटेंशन 72 2 मिनट
पश्चता 72 10 मिनट 1
4

तालिका 1: जीएम-सीएसएफk/o CART19 कोशिकाओं के TIDE अनुक्रमण के लिए पीसीआर साइकिलिंग शर्तों।

Figure 1
चित्र 1 : जीएम-सीएसएफk/ CART19 कोशिकाओं जीएम-सीएसएफ में कमी दिखाते हैं। ) एक प्रतिनिधि TIDE अनुक्रम जीएम-सीएसएफ CRISPR/Cas9 जीएम-सीएसएफk/o CART19 कोशिकाओं के जीनोम परिवर्तन की पुष्टि करता है जिसमें $71% की व्यवधान दक्षता है। बी)प्रतिनिधि प्रवाह भूखंडों जंगली प्रकार CART19 और जीएम-सीएसएफk/o CART19 पर इसी तरह की कार अभिव्यक्ति के साथ सफल कार-टी सेल उत्पादन को दर्शाती है। ) जैसा कि इंट्रासेल्यूलर धुंधला द्वारा परख किया गया है, जीएम-सीएसएफk/o CART19 कोशिकाओं जंगली प्रकार CART19 की तुलना में कम जीएम-सीएसएफ दिखा जब CD19 सकारात्मक सभी सेल लाइन NALM6 के साथ प्रेरित. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस रिपोर्ट में, हम सीएआर-टी कोशिकाओं में द्वितीयक संशोधनों को प्रेरित करने के लिए CRISPR/Cas9 तकनीक का उपयोग करने के लिए एक पद्धति का वर्णन करते हैं। विशेष रूप से, यह एक वायरल वेक्टर है कि gRNA ब्याज और Cas9 के जीन को लक्षित करने के लिए जीएम-CSFk/o CART19 कोशिकाओं उत्पन्न के साथ lentiviral transduction का उपयोग कर प्रदर्शन किया है. हमने पहले यह दिखाया था कि जीएम-सीएसएफ तटस्थीकरण एक विदेशी मॉडल में सीआरएस और एनटी को सुधारता है। 12 जैसा कि पहले बताया गया है, जीएम-सीएसएफk/o कार-टी कोशिकाओं के निर्माण की प्रक्रिया के दौरान जीएम-सीएसएफ के निषेध के लिए अनुमति देते हैं, प्रभावी ढंग से जीएम-सीएसएफ के उत्पादन को कम करते हुए अन्य महत्वपूर्ण टी सेल कार्यों को बनाए रखने, और बढ़ाया में परिणाम वाइल्डटाइप सीएआर-टी कोशिकाओं की तुलना में विवो में ट्यूमर विरोधी गतिविधि। 12

जीनोम में Cas9 के स्थायी एकीकरण के बाद से अवांछित प्रभाव के साथ जुड़ा हो सकता है जब एक नैदानिक व्यवहार्य उत्पाद के लिए अनुवाद, हम अवधारणा के सबूत के लिए अनुसंधान ग्रेड CRISPR/Cas9 संशोधित CART19 उत्पन्न करने के लिए एक तरह के रूप में इस विशिष्ट पद्धति का प्रस्ताव प्रयोगों.

जबकि कार-टी कोशिकाओं कैंसर चिकित्सा में वादा पकड़,1,2 उनकी प्रभावकारिता बढ़ाया जा करने के लिए जारी रख सकते हैं और उनके जुड़े toxicities बेहतर नियंत्रित. CRISPR/Cas9 प्रौद्योगिकी वर्तमान नैदानिक कमियों के समाधान इंजीनियर करने के लिए सीधे सीएआर-टी कोशिकाओं के जीनोम को लक्षित करने के लिए एक रणनीति प्रदान करता है। इस लेख में, हम जीएम-सीएसएफk/o CART19 कोशिकाओं के उत्पादन का वर्णन करते हैं।

जीएम-सीएसएफk/o कार-टी कोशिकाओं को सीएआर-टी सेल प्लाज्मिड के लिए एक मसूरीवायरल वेक्टर के साथ ट्रांसडक्शन द्वारा उत्पन्न किया गया था और जीएम-सीएसएफ और Cas9 के लिए एक गाइड आरएनए युक्त एक lentivirus निर्माण किया गया था। जीएम-सीएसएफk/oउत्पन्न करने के लिए, एक तीसरी पीढ़ी के lentivirus निर्माण (lentiCRISPRv2) युक्त Cas9 और एक रिपोर्ट उच्च दक्षता गाइड आरएनए (gRNA) मानव जीएम-सीएसएफ (CSF2)14 के एक U6 प्रमोटर के नियंत्रण के तहत exon 3 को लक्षित किया गया था. प्रक्रिया के ट्रांसडक्शन चरणों के दौरान विशेष सावधानी बरती जानी चाहिए क्योंकि ये संशोधित सीएआर-टी कोशिकाओं के विकास के लिए सबसे महत्वपूर्ण हैं। नॉकआउट दक्षता सत्यापित किया जा सकता है और अपघटन (TIDE) दृश्यों द्वारा indels की ट्रैकिंग के माध्यम से मूल्यांकन किया. सीएआर-टी कोशिकाओं की कार्यात्मक गतिविधि CD19 + लक्ष्य कोशिकाओं के साथ सीएआर निर्माण के प्रतिजन विशिष्ट उत्तेजना के माध्यम से जांच की जाती है, जिसके बाद जीएम-सीएसएफ के उत्पादन सहित विभिन्न टी सेल कार्यों की माप होती है। 12 ध्यान दें, एक बकरी विरोधी माउस एंटीबॉडी के साथ कार अभिव्यक्ति के लिए धुंधला माउस मूल के होने की एक श्रृंखला चर क्षेत्र टुकड़ा के कारण सतह धुंधला होने से पहले होने वाली दो washes के साथ अन्य एंटीबॉडी धुंधला होने से पहले होना चाहिए. यह मुसीबत शूटिंग में जोर देने का एक बिंदु है अगर अच्छा कार अभिव्यक्ति शुरू में मनाया नहीं जाता है.

इन संशोधित सीएआर-टी कोशिकाओं को इन विट्रो अध्ययनों में और अवधारणा प्रयोगों के सबूत के लिए विवो एक्सेनोग्रैफ्ट मॉडल में इस्तेमाल किया जा सकता है। इस तकनीक का एक लाभ यह है कि कार-टी सेल उत्पादन और आनुवंशिक हेरफेर दोनों अन्य तकनीकों की तुलना में अच्छी दक्षता के साथ एक कदम में हो सकता है. 10 , 11 जबकि दोहरी lentiviral transduction अनुसंधान ग्रेड जीएम-सीएसएफk/o CART19 कोशिकाओं उत्पन्न करने के लिए एक सुविधाजनक और प्रभावी तरीका है, डीएनए जीनोम में शामिल किया गया है और लंबे समय तक Cas9 अभिव्यक्ति जीनोम अस्थिर और वृद्धि हो सकती है ऑफ-लक्ष्य प्रभाव का खतरा. इस तकनीक की एक सीमा यह है कि अच्छा विनिर्माण अभ्यास ग्रेड knockouts एक ribonucleoप्रोटीन CRISPR/Cas9 प्रणाली के लिए तकनीक के संशोधन की आवश्यकता होगी के रूप में इस पद्धति जीनोम में Cas9 के स्थायी समावेश में परिणाम नहीं है और ऑफ-लक्ष्य प्रभाव के लिए क्षमता कम कर देता है। यहाँ प्रोटोकॉल में वर्णित पद्धति संभावित जीन की एक किस्म के लिए लागू किया जा सकता है आनुवंशिक रूप से CRISPR/Cas9 के माध्यम से सीएआर-टी कोशिकाओं को संशोधित करने में मदद करने के लिए कम विषाक्त या अधिक प्रभावी कार-टी कोशिकाओं उत्पन्न.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK कार टी सेल थेरेपी के क्षेत्र में पेटेंट पर एक आविष्कारक है कि नोवार्टिस के लिए लाइसेंस प्राप्त कर रहे हैं (Mayo क्लिनिक, पेंसिल्वेनिया विश्वविद्यालय, और नोवार्टिस के बीच एक समझौते के तहत). इन अध्ययनों के भाग में Humanigen (SSK) से अनुदान द्वारा वित्त पोषित किया गया. RMS, MJC, आर एस, और SSK इस काम से संबंधित पेटेंट पर आविष्कारक हैं. प्रयोगशाला (SSK) Tolero, Humanigen, पतंग, Lentigen, Morphosys, और Actinium से धन प्राप्त करता है.

Acknowledgments

यह काम K12CA090628 (SSK), राष्ट्रीय व्यापक कैंसर नेटवर्क (SSK), व्यक्तिगत चिकित्सा के लिए मेयो क्लिनिक केंद्र (SSK), Predolin फाउंडेशन (SSK), अनुवाद के मेयो क्लिनिक कार्यालय से अनुदान के माध्यम से समर्थित किया गया था अभ्यास करने के लिए (SSK), और मेयो क्लिनिक चिकित्सा वैज्ञानिक प्रशिक्षण कार्यक्रम रॉबर्ट एल हॉवेल चिकित्सक-वैज्ञानिक छात्रवृत्ति (आरएमएस).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics