Usando CRISPR/Cas9 para knock out GM-CSF em células CAR-T

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, apresentamos um protocolo para editar geneticamente as células CAR-T através de um sistema CRISPR/Cas9.

Cite this Article

Copy Citation | Download Citations

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A terapia de célula T (CAR-T) do receptor de antígeno quimérico é uma aresta de corte e uma nova opção de tratamento potencialmente revolucionária para câncer. No entanto, existem limitações significativas para o seu uso generalizado no tratamento do cancro. Estas limitações incluem o desenvolvimento de toxicidades originais tais como a síndrome da liberação do citocinas (CRS) e a neurotoxicidade (NT) e a expansão limitada, as funções efetoras, e a atividade antitumoral em tumores contínuos. Uma estratégia para melhorar a eficácia do CAR-T e/ou as toxicidades de controle das células CAR-t é editar o genoma das próprias células CAR-t durante a fabricação de células CAR-T. Aqui, nós descrevemos o uso da edição do gene de crispr/Cas9 em pilhas de Car-T através da transdução com uma construção lentivirais que contem um RNA do guia ao fator deestimulação da colônia do macrófago do granulocyte (GM-CSF) e Cas9. Como um exemplo, nós descrevemos o nocaute negociado CRISPR/Cas9 de GM-CSF. Nós mostramos que estas pilhas do carro-T do GM-CSFk/o produzem eficazmente menos GM-CSF ao manter a função crítica da pilha de t e resultam na atividade antitumoral aumentada in vivo comparada às pilhas selvagens do tipo Car-t.

Introduction

O receptor quimérico T do antígeno (carro-T) a terapia da pilha exibe a grande promessa no tratamento do cancro. 1. º , 2 duas terapias da pilha do carro-T que alvejaram CD19 (CART19) foram aprovadas recentemente nos Estados Unidos indicados e em Europa para o uso em malignidades da pilha de B após ter provado resultados impressionantes em ensaios clínicos multicêntrico. 3. º , 4. º , 5 as barreiras ao uso mais difundido de pilhas de Car-T são atividade limitada em tumores contínuos e em toxicidades associadas que incluem a síndrome da liberação do citocinas (CRS) e o neurotoxicidade (NT). 3. º , 5. º , 6 anos de , 7 anos de , 8 . º , 9 para realçar o índice terapêutico da terapia da pilha de Car-t, as ferramentas da engenharia do genoma tais como nucleases do dedo do zinco, Talens, e crispr são empregadas para modificar mais pilhas de Car-t em uma tentativa de gerar umas pilhas menos tóxicas ou mais eficazes de Car-t. 10 de , 11 anos de

Neste artigo, descrevemos um método para gerar células CAR-T editadas CRISPR/Cas9. O objetivo específico deste método é modificar geneticamente as células CAR-T durante a fabricação de células Car-T via CRISPR/Cas9 para gerar células CAR-T menos tóxicas ou mais efetivas. A fundamentação para o desenvolvimento desta metodologia é construída sobre as lições aprendidas com a experiência clínica da terapia celular CAR-T, o que indica uma necessidade urgente de novas estratégias para aumentar a janela terapêutica da terapia celular CAR-T e estender a aplicação em outros tumores e é apoiado pelos recentes avanços na biologia sintética permitindo múltiplas modificações das células CAR-T que começaram a entrar na clínica. Enquanto várias ferramentas de engenharia do genoma estão sendo desenvolvidas e aplicadas em diferentes configurações, como nucleases de dedo de zinco, TALENs e CRISPR, nossa metodologia descreve a modificação de CRISPR/Cas9 de células CAR-T. 10 de , 11 crispr/Cas9 é um mecanismo de defesa bacteriano baseado em RNA que é projetado para eliminar o DNA externo. O CRISPR baseia-se em endonucleases para Cleave uma sequência alvo identificada através de um RNA guia (gRNA). A edição CRISPR das células CAR-T oferece várias vantagens sobre outras ferramentas de engenharia do genoma. Estes incluem a precisão da sequência gRNA, simplicidade para projetar um gRNA visando o gene de interesse, alta eficiência de edição de genes, e a capacidade de segmentar vários genética, uma vez que vários gRNAs podem ser usados ao mesmo tempo.

Especificamente nos métodos descritos aqui, foi utilizado um Lentivirus codificação CRISPR guia RNA e Cas9 para interromper um gene durante a transdução do carro de células T. Ao selecionar uma técnica apropriada para editar células CAR-T, sugerimos que a técnica descrita aqui seja um mecanismo eficiente para gerar células CAR-T de grau de pesquisa, mas porque o efeito a longo prazo da integração permanente de Cas9 no genoma é desconhecido, nós propor esta metodologia para desenvolver a prova de conceito de pesquisa de grau de células CAR-T, mas não para a produção de boas práticas de fabrico grau CAR-T células.

Em particular, aqui nós descrevemos a geração de granulocyte macrófago colônia fator estimulante (GM-CSF) Knockout CAR-T células visando a CD19. Essas células CAR-T foram geradas por transdução com partículas lentivirais codificando um RNA guia específico para GM-CSF (Gene Name CSF2) e Cas9. Nós encontramos previamente que a neutralização do GM-CSF melhora CRS e NT em um modelo do xenograft. 12 pilhas do GM-CSFk/o Car-t permitem a inibição do GM-CSF durante o processo de manufactura, reduzindo eficazmente a produção de GM-CSF ao realçar a atividade do anti-tumor da pilha de Car-t e a sobrevivência in vivo comparado às pilhas do tipo selvagem Car-t. 12 assim, aqui nós fornecemos uma metodologia para gerar crispr/Cas9 editado células Car-T.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este protocolo segue as diretrizes do Conselho de revisão institucional da clínica Mayo (IRB) e do Comitê de biossegurança institucional (IBC).

produção da pilha 1. CART19

  1. Isolamento de células T, estimulação e cultura ex vivo
    1. Realize todo o trabalho da cultura de pilha em uma capa da cultura de pilha que utiliza o equipamento protetor pessoal apropriado. Colher células mononucleares do sangue periférico (PBMCs) de cones sanguíneos de doadores normais coletados durante a aférese, pois estes são conhecidos por serem uma fonte viável de PBMCs.13
    2. Para isolar PBMCs, adicione 15 mL de um meio de gradiente de densidade a um tubo de separação de gradiente de densidade de 50 mL. Diluir o sangue do doador com um volume igual de solução salina tamponada com fosfato (PBS) contendo 2% de soro fetal bovino (FBS) para evitar aprisionamento celular.
      1. Adicione o sangue do doador diluído do cone no tubo de separação, cuidado para não perturbar a interface entre o sangue e o meio de gradiente de densidade. Centrífuga a 1.200 x g por 10 min em RT.
      2. Decantar o sobrenadante em um novo 50 mL cônico, lave com PBS + 2% FBS trazendo até 40 mL, centrifugar a 300 x g por 8 min em RT, aspirar sobrenadante, ressuscite em 40 ml de tampão, e contagem de células.
    3. Isole células T de PBMCs através de um kit de talão magnético de seleção negativa usando um separador de células totalmente automatizado de acordo com o protocolo do fabricante.
    4. Para a cultura das células T isoladas, prepare o meio de célula T (TCM) que consiste em 10% de soro de AB humano (v/v), 1% de penicilina-estreptomicina-glutamina (v/v) e meio de células hematopoiéticas sem soro. Esterilize o meio filtrando através de um filtro de vácuo estéril de 0,45 μm e então com um filtro de vácuo estéril de 0,22 μm.
    5. No dia 0 (o dia da estimulação da célula T), lave os grânulos CD3/CD28 antes da estimulação de pilhas de T. Para lavar, coloc o volume exigido dos grânulos (use bastantes grânulos de CD3/CD28 para uma relação de 3:1 grânulos: pilhas de T; Note que a concentração de grânulos pode ser variável) em um tubo estéril do microcentrifugador de 1,5 mL e em um Ressuspender em 1 mL de TCM.
    6. Coloque em contato com um ímã.
    7. Após 1 min, aspirar o TCM e ressuscitem em 1 mL de TCM fresco para lavar as contas.
    8. Repita este procedimento para um total de três laves.
    9. Após a terceira lavagem, Ressuspender os grânulos em 1 mL de TCM.
    10. Conte as células T.
    11. Transfira grânulos às pilhas de T em uma relação de 3:1 grânulos: pilhas.
    12. Diluir as células para uma concentração final de 1 x 106 células/ml.
    13. Incubar a 37 ° c, 5% CO2 por 24 h.
  2. Transfecção de células T
    1. Realize o trabalho lentivirais usando as precauções BSL-2 +, incluindo capas de cultura celular, equipamentos de proteção individual e desinfecção de materiais usados com lixívia antes da eliminação.
    2. Adquira uma construção CART19 em um vetor lentivirais.
      Nota: a construção CART19 utilizada aqui foi projetada e sintetizada de novo usando um fornecedor de síntese de proteínas comercialmente disponível. O constructo CAR foi posteriormente clonado em um Lentivirus de terceira geração controle de um promotor EF-1 α. O fragmento de região de variável de cadeia única é derivado do clone FMC63 e reconhece a CD19 humana. O constructo CAR19 possui um domínio costimulatório de segunda geração 4-1BB e estimulação CD3ζ (FMC63-41BBz). 12 anos de
    3. Executar a produção de Lentivirus como descrito anteriormente. 12 anos de
      1. Em resumo, para produzir Lentivirus, utilizar 293T células que atingiram 70-90% confluência.
      2. Permitir incubação por 30 min à temperatura ambiente de reagentes de transfecção, incluindo 15 μg do plasmídeo lentivirais de juros, 18 μg de um vetor de embalagem de GAG/pol/tat/Rev, 7 μg de um vetor de envelope VSV-G, 111 μl do reagente pré-complexante, 129 μl do Reagente de transfecção e 9,0 mL do meio de transfecção antes de adicionar às células 293T. Em seguida, a cultura das células transfected em 37 ° c, 5% CO2.
      3. Colheita, centrifugador (900 x g por 10 min), filtro (filtro de nylon de 0,45 μm), e sobrenadante concentrado em 24 e 48 h por ultracentilgação em 13.028 x g para 18 h ou 112.700 x g para 2 h.
      4. Congelar em-80 ° c para uso futuro.
    4. No dia 1, reressuscite suavemente as células T para romper as rosetas das células T que foram estimuladas a 1 x 106/ml no dia 0.
    5. apropriado BSL-2 + precauções para todo o trabalho lentivirais, adicionam o vírus colhido fresco ou congelado às pilhas de T estimuladas em um multiplicidade da infecção (moi) de 3,0.
  3. Expansão celular CAR-T
    1. Durante a fase de expansão, continue a incubar as células T transinadas a 37 ° c, 5% CO2. Conte as células CAR-T nos dias 3 e 5 e adicione TCM fresco e pré-aquecido à cultura para manter uma concentração de células CAR-T de 1 x 106/ml.
    2. Retire os grânulos das células T transmóadas 6 dias após a estimulação (dia 6) com um íman. Colheita, ressuscitar e colocar células T em 50 mL de tubos cônicos em um ímã por 1 min. Em seguida, recolher o sobrenadante (contém as células CAR-T), e descartar as contas.
    3. Coloque as células CAR-T coletadas de volta na cultura em uma concentração de 1 x 106 células/ml para retomar a expansão.
    4. No dia 6, avalie a expressão superficial do CAR por citometria de fluxo.
      Nota: diversos métodos podem ser usados para detectar a expressão de superfície do carro, tal como a mancha com um anticorpo secundário adsorto da IgG do anti-rato da cabra (H + L) ou manchando com um peptide específico CD19, conjugado a um fluorochrome. Tome uma alíquota (cerca de 100.000 células T) da cultura e lave com tampão de fluxo preparado com soro fisiológico tamponado com fosfato de Dulbecco, soro bovino fetal a 2% e azida sódica a 1%. Manchar as células com o anticorpo anti-CAR e lave duas vezes. Manchar as células com mancha viva/morta e anticorpo monoclonal CD3 (OKT3). Lave as células e ressuscitem no tampão de fluxo. Adquira em um citômetro para determinar a eficiência da transdução.
  4. Criopreservação de células CAR-T
    1. Para colher e cripreservar células CAR-T 8 dias após a estimulação (dia 8 de expansão da célula T), colher as células da cultura.
    2. Gire para baixo por 5 min em 300 x g.
    3. Ressuscitava em meio de congelação em 10 milhões células por mL por frasco em meio de congelação consistindo de 10% de sulfóxido de dimetil e 90% de soro bovino fetal.
    4. Congelar em um recipiente de congelamento para atingir uma taxa de resfriamento de-1 ° c/min em um-80 ° c freezer e depois transferir para nitrogênio líquido após 48 h.
    5. Antes do seu uso para experimentos in vitro ou in vivo, descongele as células CAR-T em TCM quente.
    6. Lave as células para diluir e remover o dimetil sulfóxido e ressuscitar para uma concentração de 2 x 106 células/ml em TCM quente. Descanse durante a noite a 37 ° c, 5% CO2.

2. GM-CSF k/o CART19 produção

  1. Para interromper o GM-CSF, utilize um guia RNA (grna) visando exon 3 do GM-CSF humano (CSF2) selecionado através da seleção grnas relatado previamente para ter a eficiência elevada para o gene CSF2 que codifica para o GM-CSF humano do citocinas. 14 anos de
    Nota: utilizou-se um construto de pesquisa comercialmente sintetizado de grau Cas9 de terceira geração contendo este gRNA (sob um promotor U6). O construto contém um gene de resistência à puromicina. A sequência do gRNA é GACCTGCCTACAGACCCGCC. 12 anos de
  2. Para produzir Lentivirus, utilize células de 293T que atingiram 70-90% de confluência.
  3. Permitir 15 μg do plasmídeo lentivirais de juros, 18 μg de um vetor de embalagem de GAG/pol/tat/Rev, 7 μg de um vetor de envelope VSV-G, 111 μl do reagente pré-complexante, 129 μl do reagente de transfecção e 9,0 ml do meio de transfecção para incubar por 30 min no quarto te rmal.
  4. Adicionar reagentes de transfecção às células 293T. Então cultura em 37 ° c, 5% CO2.
  5. Colheita, centrifugação (900 x g por 10 min), filtro (filtro de nylon de 0,45 μM) e sobrenadante concentrado a 24 e 48 h por ultracentilgação a 13.028 x g durante 18 h ou 112.700 x g durante 2 h e congelar a-80 ° c para uso futuro.
  6. No dia 1, resuspender suavemente as células T para quebrar Rosettes.
  7. Em um laboratório aprovado BSL-2 +, adicione o vírus congelado ou recentemente colhido às pilhas de T estimuladas para gerar pilhas de CAR-T. Transduce células T com Lentivirus CAR19 e GM-CSF visando Lentivirus CRISPR. Adicionar CAR19 Lentivirus em um MOI de 3. Como a titulação do Lentivirus CRISPR não foi viável, o uso de partículas de vírus geradas a partir de uma preparação de 15 UG plasmídeo para transduce 10 x 106 células T.
  8. Veja as etapas restantes da estimulação, da expansão, e da criopreservação da célula T como discutido em etapa 1.
  9. Para células T editadas por lentiCRISPR que transportam resistência à puromicina, trate as células com dicloridrato de puromicina numa concentração de 1 μg de puromicina por 1 mL no dia 3 e no dia 5.

eficiência do rompimento 3. GM-CSF e avaliação funcional do GM-CSF k/o CART19

  1. Eficiência de ruptura GM-CSF: rastreamento de indels por sequenciamento e análise de decomposição (TIDE)
    1. Para sequenciar o exão de interesse no gene GM-CSF, use os seguintes primers. Use uma seqüência de primer para a frente para GM-CSF (CSF2) de TGACTACAGAGAGGCACAGA, e uma seqüência de primer reverso de TCACCTCTGACCTCATTAACC.
    2. Extraia o DNA de até 5 milhões células CAR-T com um kit de extração genômica. Para a reação do PCR, use 25 μL de um MasterMix de Taq por a reação com uma concentração final de cada primeira demão na reação do PCR do μM, 0.1-0.5 μg do ADN do molde, e um volume total da reação do PCR trazido até 50 μL com água livre do nuclease.
    3. Veja as condições de ciclagem da PCR descritas na tabela 1.
    4. Execute amostras de PCR em um gel de agarose de 1-2% a 100 V por 30 min e extraia usando um kit de extração de gel.
    5. Amplicons da PCR da seqüência. Calcule a frequência de modificação do alelo carregando dados brutos em um software TIDE apropriado. 15 anos de
  2. Produção de GM-CSF e avaliação funcional do GM-CSFk/o CART19
    1. Para determinar a produção de citocinas de células CAR-T, incubar células selvagens do tipo CART19 e GM-CSFk/o CART19 com o CD19 expressando linha celular de leucemia linfoblástica aguda NALM6 em uma proporção de 1:5 para 4 h a 37 ° c, 5% co2 na presença de monensina solução, CD49d, anti-Human CD28, e CD107a anti-Human.
    2. Colha células da cultura para citometria de fluxo. Lave as células com tampão de citometria de fluxo. Manchar as células com um kit de coloração vivo/morto. Incubar no escuro à temperatura ambiente durante 15 min. fixar as células com um meio de fixação e incubar no escuro à temperatura ambiente durante 15 min.
    3. Após a lavagem, manchar as células intracelularmente com meio de permeabilização em combinação com anti-humanos IFNγ anticorpo monoclonal, anti-humano GM-CSF, anti-humano MIP-1 β, anti-humano Il-2, e anti-humano CD3 e incubar no escuro em temperatura ambiente para 30 min. Lave e ressuspender as amostras. Adquira amostras em um citômetro do fluxo e analisado para a porcentagem da expressão intracelular do GM-CSF.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

A Figura 1 mostra a redução do GM-CSF nas células GM-CSFk/o CART19. Para verificar se o genoma das células T foi alterado para nocaute GM-CSF, o sequenciamento de TIDE foi utilizado nas células GM-CSFk/o CART19 (Figura 1a). A mancha da superfície da pilha de CAR-T verifica que as pilhas de T expressam com sucesso o receptor de superfície do carro in vitro gating em pilhas CD3 + vivos (Figura 1b). A coloração intracelular de GM-CSF por citometria de fluxo demonstra a diminuição da expressão de GM-CSF em células GM-CSFk/o CART19 por gating em células CD3 + ao vivo, verificando o sucesso funcional do nocaute (Figura 1C). As pilhas do carro-t do GM-CSFk/o exibem uma diminuição no GM-CSF comparada às pilhas CD19 Car-t do tipo selvagem (CART19) através da mancha intracelular (Figura 1b). Além, nós mostramos previamente que as pilhas do carro-t do GM-CSFk/o reduzem a produção de GM-CSF ao realçar a atividade e a sobrevivência antitumorais comparadas às pilhas do tipo selvagem Car-t in vivo. 12 anos de 

Passo Temp (° c) Tempo Ciclos
Desnaturação inicial 94 3 minutos 1
Desnaturação 94 45 seg 35
Recozimento 60 30 seg.
Extensão 72 2 minutos
Pós-alongamento 72 10 minutos 1
4

Tabela 1: Condições de ciclagem de PCR para sequenciamento de TIDE de células GM-CSFk/o CART19.

Figure 1
Figura 1 : GM-CSFk/o CART19 células mostram redução no GM-CSF. A) uma sequência de maré representativa verifica a alteração do genoma das células GM-CSF Crispr/Cas9 GM-CSFk/o CART19 com uma eficiência de ruptura de ~ 71%. B) as parcelas representativas do fluxo retratam a produção bem sucedida da pilha de Car-T com expressão similar do carro no tipo selvagem CART19 e GM-CSFk/o CART19. C) como analisado por coloração intracelular, as células GM-CSFk/o CART19 apresentam redução do GM-CSF em comparação com o tipo selvagem CART19 quando ESTIMULADOS com a NALM6 de linha celular All CD19 positiva. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Neste relatório, nós descrevemos uma metodologia para utilizar a tecnologia de CRISPR/Cas9 para induzir modificações secundárias em pilhas de CAR-T. Especificamente, isso é demonstrado usando transdução lentivirais com um vetor viral que contém grna visando o gene de interesse e Cas9 para gerar células GM-CSFk/o CART19. Nós tínhamos mostrado previamente que a neutralização de GM-CSF melhora CRS e NT em um modelo do xenograft. 12 como descrito previamente, as pilhas do carro-t do GM-CSFk/o permitem a inibição de GM-CSF durante o processo de manufactura, reduzem eficazmente a produção de GM-CSF ao manter outras funções críticas da pilha de t, e resultam em realçado atividade antitumoral in vivo em comparação com as células do tipo tipo selvagem Car-T. 12 anos de

Desde que a integração permanente de Cas9 no genoma poderia ser associada com os efeitos indesejados quando traduzido a um produto clinicamente viável, nós propor esta metodologia específica como uma maneira de gerar a classe da pesquisa CRISPR/Cas9 modificou CART19 para a prova do conceito Experiências.

Quando as pilhas de Car-T prendem a promessa na terapia de cancro,1,2 sua eficácia pode continuar a ser aumentada e suas toxicidades associadas controladas melhor. A tecnologia CRISPR/Cas9 fornece uma estratégia para direcionar diretamente o genoma das células CAR-T para projetar soluções para deficiências clínicas atuais. Neste artigo, nós descrevemos a geração de pilhas do GM-CSFk/o CART19.

As pilhas do carro-t do GM-CSFk/o foram geradas pela transdução com um vetor lentivirais para o plasmídeo da pilha de Car-t e uma construção do Lentivirus que contem um RNA do guia a GM-CSF e a Cas9. Para gerar o GM-CSFk/o, uma construção do Lentivirus da terceira geração (lentiCRISPRv2) que contem Cas9 e um RNA elevado relatado do guia da eficiência (grna) que focam o exon 3 do GM-CSF humano (CSF2)14 o controle de um promotor U6 foi utilizado. Um cuidado particular deve ser tomado durante as etapas da transdução do procedimento porque estes são os mais críticos ao desenvolvimento das pilhas modificadas de CAR-T. A eficiência de nocaute pode ser verificada e avaliada através do rastreamento de indelos por sequências de decomposição (TIDE). A atividade funcional de pilhas de CAR-T é investigada com a estimulação específica do antígeno da construção do carro com CD19 + pilhas do alvo, seguidas pela medida de funções diferentes da pilha de T, incluindo a produção de GM-CSF. 12 da nota, manchando para a expressão do carro com um anticorpo do anti-rato da cabra deve ocorrer antes do outro anticorpo que mancha com as duas lavas que ocorrem antes da mancha de superfície devido ao fragmento variável da região da única cadeia do CART19 que é da origem do rato. Este é um ponto da ênfase no tiro do problema se a boa expressão do carro não é observada inicialmente.

Essas células CAR-T modificadas podem ser usadas em estudos in vitro e modelos in vivo xenograft para provas de experimentos de conceito. Uma vantagem desta técnica é que a produção da pilha de CAR-T e a manipulação genética podem ambos ocorrer em uma etapa com boa eficiência comparada a outras técnicas. 10 de , 11 quando a transdução lentivirais dupla for um método conveniente e eficaz para gerar as pilhas do GM-CSFk/o CART19 da classe da pesquisa, o ADN é incorporado no genoma e a expressão Cas9 prolongada pode desestabilizar o genoma e aumentar o risco de efeitos fora do alvo. Uma limitação desta técnica é que os nocautes da classe da prática do bom-Manufacturing exigiriam a modificação da técnica a um sistema de ribonucleoprotein crispr/CAS9 porque esta metodologia não resulta na incorporação permanente de Cas9 no genoma e reduz o potencial de efeitos fora do alvo. A metodologia descrita no protocolo aqui pode potencialmente ser aplicada a uma variedade de genes para modificar geneticamente as células CAR-T via CRISPR/Cas9 para ajudar a gerar células CAR-T menos tóxicas ou mais efetivas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK é um inventor em patentes no campo da terapia de célula T do carro que são licenciadas a Novartis (sob um acordo entre a clínica de Mayo, a Universidade de Pensilvânia, e o Novartis). Estes estudos foram financiados em parte por uma subvenção do Humanigen (SSK). RMS, MJC, RS e SSK são inventores de patentes relacionadas a este trabalho. O laboratório (SSK) recebe financiamento de tolero, Humanigen, kite, Lentigen, Morphosys e actínio.

Acknowledgments

Este trabalho foi apoiado através de subvenções da K12CA090628 (SSK), da rede nacional de câncer abrangente (SSK), do centro de clínica Mayo para medicina individualizada (SSK), da Fundação Predolin (SSK), do escritório da clínica Mayo de tradução para a prática (SSK), e o programa de treinamento de cientista médico da clínica Mayo Robert L. Howell bolsa de estudos médico-cientista (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics