Uso de CRISPR/Cas9 para noquear GM-CSF en células CAR-T

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí, presentamos un protocolo para editar genéticamente las células CAR-T a través de un sistema CRISPR/Cas9.

Cite this Article

Copy Citation | Download Citations

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La terapia celular del receptor de antígeno quimérico T (CAR-T) es una nueva opción de tratamiento para el cáncer de vanguardia y potencialmente revolucionaria. Sin embargo, hay limitaciones significativas a su uso generalizado en el tratamiento del cáncer. Estas limitaciones incluyen el desarrollo de toxicidades únicas como el síndrome de liberación de citoquinas (SCR) y neurotoxicidad (NT) y la expansión limitada, las funciones del efector y la actividad antitumoral en tumores sólidos. Una estrategia para mejorar la eficacia CAR-T y / o controlar las toxicidades de las células CAR-T es editar el genoma de las células CAR-T sí mismos durante la fabricación de células CAR-T. Aquí, describimos el uso de la edición de genes CRISPR/Cas9 en células CAR-T a través de la transducción con una construcción lentiviral que contiene un ARN guía al factor estimulante de colonias de macrófagos de granulocitos (GM-CSF) y Cas9. Como ejemplo, describimos el nocaut mediado por CRISPR/Cas9 de GM-CSF. Hemos demostrado que estas células GM-CSFk/o CAR-T producen efectivamente menos GM-CSF mientras mantienen la función crítica de las células T y dan lugar a una mayor actividad antitumoral in vivo en comparación con las células CAR-T de tipo salvaje.

Introduction

La terapia celular del receptor de antígeno quimérico T (CAR-T) exhibe una gran promesa en el tratamiento del cáncer. 1 , 2 Dos terapias de células CAR-T dirigidas a CD19 (CART19) fueron aprobadas recientemente en los Estados Unidos y en Europa para su uso en neoplasias malignas de células B después de demostrar resultados sorprendentes en ensayos clínicos multicéntricos. 3 , 4 , 5 Las barreras para un uso más generalizado de las células CAR-T son la actividad limitada en tumores sólidos y toxicidades asociadas, como el síndrome de liberación de citoquinas (SCR) y la neurotoxicidad (NT). 3 , 5 , 6 , 7 , 8 , 9 Para mejorar el índice terapéutico de la terapia celular CAR-T, se emplean herramientas de ingeniería del genoma como nucleasas de dedos de zinc, TALENs y CRISPR para modificar aún más las células CAR-T en un intento de generar células CAR-T menos tóxicas o más eficaces. 10 , 11

En este artículo, describimos un método para generar celdas CAR-T editadas por CRISPR/Cas9. El objetivo específico de este método es modificar genéticamente las células CAR-T durante la fabricación de células CAR-T a través de CRISPR/Cas9 para generar células CAR-T menos tóxicas o más eficaces. La razón para desarrollar esta metodología se basa en las lecciones aprendidas de la experiencia clínica de la terapia celular CAR-T, lo que indica una necesidad urgente de estrategias novedosas para aumentar la ventana terapéutica de la terapia con células CAR-T y extender la aplicación a otros tumores y está respaldado por los recientes avances en biología sintética permitiendo múltiples modificaciones de células CAR-T que han comenzado a entrar en la clínica. Mientras que varias herramientas de ingeniería del genoma se están desarrollando y aplicando en diferentes entornos, tales como nucleasas de dedos de zinc, TALENs y CRISPR, nuestra metodología describe la modificación CRISPR/Cas9 de las células CAR-T. 10 , 11 CRISPR/Cas9 es un mecanismo de defensa bacteriana basado en ARN que está diseñado para eliminar el ADN extraño. CRISPR se basa en endonucleasas para cortar una secuencia diana identificada a través de un ARN guía (GRNA). La edición CRISPR de células CAR-T ofrece varias ventajas sobre otras herramientas de ingeniería del genoma. Estos incluyen la precisión de la secuencia de GRNA, simplicidad para diseñar un gRNA dirigido al gen de interés, alta eficiencia de edición de genes, y la capacidad de apuntar a múltiples genes ya que múltiples gRNA se pueden utilizar al mismo tiempo.

Específicamente en los métodos descritos aquí, utilizamos un ARN de guía CRISPR y Cas9 para interrumpir un gen durante la transducción CAR de las células T. Al seleccionar una técnica apropiada para editar células CAR-T, sugerimos que la técnica descrita aquí es un mecanismo eficiente para generar células CAR-T de grado de investigación, pero debido a que se desconoce el efecto a largo plazo de la integración permanente de Cas9 en el genoma, proponer esta metodología para desarrollar pruebas de concepto de células CAR-T de grado de investigación, pero no para la producción de células CAR-T de grado de buenas prácticas de fabricación.

En particular, aquí describimos la generación de células car-T de factor estimulante de colonias de macrófagos granulocitos (GM-CSF) dirigidas a CD19 humano. Estas células CAR-T fueron generadas por transducción con partículas lentivirales codificando un ARN guía específico para GM-CSF (nombre genético CSF2) y Cas9. Anteriormente encontramos que la neutralización GM-CSF mejora CRS y NT en un modelo de xenoinjerto. 12 Células GM-CSFk/o CAR-T permiten la inhibición de GM-CSF durante el proceso de fabricación, reduciendo eficazmente la producción de GM-CSF al tiempo que mejoran la actividad antitumoral de las células CAR-T y la supervivencia in vivo en comparación con las células CAR-T de tipo salvaje. 12 Por lo tanto, aquí proporcionamos una metodología para generar células CAR-T editadas por CRISPR/Cas9.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este protocolo sigue las pautas de la Junta de Revisión Institucional (IRB) y del Comité Institucional de Bioseguridad (IBC) de Mayo Clinic.

1. Producción celular CART19

  1. Aislamiento de células T, estimulación y cultivo ex-vivo
    1. Llevar a cabo todo el trabajo de cultivo celular en una campana de cultivo celular utilizando el equipo de protección personal adecuado. Cosechar células mononucleares de sangre periférica (PPBM) de conos de sangre de donante normales no identificados recogidos durante la aféresis, ya que se sabe que son una fuente viable de PPBCM.13.
    2. Para aislar los PACL, añada 15 ml de un medio de gradiente de densidad a un tubo de separación de gradiente de densidad de 50 ml. Diluir la sangre del donante con un volumen igual de solución salina con fosfato (PBS) que contiene un 2% de suero bovino fetal (FBS) para evitar la captura celular.
      1. Añadir la sangre diluida del donante del cono en el tubo de separación, con cuidado de no perturbar la interfaz entre la sangre y el medio de gradiente de densidad. Centrífuga a 1.200 x g durante 10 min a RT.
      2. Decantar el sobrenadante en un nuevo cónico de 50 ml, lavar con PBS + 2% FBS trayendo hasta 40 ml, centrifugar a 300 x g durante 8 minutos a RT, sobrenadante pirata, resuspender en 40 ml de tampón y contar células.
    3. Aísle las células T de los PBMC a través de un kit de perlas magnéticas de selección negativa utilizando un separador de celdas totalmente automatizado de acuerdo con el protocolo del fabricante.
    4. Para cultivar los células T aisladas, prepare el medio de células T (TCM) que consiste en un 10% de suero AB humano (v/v), 1% penicilina-estreptomicina-glutamina (v/v) y medio celular hematopoyético sin suero. Esterilice el medio filtrando a través de un filtro de vacío estéril de 0,45 m y luego con un filtro de vacío estéril de 0,22 m.
    5. El día 0 (el día de la estimulación de los células T), lave las perlas CD3/CD28 antes de la estimulación de los glóbulos T. Para lavar, coloque el volumen requerido de perlas (utilice suficientes perlas CD3/CD28 para una proporción de 3:1 perlas: células T; tenga en cuenta que la concentración de perlas puede ser variable) en un tubo de microcentrífuga estéril de 1,5 ml y resuspender en 1 ml de TCM.
    6. Colocar en contacto con un imán.
    7. Después de 1 min, aspirar la MTC y resuspender en 1 mL de TCM fresco para lavar las cuentas.
    8. Repita este procedimiento para un total de tres lavados.
    9. Después del tercer lavado, resuspenda las perlas en 1 ml de TCM.
    10. Cuente las células T.
    11. Transfiera las cuentas a las células T con una proporción de 3:1 beads:cells.
    12. Diluir las células a una concentración final de 1 x 106 células/ml.
    13. Incubar a 37oC, 5% CO2 durante 24 h.
  2. Transfección y transducción de células T
    1. Llevar a cabo el trabajo lentiviral utilizando las precauciones BSL-2+, incluyendo campanas de cultivo celular, equipo de protección personal y desinfección de materiales usados con lejía antes de su eliminación.
    2. Adquirir una construcción CART19 en un vector lentiviral.
      NOTA: La construcción CART19 utilizada aquí fue diseñada y luego sintetizada de novo utilizando un proveedor de síntesis de proteínas disponible comercialmente. La construcción de la CAR fue posteriormente clonada en un lentivirus de tercera generación bajo el control de un promotor EF-1. El fragmento de región variable de cadena única se deriva del clon FMC63 y reconoce CD19 humano. La construcción CAR19 posee un dominio coestimulante de segunda generación 4-1BB y estimulación CD3 (FMC63-41BBz). 12
    3. Realizar la producción lentiviral como se describió anteriormente. 12
      1. En resumen, para producir lentivirus, utilizar 293T células que han alcanzado 70-90% de confluencia.
      2. Permitir la incubación durante 30 minutos a temperatura ambiente de los reactivos de transfección, incluyendo 15 g del plásmido lentiviral de interés, 18 g de un vector de embalaje gag/pol/tat/rev, 7 g de un vector de envolvente VSV-G, 111 éL del reactivo de pre-complejo, 129 sde la transfección, y 9,0 ml del medio de transfección antes de añadira a las células 293T. A continuación, el cultivo de las células transtrópicas a 37 oC, 5% co2.
      3. Cosecha, centrífuga (900 x g durante 10 min), filtro (filtro de nylon de 0,45 m) y sobrenadante concentrado a 24 y 48 h por ultracentrifugación a 13.028 x g para 18 h o 112.700 x g para 2 h.
      4. Congele a -80 oC para su uso futuro.
    4. En el Día 1, resuspenda suavemente las células T para romper las rosetas de las células T que habían sido estimuladas a 1 x 106/ml el día 0.
    5. Bajo las precauciones apropiadas de BSL-2+ para todos los trabajos lentivirales, agregue el virus fresco o congelado cosechado a las células T estimuladas a una multiplicidad de infección (MOI) de 3.0.
  3. Expansión de células CAR-T
    1. Durante la fase de expansión, continúe incubando las células Ttransducidas a 37oC, 5% CO2. Cuente las células CAR-T en los días 3 y 5, y agregue TCM fresco y precalentado al cultivo para mantener una concentración de células CAR-T de 1 x 106/mL.
    2. Retire las perlas de las células T transducidas 6 días después de la estimulación (Día 6) usando un imán. Cosecha, resuspende y coloca las células T en tubos cónicos de 50 ml en un imán durante 1 min. A continuación, recoja el sobrenadante (contiene las células CAR-T), y deseche las cuentas.
    3. Coloque las células CAR-T recogidas de nuevo en el cultivo a una concentración de 1 x 106 células/ml para reanudar la expansión.
    4. El día 6, evaluar la expresión superficial de la CAR por citometría de flujo.
      NOTA: Se pueden utilizar varios métodos para detectar la expresión superficial de la CAR, como la tinción con un anticuerpo secundario de alta relación antiratón de cabra (H+L) o mediante la tinción con un péptido específico CD19, conjugado con un fluorocromo. Aquí, tome una alícuota (alrededor de 100.000 células T) del cultivo y lávese con tampón de flujo preparado con salina tamponada de fosfato de Dulbecco, suero bovino fetal al 2% y 1% de azida sódica. Mancha las células con el anticuerpo anti-CAR y lávate dos veces. Manchar las células con mancha viva/muerta y anticuerpo monoclonal CD3 (OKT3). Lave las células y resuspenda en el búfer de flujo. Adquirir en un catómetro para determinar la eficiencia de transducción.
  4. Criopreservación de células CAR-T
    1. Para cosechar y criopreservar las células CAR-T 8 días después de la estimulación (Día 8 de la expansión de los células T), cosechar las células del cultivo.
    2. Gire hacia abajo durante 5 min a 300 x g.
    3. Resuspender en medio de congelación a 10 millones de células por ml por vial en medio de congelación que consiste en 10% de sulfóxido de dimetil y 90% de suero bovino fetal.
    4. Congele en un recipiente de congelación para lograr una velocidad de enfriamiento de -1 oC/min en un congelador de -80 oC y luego transfiera a nitrógeno líquido después de 48 h.
    5. Antes de su uso para experimentos in vitro o in vivo, descongelar las células CAR-T en la MTC caliente.
    6. Lavar las células para diluir y eliminar el dimetil sulfóxido y resuspender a una concentración de 2 x 106 células/ml en TCM caliente. Descansar durante la noche a 37oC, 5% CO2.

2. Producción GM-CSF k/o CART19

  1. Para interrumpir gm-CSF, utilice un ARN guía (gRNA) dirigido al exón 3 de GM-CSF humano (CSF2) seleccionado a través de gRNAs de cribado previamente reportados para tener alta eficiencia para el gen CSF2 que codifica para el cytokine humano GM-CSF. 14
    NOTA: Se utilizó una construcción lentiviral Cas9 de tercera generación de grado de investigación sintetizada comercialmente que contiene este gRNA (bajo un promotor U6). La construcción contiene un gen de resistencia a la puromicina. La secuencia del ARNm es GACCTGCCTACAGACCCGCC. 12
  2. Para producir lentivirus, utilice células 293T que han alcanzado 70-90% de confluencia.
  3. Permitir 15 g del plásmido lentiviral de interés, 18 g de un vector de embalaje gag/pol/tat/rev, 7 g de un vector de envolvente VSV-G, 111 éL del reactivo precomplejo, 129 éL del reactivo de transfección y 9,0 ml del medio de transfección para incubar durante 30 minutos en la habitación mperatura.
  4. Agregue reactivos de transfección a las células 293T. A continuación, el cultivo a 37 oC, 5% CO2.
  5. Cosecha, centrífuga (900 x g durante 10 min), filtro (filtro de nylon de 0,45 oM) y sobrenadante concentrado a 24 y 48 h por ultracentrifugación a 13.028 x g para 18 h o 112.700 x g para 2 h y congelar a -80 oC para uso futuro.
  6. El día 1, resuspenda suavemente las células T para romper las rosetas.
  7. En un laboratorio aprobado por BSL-2+, agregue el virus congelado o recién cosechado a las células T estimuladas para generar células CAR-T. Transduce las células T con el lentivirus CAR19 y el GM-CSF dirigidos al lentivirus CRISPR. Añadir LENTIvirus CAR19 a un MOI de 3. Dado que la valoración del lentivirus CRISPR no era factible, utilice partículas de virus generadas a partir de una preparación de plásmido de 15 ug para transducir células T de 10 x 10 6.
  8. Vea los pasos restantes de estimulación, expansión y criopreservación de células T como se describe en el paso 1.
  9. Para las células T edificadas con lentiCRISPR que transportan resistencia a la puromicina, trate las células con dihidrocloruro de puromicina a una concentración de 1 g de puromicina por 1 ml el día 3 y el día 5.

3. Eficiencia de interrupción gm-CSF y evaluación funcional de GM-CSF k/o CART19

  1. Eficiencia de interrupción GM-CSF: seguimiento de indels por secuenciación y análisis de descomposición (TIDE)
    1. Para secuenciar el exón de interés en el gen GM-CSF, utilice las siguientes imprimaciones. Utilice una secuencia de imprimación directa para GM-CSF (CSF2) de TGACTACAGAGAGGCACAGA, y una secuencia de imprimación inversa de TCACCTCTGACCTCATTAACC.
    2. Extrae ADN de hasta 5 millones de células CAR-T con un kit de extracción genómica. Para la reacción de PCR, utilice 25 s de una mezcla maestra Taq por reacción con una concentración final de cada imprimación en la reacción de PCR de m, 0,1-0,5 g de ADN de la plantilla y un volumen total de la reacción de PCR que se trae hasta 50 l con agua libre de nucleasas.
    3. Consulte las condiciones de ciclo de PCR descritas en el Cuadro 1.
    4. Ejecuta muestras de PCR en un gel de agarosa del 1-2% a 100 V durante 30 min y extrae usando un kit de extracción de gel.
    5. Secuencia PCR amplicons. Calcule la frecuencia de modificación del alelo cargando datos sin procesar en un software TIDE adecuado. 15
  2. Producción de GM-CSF y evaluación funcional de GM-CSFk/o CART19
    1. Para determinar la producción de citoquinas de células CAR-T, incubar células de tipo silvestre CART19 y GM-CSFk/o CART19 con el CD19 que expresa la línea celular de leucemia linfoblástica aguda NALM6 en una proporción de 1:5 para 4 h a 37 oC, 5% CO2 en presencia de monensina CD49d antihumano, CD28 antihumano y CD107a antihumano.
    2. Cosecha células del cultivo para la citometría de flujo. Lave las células con tampón de citometría de flujo. Mancha las células con un kit de tinción vivo/muerto. Incubar en la oscuridad a temperatura ambiente durante 15 min. Fijar las células con un medio de fijación e incubar en la oscuridad a temperatura ambiente durante 15 min.
    3. Después del lavado, tense las células intracelularmente con medio de permeabilización en combinación con anticuerpo santi-humano IFN, anticuerpo monoclonal antihumano IFN, GM-CSF antihumano, MIP-1o antihumano, IL-2 antihumano y CD3 antihumano e incubar en la oscuridad durante 30 min. Lavar y resuspender las muestras. Adquirir muestras en un citómetro de flujo y analizar para el porcentaje de expresión GM-CSF intracelular.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La Figura 1 muestra la reducción de GM-CSF en células GM-CSFk/o CART19. Para verificar que el genoma de las células T fue alterado para noquear GM-CSF, se utilizó la secuenciación TIDE en las células GM-CSFk/o CART19 (Figura1A). La tinción de la superficie de la célula CAR-T verifica que las células T expresen con éxito el receptor de superficie CAR in vitro mediante la medición en células CD3+ vivas (Figura1B). La tinción intracelular de GM-CSF por citometría de flujo demuestra una disminución de la expresión de GM-CSF en células GM-CSFk/o CART19 mediante la medición de células CD3+ vivas, verificando el éxito funcional del knockout (Figura1C). Las células GM-CSFk/o CAR-T presentan una disminución de GM-CSF en comparación con las células CAR-T anti-CD19 de tipo salvaje (CART19) a través de la tinción intracelular (Figura1B). Además, hemos demostrado anteriormente que las células GM-CSFk/o CAR-T reducen la producción de GM-CSF al tiempo que mejoran la actividad antitumoral y la supervivencia en comparación con las células CAR-T de tipo salvaje in vivo. 12 

Paso Temperatura (C) hora Ciclos
Desnaturalización inicial 94 3 min 1
Desnaturalización 94 45 seg 35
Recocido 60 30 seg
Extensión 72 2 min
Post-elongación 72 10 min 1
4

Tabla 1: Condiciones de ciclo de PCR para la secuenciación TIDE de células GM-CSFk/o CART19.

Figure 1
Figura 1 : GM-CSFk/o Las células CART19 muestran una reducción en GM-CSF. A) Una secuencia TIDE representativa verifica la alteración del genoma de las células GM-CSF CRISPR/Cas9 GM-CSFk/o CART19 con una eficiencia de interrupción del -71%. B) Las gráficas de flujo representativas representan la producción exitosa de células CAR-T con una expresión CAR similar en el tipo salvaje CART19 y GM-CSFk/o CART19. C) Como se muestra mediante la tinción intracelular, las células GM-CSFk/o CART19 muestran una reducción de GM-CSF en comparación con el tipo silvestre CART19 cuando se estimula con la línea de células TODO positiva CD19 NALM6. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

En este informe, describimos una metodología para utilizar la tecnología CRISPR/Cas9 para inducir modificaciones secundarias en células CAR-T. Específicamente, esto se demuestra utilizando la transducción lentiviral con un vector viral que contiene gRNA dirigido al gen de interés y Cas9 para generar células GM-CSFk/o CART19. Anteriormente habíamos demostrado que la neutralización GM-CSF mejora el CRS y NT en un modelo de xenoinjerto. 12 Como se ha descrito anteriormente, las células GM-CSFk/o CAR-T permiten la inhibición de GM-CSF durante el proceso de fabricación, reducen efectivamente la producción de GM-CSF manteniendo otras funciones críticas de células T, y dan lugar a actividad antitumoral in vivo en comparación con las células CAR-T de tipo salvaje. 12

Dado que la integración permanente de Cas9 en el genoma podría asociarse con efectos no deseados cuando se traduce en un producto clínicamente viable, proponemos esta metodología específica como una forma de generar grado de investigación CRISPR/Cas9 modificado CART19 para prueba de concepto Experimentos.

Mientras que las células CAR-T prometen en la terapia contra el cáncer,1,2 su eficacia puede seguir mejorando y sus toxicidades asociadas mejor controladas. La tecnología CRISPR/Cas9 proporciona una estrategia para orientar directamente el genoma de las células CAR-T para diseñar soluciones a las deficiencias clínicas actuales. En este artículo, describimos la generación de células GM-CSFk/o CART19.

Las células GM-CSFk/o CAR-T fueron generadas por transducción con un vector lentiviral para el plásmido de células CAR-T y una construcción de lentivirus que contenía un ARN guía para GM-CSF y Cas9. Para generar el GM-CSFk/o, se utilizó una construcción de lentivirus de tercera generación (lentiCRISPRv2) que contiene Cas9 y un ARN guía de alta eficiencia (gRNA) reportado dirigido al exón 3 de GM-CSF humano (CSF2)14 bajo el control de un promotor U6. Se debe tener especial cuidado durante las etapas de transducción del procedimiento, ya que éstas son las más críticas para el desarrollo de las células CAR-T modificadas. La eficiencia de eliminatorias se puede verificar y evaluar mediante el seguimiento de indels por secuencias de descomposición (TIDE). La actividad funcional de las células CAR-T se investiga a través de la estimulación específica del antígeno de la construcción CAR con células diana CD19+, seguida de la medición de diferentes funciones de células T, incluyendo la producción de GM-CSF. 12 Tenga en cuenta que la tinción para la expresión CAR con un anticuerpo antiratón de cabra debe producirse antes de que se produzcan otras manchas de anticuerpos con dos lavados que se produzcan antes de la tinción superficial debido a que el fragmento de región variable de cadena única del CART19 es de origen del ratón. Este es un punto de énfasis en la resolución de problemas si no se observa inicialmente una buena expresión de CAR.

Estas células CAR-T modificadas se pueden utilizar en estudios in vitro y modelos de xenoinjerto in vivo para experimentos de prueba de concepto. Una ventaja de esta técnica es que la producción de células CAR-T y la manipulación genética pueden ocurrir en un solo paso con una buena eficiencia en comparación con otras técnicas. 10 , 11 Si bien la transducción lentiviral dual es un método conveniente y eficaz para generar células GM-CSFk/o CART19 de grado de investigación, el ADN se incorpora al genoma y la expresión prolongada de Cas9 puede desestabilizar el genoma y aumentar el riesgo de efectos fuera del objetivo. Una limitación de esta técnica es que los nocauts de grado de buenas prácticas de fabricación requerirían la modificación de la técnica a un sistema de ribonucleoproteína CRISPR/Cas9 ya que esta metodología no da lugar a la incorporación permanente de Cas9 en el genoma y reduce el potencial de efectos fuera del objetivo. La metodología descrita en el protocolo aquí se puede aplicar potencialmente a una variedad de genes para modificar genéticamente las células CAR-T a través de CRISPR/Cas9 para ayudar a generar células CAR-T menos tóxicas o más eficaces.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK es un inventor de patentes en el campo de la terapia de células T CAR que tienen licencia para Novartis (bajo un acuerdo entre Mayo Clinic, Universidad de Pensilvania y Novartis). Estos estudios fueron financiados en parte por una subvención de Humanigen (SSK). RMS, MJC, RS y SSK son inventores de patentes relacionadas con este trabajo. El laboratorio (SSK) recibe fondos de Tolero, Humanigen, Kite, Lentigen, Morphosys y Actinium.

Acknowledgments

Este trabajo fue apoyado a través de subvenciones de K12CA090628 (SSK), la Red Nacional Integral contra el Cáncer (SSK), el Centro Clínica Mayo para Medicina Individualizada (SSK), la Fundación Predolin (SSK), la Oficina de Traducción a la Práctica de Mayo Clinic (SSK) y el Programa de Capacitación de Científicos Médicos de Mayo Clinic Robert L. Howell Physician-Scientist (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics