CRISPR/Cas9를 사용하여 CAR-T 셀에서 GM-CSF를 제거합니다.

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기에서는 CRISPR/Cas9 시스템을 통해 CAR-T 세포를 유전적으로 편집하는 프로토콜을 제시합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

키메라 항원 수용체 T (CAR-T) 세포 치료는 암에 대한 최첨단 잠재적으로 혁명적 인 새로운 치료 옵션입니다. 그러나, 암의 치료에 그것의 광범위 한 사용에 상당한 제한이 있다. 이러한 제한은 사이토카인 방출 증후군 (CRS) 및 신경 독성 (NT) 및 고형 종양에서 제한된 확장, 이펙터 기능 및 항 종양 활성과 같은 독특한 독성의 개발을 포함한다. CAR-T 효능및/또는 CAR-T 세포의 독성을 조절하는 한 가지 전략은 CAR-T 세포 제조 중에 CAR-T 세포의 게놈을 스스로 편집하는 것입니다. 여기에서, 우리는 과립구 대식세포 대식세포 콜로니 자극 인자 (GM-CSF) 및 Cas9에 가이드 RNA를 포함하는 렌티 바이러스 구조를 가진 transduction를 통해 CAR-T 세포에 있는 CRISPR/Cas9 유전자 편집의 사용을 기술합니다. 예를 들어, 우리는 GM-CSF의 CRISPR / Cas9 중재 녹아웃을 설명합니다. 우리는 이 GM-CSFk/o CAR-T 세포가 중요한 T 세포 기능을 유지하면서 효과적으로 적은 GM-CSF를 생성하고 야생 형 CAR-T 세포에 비해 생체 내에서 향상된 항 종양 활성을 초래한다는 것을 보여주었습니다.

Introduction

키메라 항원 수용체 T (CAR-T) 세포 치료는 암 치료에 큰 약속을 전시한다. 1개 , 2 CD19(CART19)를 표적으로 하는 2개의 CAR-T 세포 치료는 다중 센터 임상 시험에서 눈에 띄는 결과를 입증한 후에 B 세포 악성에 있는 사용을 위해 최근 유나이티드 명시된 및 유럽에서 승인되었습니다. 3개 , 4개 , 5 CAR-T 세포의 보다 광범위한 사용에 대한 장벽은 고형 종양에서 제한된 활성및 사이토카인 방출 증후군(CRS) 및 신경독성(NT)을 포함한 관련 독성이다. 3개 , 5개 , 6개 , 7명 , 8개 , 9 CAR-T 세포 치료의 치료 지수를 향상시키기 위해 아연 핑거 뉴클레아제, TALENs 및 CRISPR과 같은 게놈 엔지니어링 도구가 덜 독성이 적거나 더 효과적인 CAR-T 세포를 생성하기 위해 CAR-T 세포를 추가로 수정하는 데 사용됩니다. 10개 , 11세

이 문서에서는 CRISPR/Cas9 편집된 CAR-T 셀을 생성하는 방법을 설명합니다. 이 방법의 특정 목표는 CRISPR/Cas9를 통해 CAR-T 세포 제조 중에 CAR-T 세포를 유전적으로 수정하여 독성이 적거나 더 효과적인 CAR-T 세포를 생성하는 것입니다. 이 방법론을 개발하기위한 근거는 CAR-T 세포 치료의 치료 기간을 증가시키고 응용 프로그램을 확장하기 위한 새로운 전략이 절실히 필요하다는 것을 나타내는 CAR-T 세포 치료의 임상 경험에서 얻은 교훈을 기반으로 합니다. 그밖 종양은 병원에 들어가기 시작한 CAR-T 세포의 다중 수정을 허용하는 합성 생물학에 있는 최근 어드밴스에 의해 지원됩니다. 아연 핑거 뉴클레아제, TALENs 및 CRISPR과 같은 여러 게놈 엔지니어링 도구가 개발되고 적용되고 있는 동안, 당사의 방법론은 CAR-T 세포의 CRISPR/Cas9 수정을 설명합니다. 10개 , 11 CRISPR/Cas9는 외래 DNA를 제거하도록 설계된 RNA 기반 세균 방어 메커니즘입니다. CRISPR은 가이드 RNA (gRNA)를 통해 확인된 표적 서열을 갈라기 위하여 endonucleases에 의존합니다. CAR-T 세포의 CRISPR 편집은 다른 게놈 엔지니어링 도구에 비해 몇 가지 이점을 제공합니다. 이들은 gRNA 순서의 정밀도, 관심 있는 유전자를 표적으로 하는 gRNA를 디자인하는 단순성, 높은 유전자 편집 효율성 및 다중 gRNA가 동시에 사용될 수 있기 때문에 다중 유전자를 표적으로 하는 기능.

구체적으로 여기에 기술된 방법에서, 우리는 CRISPR 가이드 RNA 및 Cas9를 코딩하는 렌티바이러스를 사용하여 T 세포의 CAR 주입 동안 유전자를 중단하였다. CAR-T 세포를 편집하기 위한 적절한 기술을 선택할 때, 여기서 설명한 기술은 연구 등급 CAR-T 세포를 생성하는 효율적인 메커니즘이지만, Cas9를 게놈에 영구적으로 통합하는 장기적인 효과는 알려지지 않기 때문에, 우리는 개념 연구 등급 CAR-T 세포의 증거를 개발하지만 좋은 제조 연습 학년 CAR-T 세포를 생산하지 않는이 방법론을 제안한다.

특히, 여기서 우리는 인간 CD19를 표적으로 하는 과립구 대식세포 콜로니 자극 인자(GM-CSF) 녹아웃 CAR-T 세포의 생성을 기술한다. 이들 CAR-T 세포는 GM-CSF(유전자 명 CSF2) 및 Cas9에 특이적인 가이드 RNA를 코딩하는 렌티바이러스 입자를 가진 트랜스덕션에 의해 생성되었다. 우리는 이전에 GM-CSF 중화가 이종이식 모델에서 CRS 및 NT를 개량한다는 것을 발견했습니다. 12 개의 GM-CSFk/o CAR-T 세포는 제조 과정에서 GM-CSF의 억제를 허용하여 야생형 CAR-T 세포에 비해 CAR-T 세포 항종양 활성 및 생존을 향상시키면서 GM-CSF의 생산을 효과적으로 감소시킵니다. 12 따라서, 여기서 우리는 CRISPR/Cas9 편집된 CAR-T 세포를 생성하는 방법론을 제공한다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

이 프로토콜은 메이요 클리닉의 기관 검토 위원회 (IRB) 및 기관 생물 안전위원회 (IBC)의 지침을 따릅니다.

1. CART19 셀 생산

  1. T 세포 분리, 자극, 및 전 생체 배양
    1. 적절한 개인 보호 장비를 활용하여 세포 배양 후드에서 모든 세포 배양 작업을 수행합니다. PBMC의 실행 가능한 근원으로 apheresis 도중 집합된 de-identified 정상 기증자 혈액 콘에서 말초 혈액 단핵 세포 (PBMC)를 수확하십시오.13
    2. PBMC를 분리하려면 밀도 그라데이션 매체의 15mL를 50mL 밀도 그라데이션 분리 튜브에 추가합니다. 세포 포획을 피하기 위해 2% 태아 소 혈청(FBS)을 함유하는 인산완충식염수(PBS)와 동일한 부피로 기증자 혈액을 희석합니다.
      1. 원뿔에서 희석 된 기증자 혈액을 분리 튜브에 추가하고 혈액과 밀도 구배 배지 사이의 계면을 방해하지 않도록주의하십시오. RT에서 10 분 동안 1,200 x g의 원심 분리기.
      2. 상급체를 새로운 50 mL 원뿔형으로 장식하고, 최대 40 mL까지 가져와서 PBS + 2 % FBS로 씻고, RT에서 8 분 동안 300 x g의 원심 분리기, 흡기 상피, 버퍼 40 mL에서 재중단 및 셀 을 계산하십시오.
    3. 제조업체의 프로토콜에 따라 완전 자동화된 셀 분리기를 사용하여 음의 선택 자기 비드 키트를 통해 PBMC로부터 T 세포를 분리합니다.
    4. 단리된 T 세포를 배양하기 위해, 10% 인간 AB 혈청(v/v), 1% 페니실린-스트렙토마이신 글루타민(v/v), 및 혈청이 없는 조혈 세포 배지로 구성된 T 세포 배지(TCM)를 준비한다. 0.45 μm 멸균 진공 필터를 통해 여과한 다음 0.22 μm 멸균 진공 필터로 배지를 살균합니다.
    5. 0일째(T 세포 자극의 날)에, T 세포를 자극하기 전에 CD3/CD28 구슬을 씻는다. 세척하려면 필요한 양의 비드(3:1 비드:T 셀의 비율로 충분한 CD3/CD28 비드사용)를 멸균 된 1.5 mL 미세 원심 분리 튜브에 놓고 TCM의 1 mL에서 다시 일시 중단하십시오.
    6. 자석과 접촉합니다.
    7. 1분 후, 한심을 흡인하고 1 mL의 신선한 TCM으로 재중단하여 구슬을 세척한다.
    8. 이 절차를 반복하여 총 3번의 세번을 세번 바하십시오.
    9. 세 번째 세척 후, 한의학 의 1 mL에 구슬을 다시 중단.
    10. T 셀을 계산합니다.
    11. 3:1 비드:셀의 비율로 구슬을 T 세포로 옮김.
    12. 세포를 1 x 10 6세포 /mL의 최종 농도로 희석하십시오.
    13. 37°C에서 배양하고, 24시간 동안 5% CO2를 배양한다.
  2. T 세포 형질 감염 및 변환
    1. BSL-2+ 예방 조치를 사용하여 렌티 바이러스 작업을 수행, 세포 배양 후드를 포함, 개인 보호 장비, 폐기하기 전에 표백제와 사용 된 재료의 소독.
    2. 렌티바이러스 벡터에서 CART19 구문구를 획득합니다.
      참고: 여기에 활용된 CART19 컨스트럭트는 시판되는 단백질 합성 벤더를 사용하여 드노보를 합성하도록 설계되었습니다. CAR 컨스트럭티드를 EF-1α 프로모터의 제어하에 3세대 렌티바이러스로 클로던트. 단일 사슬 가변 영역 단편은 FMC63 클론으로부터 파생되고 인간 CD19를 인식한다. CAR19 컨스트럭트는 2세대 4-1BB 코스티뮬레이션 도메인 및 CD3θ 자극(FMC63-41Bz)을 가지고 있다. 12세
    3. 앞서 설명한 대로 렌티바이러스 생산을 수행합니다. 12세
      1. 간단히 말해서, 렌티바이러스를 생산하기 위해 70-90%의 동률에 도달한 293T 세포를 활용합니다.
      2. 렌티바이러스 플라스미드 15 μg, 개그/폴/타트/레브 포장 벡터 18 μg, VSV-G 봉투 벡터 7 μg, 사전 착색 시약의 111 μL, 129 μL을 포함한 형질감염 시약의 실온에서 30분 동안 인큐베이션을 허용한다. 형질감염 시약, 및 293T 세포에 첨가하기 전에 형질감염 배지의 9.0 mL. 이어서 형질감염된 세포를 37°C, 5% CO2에서 배양한다.
      3. 수확, 원심 분리기 (10 분 동안 900 x g), 필터 (0.45 μM 나일론 필터), 및 18 시간 동안 13,028 x g 또는 2 시간 동안 112,700 x g에서 초원심 분리에 의해 24 및 48 h에서 상급농축.
      4. 나중에 사용하기 위해 -80 °C에서 동결하십시오.
    4. 1일째, T 세포를 부드럽게 재중단하여 0일째에 1 x 10 6/mL에서 자극된 T 세포의 장미를 분해합니다.
    5. 모든 렌티바이러스 작업에 대한 적절한 BSL-2+ 예방 조치하에, 3.0의 감염(MOI)의 복합성에서 자극된 T 세포에 신선하거나 냉동 수확된 바이러스를 첨가하십시오.
  3. CAR-T 셀 확장
    1. 팽창의 단계 동안, 37°C, 5% CO2에서 형질전환된T 세포를 계속 배양한다. 3일 및 5일에 CAR-T 세포를 카운트하고, 1 x 10 6/mL의 CAR-T 세포농도를 유지하기 위해 배양에 신선하고 미리 온난한 TCM을 첨가한다.
    2. 자석을 이용하여 자극(6일째) 6일 후 트랜스듀싱된 T 세포로부터 비드를 제거한다. 50 mL 원추형 튜브에 T 세포를 1 분 동안 자석에 수확, 재 중단 및 배치합니다. 그런 다음 상급체(CAR-T 세포 포함)를 수집하고 구슬을 버립니다.
    3. 수집된 CAR-T 세포를 1 x 106 세포/mL의 농도로 배양하여 다시 배치하여 팽창을 재개한다.
    4. 6일째에, 유세포분석으로 CAR의 표면 발현을 평가한다.
      참고: 염소 항마우스 IgG(H+L)로 염색하거나 CD19 특이적 펩타이드로 염색하여 불소화로 컨쥬게이징하는 등 CAR의 표면 발현을 검출하는 데 여러 가지 방법을 사용할 수 있다. 여기서, 배양으로부터 aliquot(약 100,000 T 세포)를 취하고 덜베코의 인산완충식염수, 2% 태아 소 혈청 및 1% 나트륨 아지드로 제조된 유량 완충액으로 세척한다. 항 CAR 항체로 세포를 염색하고 두 번 씻으하십시오. 살아있는 / 죽은 얼룩 과 CD3 단일 클론 항체 (OKT3)로 세포를 얼룩. 셀을 세척하고 흐름 버퍼에서 다시 일시 중단합니다. 전도계를 획득하여 전도 효율을 결정합니다.
  4. CAR-T 세포 냉동 보존
    1. CAR-T 세포를 자극 후 8일(T 세포 팽창 8일째) 수확하고 냉동 보존하기 위해 배양으로부터 세포를 수확한다.
    2. 300 x g에서 5 분 동안 스핀 다운하십시오.
    3. 10% 디메틸 설폭사이드 및 90% 태아 소 혈청으로 구성된 동결 배지에서 유리병 당 1,000만 개의 세포에서 동결 배지에 다시 중단합니다.
    4. 동결 용기에 동결하여 -80°C 냉동실에서 -1°C/min의 냉각 속도를 달성한 다음 48시간 후에 액체 질소로 옮김을 이월합니다.
    5. 시험관 내 또는 생체 내 실험에 사용하기 전에 따뜻한 TCM에서 CAR-T 세포를 해동하십시오.
    6. 세포를 세척하여 희석하고 디메틸 설폭사이드를 제거하고 따뜻한 TCM에서 2 x 106 세포 /mL의 농도로 다시 중단하십시오. 37 °C, 5 %CO2에서 하룻밤 휴식.

2. GM-CSF k/o CART19 생산

  1. GM-CSF를 중단시키기 위하여는, 인간 사이토카인 GM-CSF를 위해 인코딩하는 CSF2 유전자에 대해 고효율을 가지는 것으로 보고된 gRNA 스크리닝을 통해 선택된 인간 GM-CSF(CSF2)의 가이드 RNA(gRNA)를 표적으로 하는 엑소3를 활용한다. 14세
    참고: 이 gRNA를 함유하는 상업적으로 합성된 연구 등급 Cas9 3세대 렌티바이러스 구조(U6 프로모터 하에서)가 사용되었다. 컨스트럭트에는 푸로마이신 내성 유전자가 포함되어 있다. gRNA의 서열은 GACCTGCCTACAGACCCCCC이다. 12세
  2. 렌티바이러스를 생성하려면 70-90%의 동률에 도달한 293T 세포를 활용하십시오.
  3. 관심 있는 렌티바이러스 플라스미드 15 μg, 개그/폴/타트/레브 포장 벡터 18 μg, VSV-G 봉투 벡터 7 μg, 사전 복합 시약 111μL, 트랜스펙션 시약 129 μL, 트랜스펙션 배지 9.0 mL을 허용하여 30분 동안 인큐베이팅 mperature.
  4. 293T 세포에 형질감염 시약을 추가합니다. 이어서 37°C, 5%CO2에서 배양한다.
  5. 수확, 원심분리기(10분동안 900 x g), 필터(0.45 μM 나일론 필터) 및 초원심분리에 의해 24 및 48시간에서 초원심분리에 의해 18시간 동안 13,028 x g 또는 112,700 x g의 초원분리기에서 2시간 동안 농축하고 향후 사용을 위해 -80°C에서 동결합니다.
  6. 1일째에는 T 세포를 부드럽게 다시 일시 중단하여 장미를 분해합니다.
  7. BSL-2+ 승인 된 실험실에서, CAR-T 세포를 생성 하는 자극 된 T 세포에 냉동 또는 갓 수확 된 바이러스를 추가. CAR19 렌티바이러스와 CRISPR 렌티바이러스를 표적으로 하는 GM-CSF 를 모두 가진 T 세포를 변환합니다. 3의 MOI에 CAR19 렌티 바이러스를 추가합니다. CRISPR 렌티바이러스의 적정이 가능하지 않았기 때문에, 15 ug 플라스미드 제제에서 생성된 바이러스 입자를 사용하여 10 x 106 T 세포를 변환한다.
  8. 1단계에서 논의된 바와 같이 T 세포 자극, 팽창 및 동결 보존의 나머지 단계를 참조하십시오.
  9. 순수마이신 내성을 운반하는 렌티CRISPR 편집 T 세포의 경우, 3일째와 5일째에는 1 mL당 1 μg의 순으로 푸로마이신 디하이드로클로라이드로 세포를 치료하십시오.

3. GM-CSF 중단 효율 및 GM-CSF k/o CART19의 기능 평가

  1. GM-CSF 중단 효율: 분해(TIDE) 시퀀싱 및 분석에 의한 인델 추적
    1. GM-CSF 유전자에 대한 관심의 엑슨을 서열화하려면, 다음 프라이머를 사용한다. TGACTACAGAGACACAGA의 GM-CSF(CSF2)에 대한 정방향 프라이머 시퀀스 및 TCACCTCTGACCTCATTAACC의 역방향 프라이머 시퀀스를 사용한다.
    2. 게놈 추출 키트로 최대 5백만 대의 CAR-T 세포에서 DNA를 추출합니다. PCR 반응을 위해, μM의 PCR 반응에서 각 프라이머의 최종 농도와 반응당 25 μL의 Taq mastermix를 사용하고, 템플릿 DNA의 0.1-0.5 μg, 및 총 PCR 반응의 총 부피는 뉴클레아제 자유물로 최대 50 μL까지 가져왔다.
    3. 1에 설명된 PCR 사이클링 조건을 참조하십시오.
    4. 1-2% 아가로즈 젤에서 100V에서 30분 동안 PCR 샘플을 실행하고 젤 추출 키트를 사용하여 추출합니다.
    5. 시퀀스 PCR 앰플리온. 적절한 TIDE 소프트웨어에 원시 데이터를 업로드하여 대중 수정 빈도를 계산합니다. 15세
  2. GM-CSF 생산 및 GM-CSFk/o CART19의 기능 평가
    1. CAR-T 세포의 사이토카인 생성을 결정하기 위해, CD19를 사용하여 급성 림프구성 백혈병 세포주 NALM6를 37°C에서 4시간 동안 1:5 비율로 발현하는 CD19를 사용하여 야생형 CART19 세포및 GM-CSFk/o CART19을 배양하여 37°C에서 5% CO2의 모렌신이 존재할 때 솔루션, 반 인간 CD49d, 안티 인간 CD28, 및 반 인간 CD107a.
    2. 유세포측정을 위해 배양으로부터 세포를 수확한다. 유세포 분석 버퍼로 세포를 세척합니다. 살아있는/죽은 염색 키트로 세포를 염색합니다. 실온에서 15 분 동안 어둠 속에서 배양. 고정 매체로 세포를 고정하고 실온에서 15 분 동안 어둠 속에서 배양하십시오.
    3. 세척 후, 세포를 반인간 IFNγ 단일클론 항체, 항인간 GM-CSF, 항인간 MIP-1β, 항인간 IL-2 및 반인간 CD3와 결합하여 투과성 배지로 세포 내로 염색하고 30에 대한 실온에서 어두운 환경에서 배양 샘플을 세척하고 다시 일시 중단하십시오. 유세포계에서 샘플을 획득하고 세포내 GM-CSF 발현비율을 분석하였다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

그림 1은 GM-CSFk/o CART19 셀에서 GM-CSF의 감소를 나타낸다. T 세포의 게놈이 녹아웃 GM-CSF로 변경되었는지 확인하기 위해, TIDE 시퀀싱을 GM-CSFk/o CART19 세포(도1A)에서사용하였다. CAR-T 세포 표면 염색은 T 세포가 살아있는 CD3+ 세포상에서 게이팅을 통해 시험관 내에서 CAR 표면 수용체를 성공적으로 발현하는 것을 확인한다(도1B). 유세포분석에 의한 GM-CSF의 세포내 염색은 살아있는 CD3+ 세포에서 게이팅함으로써 GM-CSF에서 GM-CSF의 감소된 발현을 입증하고, 녹아웃의 기능적 성공을 검증한다(도 1C). GM-CSFk/o CAR-T 세포는 세포내 염색을 통해 야생형 항CD19 CAR-T 세포(CART19)에 비해 GM-CSF의 감소를 나타낸다(도1B). 또한, 우리는 이전에 GM-CSFk/o CAR-T 세포가 생체 내 야생형 CAR-T 세포에 비해 항종양 활성 및 생존을 향상시키면서 GM-CSF의 생산을 감소시키는 것으로 나타났습니다. 12세 

단계 온도(°C) 시간 사이클
초기 변성 94세 약 3분 1개
변성 94세 45초 35세
어 닐 링 60 30초
확장 72세 2분
연수 후 72세 약 10분 1개
4개

표 1: GM-CSFk/o CART19 셀의 TIDE 시퀀싱을 위한 PCR 사이클링 조건.

Figure 1
그림 1 : GM-CSFk/o CART19 셀은 GM-CSF의 감소를 보여줍니다. A)대표적인 TIDE 서열은 ~71%의 파괴 효율로 GM-CSF CRISPR/Cas9 GM-CSFk/o CART19 세포의 게놈 변경을 검증합니다. B)대표적인 플로우 플롯은 야생형 CART19 및 GM-CSFk/o CART19에서 유사한 CAR 발현을 가진 성공적인 CAR-T 세포 생산을 묘사합니다. C)세포내 염색에 의해 분석된 바와 같이, GM-CSFk/o CART19 세포는 CD19 양성 ALL 세포주 NALM6로 자극될 때 야생형 CART19에 비해 감소된 GM-CSF를 보여준다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 보고서에서는 CRISPR/Cas9 기술을 활용하여 CAR-T 세포의 이차 수정을 유도하는 방법론을 설명합니다. 구체적으로, 이것은 GM-CSFk/o CART19 세포를 생성하기 위해 관심 유전자및 Cas9를 표적화하는 gRNA를 포함하는 바이러스 벡터를 이용한 렌티바이러스 트랜스덕션을 사용하여 입증된다. 우리는 이전에 GM-CSF 중화가 이종이식 모델에서 CRS 및 NT를 개량한다는 것을 보여주었습니다. 12 앞에서 설명한 바와 같이, GM-CSFk/o CAR-T 세포는 제조 공정 중 GM-CSF의 억제를 허용하고, 다른 중요한 T 세포 기능을 유지하면서 GM-CSF의 생산을 효과적으로 감소시키고, 향상된 결과를 초래합니다. 야생형 CAR-T 세포에 비해 생체 내 항종양 활성. 12세

게놈에 있는 Cas9의 영구적인 통합은 임상으로 실행 가능한 제품으로 번역될 때 원치 않는 효력과 연관될 수 있기 때문에, 우리는 개념의 증명을 위한 연구 급료 CRISPR/Cas9 수정된 CART19를 생성하는 쪽으로 이 특정 방법론을 제안합니다 실험.

CAR-T 세포는 암 치료에있는 약속을 붙들고 있는 동안, 1,2 그들의 효험은 향상되고 그들의 관련한 독성이 더 잘 통제될 수 있습니다. CRISPR/Cas9 기술은 CAR-T 세포의 게놈을 직접 표적으로 삼아 현재의 임상 적 단점에 대한 솔루션을 엔지니어링하는 전략을 제공합니다. 이 문서에서는 GM-CSFk/o CART19 셀의 생성에 대해 설명합니다.

GM-CSFk/o CAR-T 세포는 GM-CSF 및 Cas9에 대한 가이드 RNA를 포함하는 CAR-T 세포 플라스미드 및 렌티바이러스 구조에 대한 렌티바이러스 벡터를 가진 트랜스덕션에 의해 생성되었다. GM-CSFk/o를생성하기 위해, Cas9를 함유하는 3세대 렌티바이러스 구조(lentiCRISPRv2)와 U6 프로모터의 제어 하에 인간 GM-CSF(CSF2)14의 엑소3을 표적으로 하는 고효율 가이드 RNA(gRNA)를 활용하였다. 이들은 수정된 CAR-T 세포의 발달에 가장 중요하기 때문에 절차의 감전 단계 도중 특별한 주의를 기울여야 합니다. 녹아웃 효율은 분해(TIDE) 서열에 의한 인델의 추적을 통해 검증및 평가될 수 있습니다. CAR-T 세포의 기능적 활성은 CD19+ 표적 세포를 가진 CAR 컨스트럭트의 항원 특이적 자극을 통해 조사되고, 그 다음에 GM-CSF의 생산을 포함하는 상이한 T 세포 기능의 측정이 뒤따랐다. 12 참고로, 염소 항마우스 항체를 사용하여 CAR 발현을 위한 염색은 마우스 기원인 CART19의 단일 사슬 가변 영역 단편으로 인해 표면 염색 전에 발생하는 2개의 세차체로 다른 항체 염색 전에 발생해야 한다. 이것은 좋은 CAR 표현이 처음에 관찰되지 않는 경우 문제 해결에 중점을 둡자입니다.

이러한 변형된 CAR-T 세포는 시험관 내 연구 및 생체 내 이종이식 모델에서 개념 증명 실험을 위해 사용될 수 있다. 이 기술의 장점은 CAR-T 세포 생산 및 유전자 조작이 다른 기술에 비해 효율이 좋은 한 단계에서 모두 발생할 수 있다는 것입니다. 10개 , 11 이중 렌티바이러스 트랜스덕션은 연구등급의 GM-CSFk/o CART19 세포를 생성하는 편리하고 효과적인 방법이지만, DNA가 게놈에 통합되고 Cas9 발현이 길어지면서 게놈이 불안정해질 수 있고 오프 타겟 효과의 위험. 이 기술의 한계는 좋은 제조 사례 학년 녹아웃이 방법론이 게놈에 Cas9의 영구적인 통합을 초래하지 않기 때문에 리보뉴클레오 단백질 CRISPR /Cas9 시스템에 기술의 수정을 요구할 것이라는 점입니다. 대상 을 벗어난 효과의 가능성을 줄입니다. 여기서 프로토콜에 기술된 방법론은 CRISPR/Cas9를 통해 CAR-T 세포를 유전적으로 변형시켜 독성이 적거나 더 효과적인 CAR-T 세포를 생성하는 데 도움을 주기 위해 다양한 유전자에 잠재적으로 적용될 수 있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK는 노바티스(Mayo Clinic, 펜실베이니아 대학, 노바티스)에 허가된 CAR T 세포 치료 분야의 특허에 대한 발명가입니다. 이 연구 결과는 Humanigen (SSK)에서 보조금에 의해 부분적으로 투자되었습니다. RMS, MJC, RS 및 SSK는 이 작업과 관련된 특허를 발명하는 발명자입니다. 실험실 (SSK)는 Tolero, Humanigen, 연, 렌티겐, 모르포시, 및 액티늄에서 자금을 받습니다.

Acknowledgments

이 작품은 K12CA090628 (SSK), 국립 종합 암 네트워크 (SSK), 개별 의학메이요 클리닉 센터 (SSK), 프레돌린 재단 (SSK), 실천번역의 메이요 클리닉 사무소 (SSK) 및 보조금을 통해 지원되었습니다. 메이 요 클리닉 의료 과학자 교육 프로그램 로버트 L. 하웰 의사-과학자 장학금 (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics