CAR-T hücrelerinde GM-CSF ' ı Knock Out için CRISPR/Cas9 kullanma

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, bir CRISPR/Cas9 sistemi üzerinden araç-T hücrelerini genetik olarak düzenlemek için bir protokol sunuyoruz.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimerik antijen reseptör T (CAR-T) hücre tedavisi, kanser için bir kesme kenarı ve potansiyel olarak devrimci yeni tedavi seçeneğidir. Ancak, kanser tedavisinde yaygın kullanımı için önemli sınırlamalar vardır. Bu sınırlamalar, sitokin serbest bırakma Sendromu (CRS) ve nörotoksisite (NT) ve sınırlı genişleme, efektör fonksiyonları ve katı tümörlerde anti-tümör aktivitesi gibi benzersiz toksisitelerin gelişmesini içerir. Bir strateji Car-t etkinliğini artırmak için ve/veya CAR-t hücrelerinin kontrol toksisiteleri Car-t hücre üretimi sırasında kendilerini CAR-k hücrelerinin genomu düzenlemek için. Burada, araç-T hücrelerinde CRISPR/Cas9 gen düzenlemenin, granülocayt makrophaj kolonisi uyarıcı faktörüne (GM-CSF) ve Cas9 için bir kılavuz RNA içeren bir lentiviral yapı ile dönüştürücü yoluyla kullanımını tarif ediyoruz. Örnek olarak, biz GM-CSF CRISPR/Cas9 aracılı nakavt açıklanmaktadır. Biz bu GM-CSFk/o Car-t hücrelerinin etkili daha az GM-CSF kritik T hücre fonksiyonu koruyarak ve gelişmiş anti-tümör aktivite içinde vivo VAHŞI tip Car-T hücrelere kıyasla sonuç ürettiğimiz göstermiştir.

Introduction

Chimerik antijen reseptör T (CAR-T) hücre tedavisi kanser tedavisinde büyük söz sergiler. 1 , CD19 (CART19) hedefleyen 2 adet Car-T hücre terapisi, son zamanlarda Birleşik belirtilen ve Avrupa 'da çok merkezli klinik çalışmalarda çarpıcı sonuçlar gösterdikten sonra B hücreli malignite kullanımı için onaylanmıştır. 3 ' ü , 4 , CAR-T hücrelerinin daha yaygın kullanımına yönelik 5 bariyer, katı tümörlerde ve sitokin serbest bırakma Sendromu (CRS) ve NÖROTOKSISITE (NT) dahil olmak üzere ilişkili toksisitelerde sınırlıdır. 3 ' ü , 5 , 6 , 7 , 8 , 9 Car-t hücre tedavisinin terapötik indeksi geliştirmek için, çinko parmak nükrenler gibi genom mühendislik araçları, Talens, ve CRıNPR daha az toksik veya daha etkili Car-t hücreleri oluşturmak için bir GIRIŞIM daha Car-t hücreleri değiştirmek için kullanılmaktadır. 10 ' dan fazla , 11 ' i

Bu yazıda, CRISPR/Cas9 düzenlenmiş CAR-T hücrelerini oluşturmak için bir yöntem açıklanmaktadır. Bu yöntemin spesifik amacı, daha az toksik veya daha etkili CAR-T hücreleri oluşturmak için CRISPR/Cas9 üzerinden CAR-t hücre üretimi sırasında araç-T hücrelerini genetik olarak değiştirmenizi sağlamaktır. Bu metodolojisi geliştirmek için mantık, Car-t hücre tedavisinin terapötik penceresini artırmak ve uygulama genişletmek için yeni stratejiler için acil bir ihtiyaç gösterir CAR-T hücre tedavisinin klinik deneyiminden öğrenilen dersler üzerine kurulmuştur diğer tümörler ve klinik girmeye başladı CAR-T hücrelerin birden fazla değişiklik sağlayan sentetik biyoloji son gelişmeler tarafından desteklenmektedir. Çeşitli genom mühendislik araçları geliştirilmiştir ve çinko parmak nükler, TALENs ve JıSPR gibi farklı ayarlarla uygulandığında, metodolojimiz CAR-T hücrelerinin CRISPR/Cas9 modifikasyonu açıklanmaktadır. 10 ' dan fazla , 11 Crispr/Cas9, yabancı DNA 'yı ortadan kaldırmak IÇIN tasarlanan RNA bazlı bir bakteriyel savunma mekanizmasıdır. CRıSPR, bir kılavuz RNA (gRNA) aracılığıyla tanımlanan bir hedef sırasını ayırmak için endonükleazları kullanır. CAR-T hücrelerinin CRıNPR düzenleme diğer genom mühendislik araçları üzerinde çeşitli avantajlar sunar. Bu, gRNA dizisinin hassasiyetini, faiz geni, yüksek gen düzenleme verimliliği ve birden fazla gRNAs aynı anda kullanılabilir olduğundan birden çok geni hedefleme yeteneğini hedefleyen bir gRNA tasarlamak için basitlik içerir.

Özellikle burada açıklanan yöntemlerle, bir Lentivirus kodlama CRıPR Kılavuzu RNA ve Cas9 T hücrelerinin araba dönüştürücü sırasında bir geni bozmak için kullanılır. CAR-T hücrelerini düzenlemek için uygun bir tekniği seçerken, burada açıklanan tekniği araştırma notu CAR-T hücreleri oluşturmak için etkili bir mekanizma olduğunu öneririz, ancak genom içine Cas9 kalıcı entegrasyonu uzun vadeli etkisi bilinmiyor, biz Konsept araştırma notu CAR-T hücrelerinin kanıtı geliştirmek için bu metodoloji önermek ama iyi üretim uygulama notu CAR-T hücreleri üretmek için değil.

Özellikle, burada granülosit makrofaj koloni uyarıcı faktör (GM-CSF) nakavt Car-T hücreleri insan CD19 hedefleyen nesil açıklanmaktadır. Bu CAR-T hücreleri lentiviral parçacıklar GM-CSF (gen adı CSF2) ve Cas9 özel bir kılavuz RNA kodlama ile dönüştürücü tarafından oluşturuldu. Daha önce GM-CSF nötralizasyonu bir xenograft modelinde CRS ve NT iyileştirir bulundu. 12 GM-CSFk/o Car-t hücreleri GM-CSF üretim sürecinde inhibisyonu IÇIN izin, etkili GM-CSF üretimini azaltarak ise Car-t hücre anti-tümör aktivitesi ve hayatta kalma IÇINDE vivo wildtype Car-t hücrelere kıyasla artırır. 12 böylece, burada Crispr/CAS9 düzenlenmiş Car-T hücreleri oluşturmak için bir metodoloji sunuyoruz.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bu protokol Mayo Clinic 'in kurumsal Inceleme Kurulu (ıRB) ve kurumsal Biyogüvenlik Komitesi (ıBC) yönergelerini takip eder.

1. CART19 hücre üretimi

  1. T hücresi yalıtımı, stimülasyon ve ex-vivo kültürü
    1. Uygun kişisel koruyucu ekipman kullanarak bir hücre kültürü kaputu tüm hücre kültürü çalışmalarını gerçekleştirin. Periferik kan mononükleer hücreleri hasat (pbmcs) bu pbmcs uygun bir kaynak olduğu bilinmektedir gibi Aferez sırasında toplanan de-teşhis normal donör kan konileri.13
    2. PBMCs yalıtmak için, bir 50 mL yoğunluk degrade ayırma tüpü bir yoğunluk degrade orta 15 mL ekleyin. Hücre bindirmeyi önlemek için% 2 fetal sığır serumu (FBS) içeren fosfat-tamponlu tuz (PBS) eşit hacmine sahip donör kanı seyreltin.
      1. Ayırma tüpü içine koni seyreltilmiş donör kan ekleyin, dikkatli kan ve yoğunluk degrade orta arasındaki arayüz rahatsız değil. 1.200 x g 'de santrifüjün 10 dakıka içinde RT.
      2. Yeni bir 50 ml konik içine süpernatant decant, 40 ml kadar getirerek PBS + 2% FBS ile yıkayın, RT 8 dakika için 300 x g Santrifüjlü, Aspire süpernatant, pelletini içinde 40 ml tampon, ve sayma hücreleri.
    3. T hücrelerini, üreticinin protokolüne göre tam otomatik hücre ayırıcı kullanarak negatif seçim manyetik boncuk kiti ile PBMCs 'den yalıtın.
    4. İzole T hücrelerini kültüre etmek için,% 10 insan AB serumu (v/v),% 1 penisilin-streptomisin-glutamin (v/v) ve serum içermeyen hematopoetik hücre ortamını içeren T hücresi Orta (TCM) hazırlayın. 0,45 μm steril vakum filtresinde ve ardından 0,22 μm steril vakum filtresiyle ortamı sterilize edin.
    5. Gün 0 (T hücre stimülasyon günü), T hücrelerinin stimülasyon öncesinde Yıkamak için, boncuk gerekli hacmi (3:1 boncuk oranı için yeterli CD3/CD28 boncuk kullanın: T hücreleri; Not boncuk konsantrasyonu değişken olabilir) steril bir 1,5 ml microsantrifüz tüp ve pelletini 1 ml tcm.
    6. Mıknatıs ile temas halinde yerleştirin.
    7. 1 dk sonra, TCM Aspire ve 1 ml taze TCM içinde pelletini boncuklar yıkamak için.
    8. Bu prosedürü toplam üç yıkama için tekrarlayın.
    9. Üçüncü yıkama sonra, TCM 1 ml boncuk pelletini.
    10. T hücrelerini say.
    11. 3:1 boncuk oranındaki T hücrelerine boncuklar aktarın: hücreler.
    12. Hücreleri 1 x 106 hücreli/ml son konsantrasyonuna seyreltin.
    13. 37 °C ' de, 24 saat için% 5 CO2 ' de inkübe
  2. T hücreli transfeksiyon ve dönüştürücü
    1. Hücre kültürü davlumbaz, kişisel koruyucu ekipman ve bertaraf önce çamaşır suyu ile kullanılan malzemelerin dezenfeksiyon dahil olmak üzere BSL-2 + önlemleri kullanarak lentiviral çalışma gerçekleştirin.
    2. Elde bir CART19 bir lentiviral vektör yapı.
      Not: burada kullanılan CART19 yapı tasarlanmış ve sonra da Novo ticari olarak kullanılabilir bir protein sentezi satıcı kullanarak sentezlenmiş. CAR yapı daha sonra bir EF-1α Promoter kontrolü altında üçüncü nesil Lentivirus içine klonlanmış. Tek zincir değişken bölge parçası türetilir FMC63 klonlama ve insan CD19 tanır. CAR19 yapı ikinci nesil 4-1BB costimulatory etki alanı ve CD3ζ stimülasyon (FMC63-41BBz) sahiptir. 12 tane
    3. Daha önce açıklandığı gibi lentiviral üretim gerçekleştirin. 12 tane
      1. Kısacası, Lentivirus üretmek için,% 70-90 konfluency ulaştı 293T hücreleri kullanın.
      2. 15 μg bir gag/pol/tat/Rev paketleme vektörü, 7 μg bir VSV-G zarf vektörü, 111 μL ön-kompleks reaktif, 129 μL dahil olmak üzere transfeksiyon reaktiflerin oda sıcaklığında 30 dakika boyunca inkübasyon izin transfeksiyon reaktif, ve 9,0 mL transfeksiyon orta önce 293T hücrelere eklemeden. Daha sonra 37 °C, 5% CO2' de Transferli hücreleri kültürleştirin.
      3. Hasat, santrifü112.700 13.028 jü (900 x g için 10 dk), filtre (0,45 μM naylon filtre), ve konsantre süpernatant 24 ve 48 h ile ultracent
      4. Gelecekteki kullanım için-80 °C ' de dondurur.
    4. 1. gün, hafifçe pelletini t hücreleri 1 x 106/ml gün 0 uyarılmış olmuştu t hücrelerinin rozetleri kırmak için.
    5. Tüm lentiviral çalışma için uygun BSL-2 + önlemleri altında, 3,0 ' in enfeksiyonunun bir çokluğu (MOı) ile uyarılan T hücrelerine taze veya dondurulmuş hasat virüsü ekleyin.
  3. CAR-T hücre genişletme
    1. Genişleme aşaması sırasında, 37 °C,% 5 CO2' de Traned T hücrelerini inküymeye devam edin. Sayı CAR-T hücreleri gün 3 ve 5, ve taze eklemek, önceden ısıtılmış TCM kültürü için bir CAR-T hücre konsantrasyonu korumak için 1 x 106/ml.
    2. Bir mıknatıs kullanarak uyarıcı (gün 6) sonra 6 gün transed T hücrelerinden boncuk çıkarın. Hasat, resuspend, ve yer T hücreleri 50 mL konik tüpler için bir mıknatıs içinde 1 dakika. Sonra süpernatant toplamak (Car-T hücreleri içerir), ve boncuklar atın.
    3. Genişleme devam etmek için 1 x 106 hücreler/ml konsantrasyonunda kültüre GERI toplanan Car-T hücreleri yerleştirin.
    4. 6. gün, Akış sitometrisi ile OTOMOBILIN yüzey ifadesini değerlendir.
      Not: çeşitli yöntemler, bir keçi Anti-fare IgG (H + L) Cross-adsorbed ikincil antikor ile boyama veya bir CD19 spesifik peptid ile boyama gibi, bir fluorokrom konjuli, otomobıl yüzey ifadesi algılamak için kullanılabilir. Burada, kültürden bir kısım (yaklaşık 100.000 T hücreleri) alın ve Dulbecco fosfat-tamponlu tuzlu,% 2 fetal sığır serumu ve% 1 Sodyum azid ile hazırlanan akış tampon ile yıkayın. Anti-CAR antikor ile hücreleri leke ve iki kez yıkayın. Canlı/ölü leke ve CD3 monoklonal antikor (OKT3) ile hücreleri leke. Hücreleri yıkayın ve akış tamponunun pelletini. Dönüştürücü verimliliğini belirlemek için bir sitometresi elde.
  4. CAR-T hücre ağoprezervasyon
    1. Hasat ve cryopreserve CAR-T hücreleri 8 gün stimülasyon (gün 8 T hücre genişleme), kültür hücreleri hasat.
    2. 300 x g'de 5 dakika aşağı spin.
    3. % 10 dimetil sülfoxid ve 90% fetal sığır serumu oluşan donma ortamında şişe başına mL başına 10.000.000 hücrelerde donma ortamında resuspend.
    4. A-80 °C dondurucu içinde-1 °C/dk soğutma hızı elde etmek ve sonra 48 h sonra sıvı nitrojeni aktarmak için bir donma kabı içinde dondurmak.
    5. İn vitro veya in vivo deneyler için kullanımından önce, sıcak TCM CAR-T hücreleri çözüyor.
    6. Seyreltilen hücreleri yıkayın ve dimetil sülfoxid ve pelletini bir konsantrasyon 2 x 106 hücreler/ml sıcak t cm kaldırın. 37 °C ' de gece istirahat,% 5 CO2.

2. GM-CSF k/o CART19 üretim

  1. GM-CSF ' ı kesintiye uğratmak için, daha önce insan sitokinin GM-CSF ' ı kodlayan CSF2 geni için yüksek verimliliğe sahip olduğu bildirilen tarama gRNAs aracılığıyla seçilen insan GM-CSF (CSF2) eXoN 3 ' ü hedefleyen bir kılavuz RNA (gRNA) kullanın. 14
    Not: Bu gRNA (U6 Organizatör altında) içeren ticari olarak sentezlenmiş araştırma notu Cas9 üçüncü nesil lentiviral yapı kullanılmıştır. Yapı, puromisin direnç geni içerir. GRNA dizisi GACCTGCCTACAGACCCGCC şeklindedir. 12 tane
  2. Lentivirus üretmek için,% 70-90 konfluency ulaştı 293T hücreleri kullanın.
  3. Faiz lentiviral plazmid 15 μg izin, 18 μg bir gag/pol/tat/Rev paketleme vektörü, 7 μg bir VSV-G zarf vektörü, 111 μL ön-kompleks reaktif, 129 μL transfeksiyon reaktif, ve 9,0 mL transfeksiyon orta için 30 dakika Oda te saklamayýn.
  4. Transfeksiyon reaktifler 293t hücrelere ekleyin. Sonra kültür 37 °C, 5% CO2.
  5. Hasat, Santrifüjü (10 dk için 900 x g), filtre (0,45 μM naylon filtre) ve 24 ve 48 h 'de, 2 saat için 13.028 x g , 18 h veya 112.700 x g için de, gelecekteki kullanım için donma-80 °c ' de konsantre süpernatant.
  6. 1. gün, hafifçe Rosettes kırmak için T hücreleri pelletini.
  7. Bir BSL-2 + onaylı laboratuvarda, araç-T hücreleri oluşturmak için uyarılmış T hücrelere dondurulmuş veya taze hasat virüs ekleyin. CAR19 Lentivirus ve GM-CSF CRıPR Lentivirus hedefleme ile T hücreleri transduce. CAR19 Lentivirus ile 3. CRıPR Lentivirus titrasyon mümkün değildi bu yana, 10 x 106 T hücreleri dönüşüm için 15 UG Plasmid hazırlık oluşturulan virüs parçacıkları kullanın.
  8. Adım 1 ' de anlatıldığı gibi T hücresi stimülasyon, genişleme ve ağaloprezervasyon kalan adımlarına bakın .
  9. Puromisin direncini taşıyan lentiCRISPR-düzenlenmiş T hücreleri için, 3 ve gün 5 günü 1 mL başına 1 μg puromisin konsantrasyonunda puromisin Dihidroklorür ile hücreleri tedavi edin.

3. GM-CSF bozulma verimliliği ve GM-CSF k/o CART19 fonksiyonel değerlendirme

  1. GM-CSF bozulma verimliliği: ayrıştırma (TIDE) sıralama ve analiz ile ındels izleme
    1. GM-CSF geni ile ilgilinin eXoN dizisi için, aşağıdaki astar kullanın. TGACTACAGAGAGGCACAGA GM-CSF (CSF2) için bir ileri primer sıra kullanın ve TCACCTCTGACCTCATTAACC bir ters astar dizisi.
    2. Genomik ekstraksiyon kiti ile 5.000.000 CAR-T hücrelerinden DNA ayıklayın. PCR reaksiyonu için, μM ' nin PCR reaksiyonu, 0.1-0.5 μg şablon DNA 50 'Sı ile her bir astar için son konsantrasyon ile reaksiyon başına 25 μL, bir Taq Mastermix kullanın
    3. Tablo 1' de açıklanan PCR Bisiklet koşullarına bakın.
    4. PCR örneklerini, 100 V 'de 30 dakika boyunca% 1-2 agaroz jel ile çalıştırın ve bir jel ekstraksiyon kiti kullanarak ayıklayın.
    5. Seri PCR amplicons. Ham verileri uygun bir gelgit yazılımına yükleyerek allel modifikasyon sıklığını hesaplayın. 15
  2. GM-CSFk/o CART19 GM-CSF üretim ve fonksiyonel değerlendirme
    1. CAR-T hücrelerinin sitokin üretimini belirlemek için, vahşi tip CART19 hücreleri ve GM-CSFk/o CART19 CD19 ifade eden akut lenfoblastik lösemi hücre hattı NALM6 1:5 Için 37 °c ' de 4 h, monensin varlığına% 5 Co2 çözüm, anti-human CD49d, anti-human CD28 ve anti-human CD107a.
    2. Akış sitometri için kültürden hasat hücreleri. Hücreleri akış sitometri tamponunu ile yıkayın. Hücreleri canlı/ölü boyama kiti ile lekelenin. Oda sıcaklığında karanlıkta kuluçkara 15 dakika. sabitleme ortamı ile hücreleri düzeltin ve oda sıcaklığında karanlıkta inkübasyon 15 dakika.
    3. Yıkandıktan sonra, anti-human ıfnγ monoklonal antikor, Anti-insan GM-CSF, anti-human MıP-1β, anti-human IL-2 ve anti-human CD3 ile kombinasyon halinde geçirgen orta ile hücreler arasında Lekelenmek ve 30 için oda sıcaklığında karanlıkta kulkaylık Min. numuneleri yıkayın ve pelletini. Bir akış sitometresi örnekleri elde ve hücre içi GM-CSF ifade yüzdesi için analiz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1 GM-CSFk/o CART19 HÜCRELERINDE GM-CSF azaltılması gösterir. T hücrelerinin genomunun, GM-CSF ' d e değiştirildiğini doğrulamak için, GM-CSFk/o CART19 hücrelerinde (ŞEKIL 1a) tid sıralaması kullanılmıştır. CAR-T hücre yüzeyi boyama, T hücrelerinin canlı CD3 + hücrelerde (Şekil 1B) gating tarafından araç yüzey reseptörü in vitro başarıyla ifade ettiğini doğrular. GM-CSF akış sitometri tarafından hücre içi boyama GM-CSFk/o CART19 hücrelerinde, canlı CD3 + hücrelerde gating, nakavt işlevsel başarısını doğrulayarak (Şekil 1C. GM-CSFk/o Car-t hücreleri, hücre içi boyama yoluyla wildtype ANTI-CD19 Car-t HÜCRELERINE (CART19) kıyasla GM-CSF ' d e azalma sergiliyor (Şekil 1B). Buna ek olarak, daha önce GM-CSFk/o Car-t hücrelerinin GM-CSF üretimini düşürürken, anti-tümör aktivitesini ve hayatta kalma etkinliğini artırarak WILDTYPE Car-t hücrelerinin in vivo olarak karşılaştırıldığı gösterildi. 12 tane 

Adım Sıcaklık (°C) Zaman Döngü
İlk denatürasyon 94 3 dk. 1
Denatürasyon 94 45 sn 35
Tavlama 60 30 saniye sonra
Uzantısı 72 2 dk.
Uzama sonrası 72 10 dak. 1
4

Tablo 1: GM-CSFk/o CART19 hücrelerinin gelgit sıralaması için PCR Bisiklet koşulları.

Figure 1
Şekil 1 : GM-CSFk/o CART19 hücreler GM-CSF azalma gösterir. A) temsili bir gelgit DIZISI, GM-CSF Crispr/Cas9 GM-CSFk/o CART19 hücrelerinin genom değişikliğinin ~ 71% ' lik bir bozulma verimliliğine sahip olduğunu doğrular. B) temsilci akış çizimleri, VAHŞI tip CART19 ve GM-CSFk/o CART19 benzer araç Ifadesiyle başarılı Car-t hücre üretimini tasvir ediyor. C) Cell-CSFk/o CART19 HÜCRELERI, CD19 pozıtıf tüm hücre hattı NALM6 ile UYARıLDıĞıNDA vahşi tip CART19 ile karşılaştırıldığında GM Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu raporda, CAR-T hücrelerinde ikincil modifikasyonları teşvik etmek için CRISPR/Cas9 teknolojisini kullanmak üzere bir metodoloji açıklanmaktadır. Özellikle, bu gRNA faiz gen hedefleme ve GM-CSFk/o CART19 hücreleri oluşturmak için Cas9 içeren bir viral vektör ile lentiviral dönüştürücü kullanılarak gösterilmiştir. Daha önce GM-CSF nötralizasyonu bir xenograft modelinde CRS ve NT iyileştirir göstermiştir. 12 daha önce açıklandığı gıbı, GM-CSFk/o Car-T hücreler ÜRETIM sürecinde GM-CSF inhibisyonu IÇIN izin, etkili GM-CSF üretimini azaltmak diğer kritik T hücre fonksiyonları korurken, ve sonuç gelişmiş anti-tümör aktivite in vivo wildtip CAR-T hücrelere kıyasla. 12 tane

Genomda Cas9 kalıcı entegrasyonu, klinik olarak uygun bir ürüne çevrilmiş olduğunda istenmeyen etkilerle ilişkili olabilir, bu özel metodolojisi, kavram kanıtı için araştırma derecesi CRISPR/Cas9 değiştirilmiş CART19 oluşturmak için bir yol olarak öneriyoruz Deney.

Car-T hücreleri kanser terapisi söz tutun iken,1,2 onların etkinliği gelişmiş olmaya devam edebilir ve ilişkili toksişlar daha iyi kontrol. CRISPR/Cas9 teknolojisi, araç-T hücrelerinin genomunu, mevcut klinik eksiklikleri çözümlemek için doğrudan hedefleyen bir strateji sunar. Bu yazıda GM-CSFk/o CART19 hücrelerinin oluşumunu tarif ediyoruz.

GM-CSFk/o Car-t HÜCRELERI, Car-t hücreli plazmid için lentiviral bir VEKTÖRLE ve GM-CSF ve Cas9 için BIR kılavuz RNA içeren bir Lentivirus yapısı ile dönüştürücü tarafından oluşturuldu. GM-CSFk/ooluşturmak için, üçüncü nesil Lentivirus yapı (LentiCRISPRv2) Cas9 içeren ve bildirilen yüksek VERIMLILIK Kılavuzu RNA (Grna) hedef eXoN 3 insan GM-CSF (CSF2)14 bir U6 Organizatör kontrolü altında kullanılmıştır. Bu en çok değiştirilmiş CAR-T hücrelerinin geliştirilmesi için kritik olduğu gibi prosedürün iletim adımları sırasında özel bakım alınmalıdır. Nakavt verimliliği doğrulanabilir ve girinti (TIDE) dizileri ile indels izleme yoluyla değerlendirilebilir. CAR-T hücrelerinin fonksiyonel aktivite CD19 + hedef hücreler ile otomobıl yapı antijen spesifik stimülasyon ile incelenmiştir, GM-CSF üretimi de dahil olmak üzere farklı T hücre fonksiyonları, ölçümü izledi. 12 Not, bir keçi Anti-fare ANTIKOR ile Car ifade için boyama diğer antikor boyama önce oluşan iki yıkayan önce ortaya çıkan tek zincir değişken bölge parçası nedeniyle yüzey boyama CART19 fare kökeni. Bu iyi CAR ifadesi başlangıçta gözlenen değilse sorun çekim vurgu bir noktasıdır.

Bu modifiye CAR-T hücreleri konsept deneylerinin kanıtı için in vitro çalışmalarda ve in vivo xenograft modellerinde kullanılabilir. Bu tekniğin bir avantajı, CAR-T hücre üretimi ve genetik manipülasyon her ikisi de diğer tekniklere kıyasla iyi verimlilik ile bir adımda ortaya çıkabilir. 10 ' dan fazla , 11 çift lentiviral dönüştürücü ARAŞTıRMA derecesi GM-CSFk/o CART19 hücreleri oluşturmak için uygun ve etkili BIR yöntemdir iken, DNA genom içine dahil ve uzun süreli Cas9 ifade genom istikrarsızlaştırabilir ve artırmak off-hedef etkileri riski. Bu teknikte bir sınırlama iyi üretim uygulama notu tırnakları bir ribonukleoprotein Crispr/Cas9 sistemi için tekniğin değiştirilmesi gerektirecektir olduğu gibi bu metodoloji genom içine Cas9 kalıcı birleşmesine neden olmaz ve Hedef dışı efektler için potansiyeli azaltır. Burada protokolde açıklanan metodoloji potansiyel olarak daha az toksik veya daha etkili CAR-T hücreleri oluşturmaya yardımcı olmak için CRISPR/Cas9 üzerinden CAR-T hücrelerini değiştirmek için genlerin çeşitli uygulanabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK, Novartis 'e (Mayo Clinic, Pennsylvania Üniversitesi ve Novartis arasında bir anlaşma kapsamında) lisanslı araç T-Cell terapisi alanında patent üzerine bir mucidi. Bu çalışmalar Humanigen (SSK) bir hibe tarafından kısmen finanse edildi. RMS, MJC, RS ve SSK bu iş ile ilgili patentler üzerinde mucitler vardır. Laboratuar (SSK) tolero, Humanigen, Kite, Lentigen, Morphosys ve actinium 'dan fon alır.

Acknowledgments

Bu çalışma K12CA090628 (SSK), Ulusal kapsamlı kanser ağı (SSK), Mayo Clinic Center bireyselleştirilmiş Tıp (SSK), Predolin Vakfı (SSK), Mayo Clinic Office çeviri uygulama (SSK) gelen hibe yoluyla destekleniyordu ve Mayo Clinic tıp bilimcisi eğitim programı Robert L. Howell hekim-bilim adamı Bursu (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics