Esplorare lo spazio di sequenza per identificare i siti di legame per le proteine di legame dell'RNA regolamentare

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La specificità della sequenza è fondamentale per la regolazione genica. Le proteine regolatorie che riconoscono sequenze specifiche sono importanti per la regolazione genica. La definizione di siti di legame funzionale per tali proteine è un problema biologico impegnativo. Un approccio iterativo per l'identificazione di un sito di legame per una proteina legante l'RNA è descritto qui ed è applicabile a tutte le proteine che legano l'RNA.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Singh, R. Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins. J. Vis. Exp. (150), e59635, doi:10.3791/59635 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La regolazione genica svolge un ruolo importante in tutte le cellule. Le fasi trascrizionali, post-trascrizionali (o elaborazione dell'RNA), traslazionali e post-traduzionale vengono utilizzate per regolare geni specifici. Le proteine geneagene-leganti specifiche della sequenza prendono di mira sequenze specifiche per controllare l'espressione genica spaziale o temporale. I siti di legame negli acidi nucleici sono tipicamente caratterizzati da analisi mutazionali. Tuttavia, numerose proteine di interesse non hanno un sito di legame noto per tale caratterizzazione. Qui descriviamo un approccio per identificare siti di legame precedentemente sconosciuti per le proteine che legano l'RNA. Si tratta di selezione iterativa e amplificazione delle sequenze a partire da un pool di sequenze randomizzato. Seguendo diversi cicli di questi passaggi-trascrizione, rilegatura e amplificazione- le sequenze arricchite sono sequenziati per identificare un sito di associazione preferito. Il successo di questo approccio è monitorato utilizzando saggi vincolanti in vitro. Successivamente, per valutare la rilevanza biologica delle sequenze selezionate è possibile utilizzare analisi funzionali in vitro e in vivo. Questo approccio consente l'identificazione e la caratterizzazione di uno o più siti di legame precedentemente sconosciuti per qualsiasi proteina legante all'RNA per la quale esiste un saggio per separare gli RNA legati alle proteine e non associati.

Introduction

Nella biologia cellulare, la regolazione genica svolge un ruolo centrale. A uno o più passaggi lungo il percorso di espressione genica, i geni hanno il potenziale per essere regolati. Questi passaggi includono la trascrizione (iniazione, allungamento e terminazione) così come lo splicing, la poliadenilazione o la formazione finale di 3' , l'esportazione dell'RNA, la traduzione di mRNA e il decadimento/localizzazione delle trascrizioni primarie. In questi passaggi, le proteine che legano l'acido nucleico modulano la regolazione genica. L'identificazione dei siti di legame per tali proteine è un aspetto importante dello studio del controllo genico. L'analisi mutazionale e il confronto della sequenza filogenetica sono stati utilizzati per scoprire sequenze normative o siti di legame proteico in acidi nucleici, come promotori, siti di giunzione, elementi di poliadenilazione e segnali traslazionali1, 2 Il nome del sistema , 3 (COM del nome , 4.

Lo splicing pre-mRNA è un passo fondamentale durante l'espressione e la regolazione genica. La maggior parte dei geni dei mammiferi, compresi quelli negli esseri umani, hanno introni. Una grande frazione di queste trascrizioni è alternativamente spliced, producendo più isoforme mRNA e proteine dallo stesso gene o trascrizione primaria. Queste isoforme hanno ruoli specifici delle cellule e di sviluppo nella biologia cellulare. Il sito di giunzione da 5' , il punto di rammarico e il sito di giunzione polipirina/3' sono segnali critici di giunzione che sono soggetti a regolamentazione. Nella regolazione negativa, un sito di giunzione altrimenti forte viene represso, mentre nella regolamentazione positiva viene attivato un sito di giunzione altrimenti debole. Una combinazione di questi eventi produce una pletora di isoforme funzionalmente distinte. Le proteine che legano l'RNA svolgono un ruolo chiave in questi eventi alternativi di giunzione.

Sono note numerose proteine i cui siti di legame o bersagli di RNA devono ancora essere identificati5,6. Collegare le proteine regolatorie ai loro bersagli o sequenze biologiche a valle è spesso un processo complesso. Per tali proteine, l'identificazione dell'RNA bersaglio o del sito di legame è un passo importante nella definizione delle loro funzioni biologiche. Una volta identificato, un sito di legame può essere ulteriormente caratterizzato utilizzando analisi molecolari e biochimiche standard.

L'approccio qui descritto presenta due vantaggi. In primo luogo, può identificare un sito di legame precedentemente sconosciuto per una proteina di interesse. In secondo luogo, un ulteriore vantaggio di questo approccio è che consente contemporaneamente la mutagenesi della saturazione, che altrimenti richiederebbe molta manodopera per ottenere informazioni comparabili sui requisiti di sequenza all'interno del sito di rilegatura. Così, offre uno strumento più veloce, più facile e meno costoso per identificare i siti di legame proteico nell'RNA. Originariamente, questo approccio (SELEX o evoluzione sistematica dei ligandi da arricchimento EXponential) è stato utilizzato per caratterizzare il sito di legame per la polioamerasi del DNA batteriophage T4 (proteina genica 43), che si sovrappone al sito di legame del ribosoma nel proprio mRNA. Il sito di associazione contiene una sequenza di loop a 8 basi, che rappresenta 65.536 varianti randomizzate per l'analisi7. In secondo luogo, l'approccio è stato utilizzato anche in modo indipendente per dimostrare che specifici siti di legame o aptamers per diversi coloranti possono essere selezionati da un pool di circa 1013 sequenze8. Infatti, questo approccio è stato ampiamente utilizzato in molti contesti diversi per identificare gli aptamers (sequenze di RNA o DNA) per legare numerosi ligandi, come proteine, piccole molecole e cellule, e per la catalisi9. Ad esempio, un aptamer può discriminare tra due derivati xanthine, caffeina e teofillina, che differiscono per la presenza di un gruppo metilico nella caffeina10. Abbiamo ampiamente usato questo approccio (SELEX o selezione iterativa-amplificazione) per studiare come funzionano le proteine che legano l'RNA nella regolazione dello splicing o dello splicing11, che sarà la base per la discussione qui sotto.

La libreria casuale: Abbiamo usato una libreria casuale di 31 nucleotidi. La considerazione della lunghezza per la libreria casuale era vagamente basata sull'idea che il fattore di giunzione generale U2AF65 si lega a una sequenza tra la sequenza di branch-point e il sito di giunzione 3'. In media, la spaziatura tra questi segnali di splicing nei metazoi è compresa tra 20-40 nucleotidi. Un'altra proteina Sex-lethal era nota per legarsi a una sequenza regolatore mal caratterizzata vicino al sito di giunzione 3' del suo pre-mRNA bersaglio, trasformatore. Così, abbiamo scelto una regione casuale di 31 nucleotidi, affiancata da siti di legame primer con siti di enzimi di restrizione per consentire l'amplificazione PCR e l'attaccamento del promotore di polimerasi t7 RNA per la trascrizione in vitro. La dimensione teorica della biblioteca o la complessità era di 431 o di circa 1018. Abbiamo usato una piccola frazione di questa libreria per preparare ilnostro pool di RNA casuale (1012-15 dollari) per gli esperimenti descritti di seguito.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTA: nella Figura 1 viene fornito un riepilogo dei passaggi chiave del processo iterativo di selezione-amplificazione (SELEX).

1. Generazione di un modello di libreria casuale

  1. Sintetizzare l'avanzata 5'- GTAATACGACTCACTCACTATAGGGTGATCAGATTGATCCA-3' e il primer inverso 5'- GCGACGGATCCAAGCTTCA-3' con la sintesi chimica su un sintetizzatore di DNA.
    NOTA: I primer e la libreria casuale possono essere sintetizzati commercialmente.
  2. Sintetizzare una libreria casuale oligonucleotide modello 5' - GGTGATCAGATTGATCTGATCCA(N1... N31)TGAAGCTTGGATCCGTCGC-3' per sintesi chimica. Utilizzare una miscela equimolare di quattro fosforamiditi durante la sintesi per le 31 posizioni randomizzate mostrate sopra come N.
    NOTA: la sequenza del modello di libreria contiene 31 nucleotidi casuali (da N1 a N31) e sequenze di fianco per l'associazione dei primer in avanti e inverso. Il primer in avanti include la sequenza promotrice di polimerasi dell'RNA T7 (sottolineata) per la trascrizione in vitro e un sito di restrizione Bcl1 (corsivo) per la clonazione. Il primer inverso contiene siti di enzimi di restrizione BamH1 e HindIII (corsivo) per facilitare la clonazione.

2. Generazione del pool della libreria casuale del DNA

  1. Attaccare il promotore di polimerasi T7 RNA alla libreria mediante reazione a catena di polimerasi (PCR) contenente 1 modello di libreria casuale di DNA M, 1 M di ogni primer, 20 mM Tris (pH 8.0), 1,5 mM MgCl2, 50 mM KCl, 0,1 g/sacetylated bovine serumin, 2 unità di Taq /c1> polimerasi, e 200 M ciascuno dei dNTP (deoxyguanosine, deoxyadenosine, deossicitidina e trefosfato deossithymidine).
  2. Utilizzare cinque cicli di denaturazione, annessione ed estensione (94 gradi centigradi per 1 min, 53 gradi centigradi per 1 min e 72 gradi centigradi per 1 min) di PCR seguiti da un ciclo di estensione (72 gradi centigradi per 10 minuti).

3. Sintesi della piscina 0 RNA

  1. Impostare una reazione di trascrizione di 100l112. Mix T7 buffer di trascrizione, 1 M di pool di libreria casuale DNA, 5 mM dithiothreitol (DTT), 2 mM guanosine tripofoshate (GTP), 1 mM ciascuno di adenosina trifosfato (ATP), trefosdo citidino (CTP), e urdine triposphate (UTP), e 2 unità/
    NOTA: l'RNA può essere trascritto in vitro utilizzando kit disponibili in commercio con un'opzione della polimerasi dell'RNA T7 o SP6.
  2. Incubare la miscela di reazione di cui sopra in un tubo di microcentrifuga per 2 h a 37 .
  3. Gel purifica l'RNA in un gel di poliacrilammide denatura al 10%.
  4. Identificare la posizione delle trascrizioni sul gel macchiandolo con blu di metilene o autoradiografia includendo tracce di radioattività (0,5 o meno di32P UTP) nella reazione di trascrizione.
    1. Mettere la fetta di gel in un tubo di centrifuga e rompersi in pezzi più piccoli, ad esempio, con una punta omogenea. Aggiungere il buffer di proteine K (PK) (100 mM Tris, pH 7,5, 150 mM NaCl, 12,5 mM EDTA, 1% solfato di sodismo di sodio) per immergere i pezzi di gel. Lasciare il tubo su un nutatore da 2 h a una notte a temperatura ambiente.
  5. Girare in una microcentrifuga ad alta velocità (14.000 rpm o 16.873 x g) per 5 min a temperatura ambiente per rimuovere i detriti gel e recuperare la soluzione buffer.
  6. Vorticare il campione due volte con un volume uguale di fenolo-cloroformio e una volta con cloroformio.
  7. Mescolare la fase acquosa dall'alto con un decimo di volume di acetato di sodio (3,0 M, pH 5,2), 10 g di tRNA o 20 g di glicogeno ed etanolo (2–3 volumi, conservati a -20 gradi centigradi). Lasciare i tubi a -80 gradi centigradi per 1 ora.
  8. Girare i tubi contenenti la soluzione per 5-10 min a 4 gradi centigradi in una microcentrifuga (14.000 giri/m o 16.873 x g). Scartate il super-natante con attenzione. Sciacquare accuratamente il pellet di RNA con il 70% di etanolo e spin per 2-5 min. Asciugare all'aria il pellet di RNA.
  9. Solubilizzare il pellet di RNA in 50 o l di acqua trattata con pirocarbonato dietilio (DEPC). Lasciare il campione a -20 gradi centigradi per lo stoccaggio.
    NOTA: Purificare l'RNA utilizzando colonne di spin disponibili in commercio, che sono attualmente più comunemente utilizzate per rimuovere la radioattività non incorporata e fungono da alternativa rapida e più conveniente per la purificazione dell'RNA.
    UTILITÀ: utilizzare uno scudo di vetro acrilico, guanti e altre precauzioni per proteggersi dalla radioattività.

4. Reazione di legame proteico e separazione dell'RNA legato

  1. Eseguire il legame di proteine e RNA in 10 mM Tris-HCl, pH 7,5 in un volume di 100 gradi aggiungendo i seguenti ingredienti a queste concentrazioni finali: 50 mM KCl, 1 mM DTT, 0,09 g di albumina di siero bovine, 0,5 unità/L RNasin, 0,15 g/tRNA , 1 mM EDTA, e 30 - L di adeguata concentrazione di proteine ricombinanti (PTB). Aggiungere l'RNA dalla piscina appropriata.
    NOTA: Il fattore di giunzione U2AF65 si lega tipicamente ai siti di giunzione polipirina-tratto/3' degli introni del modello con un'affinità di legame (costante di dissociazione di equilibrio o Kd) di circa 1–10 nM. Pertanto, i primi due cicli di legame hanno usato la concentrazione di proteine di 10 volte sopra il Kd per U2AF65; per le proteine SXL e PTB, la concentrazione iniziale in questa gamma era solo la nostra ipotesi migliore. Ciò ha garantito che le specie di RNA desiderate potessero legarsi, anche se anche le sequenze di affinità inferiore potrebbero essere potenzialmente legate. Nei round 3 e 4 (trascrizione, legame e amplificazione), la concentrazione proteica è stata ridotta di tre volte (Passo 4.1). Questo è stato fatto per eliminare successivamente le specie di RNA a bassa affinità.
  2. Posizionare i tubi contenenti le reazioni di legame per circa 30 min a 25 gradi centigradi in un blocco di temperatura (o sul ghiaccio).
  3. Frazionare l'RNA legato dall'RNA non legato per i primi 4 cicli di selezione-amplificazione utilizzando i seguenti passaggi.
    1. Filtrare il campione (100 ) a temperatura ambiente attraverso un filtro di nitrocellulosa attaccato a un collettore sottovuoto.
      NOTA: Il complesso RNA-proteina, ma non l'RNA non legato, rimane sul filtro.
    2. Tritare il filtro con RNA trattenuto in frammenti con una lama sterile di rasoio; inserirli in un tubo di centrifuga. Recuperare l'RNA facendo cadere delicatamente il tubo per un minimo di 3 h (o durante la notte) con i pezzi di filtro immersi nel buffer della proteinasi K (PK).
    3. Deproteinezza recibes se demintocare in presenza di un volume uguale di fenolo-cloroformio (1:1) e poi di cloroformio. Recuperare la fase acquosa ogni volta centrifugando il campione ad alta velocità per 5 min a temperatura ambiente.
    4. Mescolare con acetato di sodio (0,1 volume di 3,0 M, pH 5,2) e etanolo (2-3 volumi di etanolo assoluto, 200 prova). Lasciare il tubo in un congelatore a -80 gradi centigradi per 30 min, centrifugarlo ad alta velocità per 10 min e, seguendo le fasi di lavaggio e asciugatura (passaggio 3.8), solluvirizzare l'RNA in acqua trattata con DEPC. Questi passaggi sono descritti in precedenza (passaggi da 3.6 a 3.9).
  4. Separare le frazioni di RNA legate alle proteine dalle frazioni non legate per gli ultimi 2 turni (arrotondamenti 5 e 6; trascrizione, legame e amplificazione) come segue. Ridurre la concentrazione proteica nella reazione di legame (passo 4.1) di altre tre volte per aggiungere una pressione di selezione per arricchire le sequenze di legame ad alta affinità e rimuovere preferibilmente le sequenze a bassa affinità.
    1. Pre-cast di un gel di poliacrilamide nativo (5% con 60:1 acrilamide:bis-acrilamide ratio) in buffer TBE 0,5x (Tris-Borate-EDTA) prima di impostare la precedente reazione RNA:protein-binding (passaggio 4.1). Elettrophorese questo gel in una stanza fredda (4 gradi centigradi) applicando 250 V per 15 min.
    2. Pipette le reazioni di legame RNA:proteindi cui sopra (passaggio 4.1) in diversi pozzi di questo gel.
      NOTA: La proteina viene immagazzinata a -80 gradi centigradi e diluita prima dell'uso in 20 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), pH 8.0, 20% glicerolo, 0,2 mM di acido etilenediaminetracetraacetica (EDTA), 0,05% NP-40 e 1 mM dithiothreitol (DTT). L'aggiunta di 0,5–1,0 mM di inibitore del fenilmetano alito (PMSF) è opzionale. Nella reazione di rilegatura, questo buffer contribuisce circa 6% glicerolo, che consente il caricamento diretto di campioni nei pozzi senza la necessità di mescolarli con un buffer di caricamento gel separato.
    3. Frazionare l'RNA legato dall'RNA non legato utilizzando l'elettroforesi gel in una stanza fredda (4 gradi centigradi) a 250 V per 1 a 2 h. Questo processo è noto anche come analisi del cambio di mobilità del gel.
      NOTA: La durata dell'elettroforesi varia a seconda delle caratteristiche dell'RNA e delle proteine utilizzate per il legame.
    4. Esporre il gel su una pellicola a raggi X e identificare la posizione dell'RNA legato utilizzando l'autoradiografia. Tagliare la fetta di gel con l'RNA legato e inserirla in un tubo.
    5. Incubare la fetta di gel schiacciato nel buffer PK utilizzato per l'eluizione per 3 h o durante la notte.
    6. Ripetere i passaggi da 3.5 a 3.9 descritti in precedenza. In breve, vortice il campione di RNA eluito vigorosamente prima con fenolo-cloroformio e poi con cloroformina.
    7. Mescolare l'acetato di sodio e l'etanolo con la fase acquosa dopo l'estrazione del cloroformio. Dopo l'incubazione nel congelatore a -80 gradi centigradi, girare a 4 gradi centigradi per 5-10 min per raccogliere il pellet di RNA. Lavare il pellet di RNA con etanolo e asciugarlo all'aria lasciando il coperchio del tubo aperto. Sciogliere l'RNA in acqua trattata con DEPC.
      NOTA: il passaggio all'analisi del cambio di mobilità del gel per la frazione consente l'eliminazione di specie di RNA indesiderate che potrebbero essere state arricchite per legarsi, ad esempio, al filtro di nitrocellulosa qui (o a qualsiasi matrice) utilizzato nei turni iniziali per la frazione.

5. Trascrizione inversa e amplificazione PCR

  1. Sintetizza cDNA dall'RNA disciolto utilizzando la trascrizione inversa e l'innintore inverso incubando la reazione di 20 -L (2 -L di 10x RT Buffer, 2 -L di trascrizione inversa AMV, 1M inverso primer, 10 L di RNA, inibitore di RNase opzionale) a 42 gradi centigradi per 60 min.
  2. Amplificare il cDNA utilizzando 20-25 cicli PCR come descritto nel passaggio 2.1.

6. Trascrizione e rilegatura delle proteine

  1. Ripetere il processo di sintesi dell'RNA, legame proteico, separazione della proteina legata e frazione non legata, come descritto nella sezione 3-5 sopra.

7. Analisi delle interazioni RNA-proteina

  1. Utilizzare l'analisi del cambio di mobilità gel (passaggio 4.4) o l'analisi di associazione del filtro (passaggio 4.3) per determinare l'affinità e la specificità di legame per pool selezionati o singole sequenze all'interno di ogni pool (vedere il passaggio 8.3).
  2. Utilizzare l'autoradiografia o un imager fosforo per rilevare e quantificare le bande nella frazione legata e non associata.

8. Clonazione e sequenziamento

  1. Digerire il prodotto finale del DNA PCR con enzimi di restrizione Bcl1 e HindIII per 1–2 h, ligati con il pGEM3 opportunamente digerito o altri plasmidi che trasportano i siti di restrizione da 2 h a una notte, trasformare il prodotto di legazione in cellule batteriche competenti da shock termico o elettroporazione utilizzando procedure di biologia molecolare standard13.
  2. Coltiva i batteri durante la notte placcando le cellule trasformate su piastre di agar con il mezzo Luria-Bertani (LB) e l'ampicillina (50 g/mL) a 37 gradi centigradi. Raccogliere le colonie per inoculare i tubi di coltura contenenti il mezzo liquido LB con ampicillina e crescere a 37 gradi centigradi in un incubatore tremante durante la notte. Purificare i DNA plasmide contenenti inserti di DNA utilizzando un protocollo di isolamento plasmide standard13.
    NOTA: sono disponibili kit commerciali per la purificazione plasmida.
  3. Sequenziare i plasmidi con inserti di DNA utilizzando il protocollo di dideossia di terminazione della catena, seguendo le istruzioni del produttore per il sequenziamento14.
    NOTA: Il sequenziamento può essere eseguito in casa o in commercio.

9. Allineamento della sequenza

  1. Allineare le sequenze e ottenere uno o più siti di associazione del consenso utilizzando gli strumenti di allineamento online disponibili
    (https://www.ebi.ac.uk/Tools/msa/).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Le seguenti osservazioni dimostrano il successo della selezione-amplificazione (SELEX). In primo luogo, abbiamo analizzato la piscina 0 e le sequenze selezionate per il legame alla proteina utilizzata per l'approccio iterativo di selezione-amplificazione. La figura 2 mostra che la proteina legante polipirimidina-tratto mammifero (PTB) mostra un legame appena rilevabile alla sequenza 0 della piscina, ma un'elevata affinità per il pool di sequenze selezionato. C'era un legame appena rilevabile alla piscina 0 quando abbiamo usato una concentrazione proteica superiore di circa 300 volte per il legame rispetto a quella utilizzata per la piscina selezionata. Così, c'era almeno un centinaio di volte differenza nelle affinità di legame proteico tra la piscina casuale o iniziale e la piscina selezionata. Questa osservazione conferma sperimentalmente che il protocollo di selezione-amplificazione qui descritto ha esito positivo.

In secondo luogo, abbiamo sequenziato il pool selezionato e determinato un sito di associazione di consenso. La sequenza di consenso ottenuta dall'allineamento della maggior parte delle sequenze selezionate dal pool selezionato dal PTB dei mammiferi è stata: GCCUG(Y/G)UGCYYYYYYYG(Y/G)CCC. Questo dimostra che abbiamo selezionato sequenze uniche ricche di pirimine che legano PTB11. Quando abbiamo eseguito la selezione iterativa-amplificazione per il dominio di legame dell'RNA del PTB di Drosophila, abbiamo arricchito sequenze ricche di CU interrotte dalle guanosine. Tra le sequenze ad alta affinità selezionate dal PTB della Drosophila c'era una sequenza ricca di pirimidine dell'84%: GCUUUCCUCUGUCGCCUCUCUCGUCCCCUGUG. Infatti, questa sequenza è simile alla sequenza ricca di pirimine presente nell'intron alfa-tropomiosina che si lega con alta affinità ed è regolata dal mammifero PTB15. Abbiamo utilizzato con successo questo approccio ripetutamente per studiare le proprietà di legame dell'RNA e le funzioni dei regolatori di giunzione e un fattore di giunzione11,15,16. La tabella 1 mostra esempi di successo di proteine che legano l'RNA per le quali SELEX è stato utilizzato per identificare i loro siti di legame preferito o di consenso.

In terzo luogo, un saggio di giunzione in vitro, che si basa sulla scelta alternativa del sito di giunzione 3', mostra una rilevanza funzionale di specificità distinti ma sovrapposte di legame dell'RNA delle proteine leganti polipirimide del tratto. Mentre un sito di giunzione upstream 3' viene utilizzato per impostazione predefinita, l'aggiunta del PTB ricombinante porta all'attivazione del sito di giunzione alternativo o a valle 3' (Figura 3). Al contrario, l'aggiunta di hnRNP C17 ricombinante porta alla repressione di entrambi i siti di giunzione 3'. L'aggiunta del fattore di giunzione generale ricombinante U2AF65 inverte la repressionedel sito di giunzione 3' mediata da hnRNP C1, nonché l'effetto mediato dal PTB sull'attivazione del sito di giunzione a valle 3' (dati non mostrati). Una semplice spiegazione di questi effetti è una concorrenza diretta tra il legame del fattore di giunzione generale U2AF65 e PTB (chiamato anche hnRNP I), che si lega preferibilmente e reprime alcuni siti di giunzioni 3', o tra U2AF65 e hnRNP C, che si lega e reprime entrambi i siti di giunzione 3'.

Figure 1
Figura 1: Riepilogo dei passaggi chiave del processo di selezione-amplificazione iterativo (SELEX). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Arricchimento degli RNA legati al PTB. L'aumento della concentrazione (triangoli riempiti) di PTB ricombinante è stato utilizzato sia con piscina radioetichettata 0 RNA o la piscina selezionata ottenuta dopo sei cicli di selezione e amplificazione. Sono indicate posizioni di RNA non legato e complesso di proteine: Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Il test di commutazione del sito Splice convalida le specificità distintiche delle proteine che legano la pirimidine. (A-Top) Schemi del substrato di giunzione. Il substrato di giunzione contiene un sito di giunzione di 5' e due siti di giunzione alternativi a fianco dell'intron. I rettangoli (aperti, con linee orizzontali e solidi) sono esoni e la linea è un intron. (A-Bottom) hnRNP C1 reprime il sito di giunzione upstream 3' (senza attivazione del sito di giunzione a valle 3'), mentre PTB porta all'attivazione del sito di giunzione downstream 3'. Il substrato di splicing è stato incubato in un estratto nucleare a cellule HeLa. I prodotti di giunzione (mostrati ai lati) sono stati analizzati utilizzando un'estensione del primer18 con primer giunzione (frecce), che riconoscono lo splicing del comune sito di giunzione 5' al sito di giunzione a monte o a valle 3'. (B) Il ricombinante U2AF65 (rU2AF65) inverte l'effetto repressivo di hnRNP C1. L'aggiunta delle proteine hnRNP C1, PTB o rU2AF65 ricombinanti alla reazione di giunzione è indicata dai simboli . Fare clic qui per visualizzare una versione più grande di questa figura.

proteina Sequenza/e preferita/e
U2AF65 Ricco di U contenente Cs
Sxl Ricco di U contenente 2-4 Gs
Ptb UCUUC ricco di alcuni Gs
hnRNP C1 Ricco di U (5-6 lungo)
CstF64 Ricco di GUI
hnRNP E1/E2 e K Ricco di C
U2AF65/U2AF35 eterodirico UUUYYYYAUNAGUGU

Tabella 1: Siti di legame preferiti per alcune proteine che legano l'RNA.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le proteine che legano gli acidi nucleici sono importanti regolatori dello sviluppo animale e vegetale. Un requisito fondamentale per la procedura SELEX è lo sviluppo di un saggio che può essere utilizzato per separare le frazioni di RNA legate alle proteine e non legate. In linea di principio, questo saggio può essere un saggio in vitro vincolante come l'analisi di legame filtrante, l'analisi del cambio di mobilità del gel o un saggio di legame di matrice19 per proteine ricombinanti, proteine purificate o complessi proteici. Il saggio può anche essere un saggio enzimatico in cui i precursori e i prodotti (o intermedi) possono essere separati in base alle dimensioni o ad altri mezzi20.

Mentre la mutagenesi è stata ampiamente utilizzata per caratterizzare i siti di legame per le proteine, è laboriosa e le sequenze che richiedono molto tempo e più lunghe non sono così facilmente suscettibili alla mutagenesi della saturazione. L'importanza dell'approccio iterativo di associazione e amplificazione descritto qui è che non solo supera alcune delle limitazioni di cui sopra, ma può soprattutto identificare i siti di associazione precedentemente sconosciuti e fornire informazioni importanti su requisiti nucleotidi in ogni posizione allo stesso tempo.

Una considerazione importante per il successo della selezione iterativa-amplificazione è l'affinità e la specificità vincolanti. Tipicamente, vengono impiegati da 12 a 15 cicli di selezione-amplificazione e uno spazio di sequenza di 10 12-1015 molecole può essere regolarmente campionato. L'avanzamento e l'eventuale successo del protocollo di selezione-amplificazione possono essere monitorati utilizzando un saggio di rilegatura o un sequenziamento diretto, che monitora rispettivamente l'affinità o l'arricchimento di sequenze specifiche in pool intermedi. Mentre il saggio vincolante è stato tradizionalmente utilizzato, l'avvento del sequenziamento di nuova generazione consente l'analisi dell'arricchimento della sequenza in modi non possibili dal sequenziamento manuale Sanger14.

Un passo fondamentale nel successo di SELEX è l'arricchimento delle molecole desiderate ad ogni passo. Il numero di cicli necessari per SELEX varia e dipende da diversi fattori. Ad esempio, se l'arricchimento delle pieghe delle sequenze desiderate o specifiche è più alto in ogni round, sarà sufficiente un numero inferiore di round. Tuttavia, se un analisi consente un'alta percentuale di sequenze indesiderate nel pool legato, saranno necessari ulteriori round per arricchire le sequenze di RNA desiderate. Una limitazione della tecnica o una conseguenza involontaria della necessità di ulteriori cicli di selezione-amplificazione che devono essere tenuti a mente è la possibilità che possa introdurre artefatti o arricchire sequenze che hanno proprietà non correlate come la loro capacità di amplificare. Infine, mentre alcune applicazioni traggono vantaggio dai leganti di affinità più elevati, per altri usi, è necessario trovare un equilibrio durante il processo di selezione-amplificazione tra affinità di legame e funzione, poiché le sequenze di rilegatura più strette potrebbero non essere necessariamente le sequenze più funzionali in contesti biologici (ad esempio, se una sequenza viene riconosciuta più volte da proteine diverse durante lo splicing).

Tra le modifiche e la risoluzione dei problemi per migliorare la procedura, la selezione negativa o la selezione contatore può essere impiegata per aumentare la specificità. Analogamente, l'uso di diversi protocolli di partizionamento, come l'analisi di binding del filtro seguita dall'analisi del cambio di mobilità del gel, può eliminare l'arricchimento di sequenze indesiderate che legano, ad esempio, al filtro di nitrocellulosa o a una matrice di colonna21. Dato che le interazioni proteina-acido nucleico hanno componenti specifici e non specifici, condizioni di tampone come sale e pH hanno effetti sulle interazioni RNA-proteina. Inoltre, l'uso di un'adeguata concentrazione proteica può avere un effetto diretto sulla ritenzione di leganti forti, deboli e non specifici. La pressione di selezione può essere aumentata nei turni successivi, ad esempio, includendo un RNA concorrente, riducendo la concentrazione di proteine o riducendo il tempo di incubazione. Pertanto, considerazioni accurate e l'ottimizzazione di questi parametri possono influenzare il risultato del protocollo SELEX.

Recentemente, molte variazioni o modifiche del protocollo SELEX originale sono state sviluppate che superano alcune delle limitazioni di cui sopra. Questi includono l'alta produttività-SELEX (HT-SELEX), che combina SELEX e sequenziamento massicciamente parallelo6, RNAcompete, che comporta l'incubazione con l'eccesso di RNA non casuale, l'abbattimento dell'RNA legato, l'etichettatura fluorescente dell'RNA e l'analisi microarray5, RNA Bind-n-Seq, che combina l'analisi dell'affinità dell'RNA in un ciclo quantitativo e ad alta produttività22e RAPID-SELEX, che accorcia il processo e include una fase di non amplificazione23.

Basi modificate chimicamente sono state utilizzate per espandere il repertorio delle molecole di RNA per applicazioni specifiche24. Diagnostica, terapie, così come le molecole con attività catalitiche sono tra le molte applicazioni (anche in medicina) delle molecole selezionate25. Gli aptamers completano protocolli basati su anticorpi e forniscono strumenti eccellenti il cui potenziale, ad esempio, nella diagnostica, terapeutica e altre applicazioni, rimane da sfruttare appieno26,27,28. In futuro, ad esempio, i benefici clinici sono tra le numerose applicazioni desiderate, al di là di ciò che il primo aptamer approvato dalla FDA (Pegaptanib sodium) potrebbe fornire per la degenerazione maculare legata all'età. La tecnologia proteomica scalabile per la misurazione delle proteine offre un passo verso la comprensione della salute e delle malattie24.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

L'autore dichiara di non avere interessi finanziari concorrenti.

Acknowledgments

L'autore ringrazia i National Institutes of Health per i finanziamenti passati.

Materials

Name Company Catalog Number Comments
Gel Electrophoresis equipment Standard Standard
Glass Plates Standard Standard
Nitrocellulose Millipore HAWP
Nitrocellulose Schleicher & Schuell PROTRAN
polyacrylamide gel solutions Standard Standard
Proteinase K NEB P8107S
Recombinant PTB Laboratory Preparation Not applicable
Reverse Transcriptase NEB M0277S
Vacuum manifold Fisher Scientific XX1002500 Millipore 25mm Glass Microanalysis Vacuum Filter
Vacuum manifold Millipore XX2702552 1225 Sampling Vacuum Manifold
X-ray films Standard Standard

DOWNLOAD MATERIALS LIST

References

  1. Pribnow, D. Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. Proceedings of the National Academy of Sciences of the United States of America. 72, (3), 784-788 (1975).
  2. Breathnach, R., Chambon, P. Organization and expression of eucaryotic split genes coding for proteins. Annual Review of Biochemistry. 50, 349-383 (1981).
  3. Wickens, M., Stephenson, P. Role of the conserved AAUAAA sequence: four AAUAAA point mutants prevent messenger RNA 3' end formation. Science. 226, (4678), 1045-1051 (1984).
  4. Kozak, M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research. 15, (20), 8125-8148 (1987).
  5. Ray, D., Ha, K. C. H., Nie, K., Zheng, H., Hughes, T. R., Morris, Q. D. RNAcompete methodology and application to determine sequence preferences of unconventional RNA-binding proteins. Methods. 118, 3-15 (2017).
  6. Jolma, A., et al. Multiplexed massively parallel SELEX for characterization of human transcription factor binding specificities. Genome Research. 20, (6), 861-873 (2010).
  7. Tuerk, C., Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. 249, (4968), 505-510 (1990).
  8. Ellington, A. D., Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature. 346, (6287), 818-822 (1990).
  9. Cowperthwaite, M. C., Ellington, A. D. Bioinformatic analysis of the contribution of primer sequences to aptamer structures. Journal of Molecular Evolution. 67, (1), 95-102 (2008).
  10. Jenison, R. D., Gill, S. C., Pardi, A., Polisky, B. High-resolution molecular discrimination by RNA. Science. 263, (5152), 1425-1429 (1994).
  11. Singh, R., Valcarcel, J., Green, M. R. Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science. 268, (5214), 1173-1176 (1995).
  12. Milligan, J. F., Uhlenbeck, O. C. Synthesis of small RNAs using T7 RNA polymerase. Methods in Enzymology. 180, 51-62 (1989).
  13. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular Cloning. Cold Spring Harbor Laboratory Press. New York. (1989).
  14. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  15. Robida, M., Sridharan, V., Morgan, S., Rao, T., Singh, R. Drosophila polypyrimidine tract-binding protein is necessary for spermatid individualization. Proceedings of the National Academy of Sciences of the United States of America. (2010).
  16. Banerjee, H., Rahn, A., Gawande, B., Guth, S., Valcarcel, J., Singh, R. The conserved RNA recognition motif 3 of U2 snRNA auxiliary factor (U2AF(65)) is essential in vivo but dispensable for activity in vitro. RNA. 10, (65), 240-253 (2004).
  17. Gorlach, M., Burd, C. G., Dreyfuss, G. The determinants of RNA-binding specificity of the heterogeneous nuclear ribonucleoprotein C proteins. J Biol Chem. 269, (37), 23074-23078 (1994).
  18. Valcarcel, J., Singh, R., Zamore, P. D., Green, M. R. The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. Nature. 362, (6416), 171-175 (1993).
  19. Wilson, C., Szostak, J. W. Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & Biology. 5, (11), 609-617 (1998).
  20. Joyce, G. F. Reflections of a Darwinian Engineer. Journal of Molecular Evolution. 81, (5-6), 146-149 (2015).
  21. McKeague, M., Derosa, M. C. Challenges and opportunities for small molecule aptamer development. Journal of Nucleic Acids. 2012, 748913 (2012).
  22. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Molecular Cell. 54, (5), 887-900 (2014).
  23. Szeto, K., et al. RAPID-SELEX for RNA aptamers. PLoS One. 8, (12), e82667 (2013).
  24. Rohloff, J. C., et al. Nucleic Acid Ligands With Protein-like Side Chains: Modified Aptamers and Their Use as Diagnostic and Therapeutic Agents. Molecular Therapy - Nucleic Acids. 3, e201 (2014).
  25. Gold, L., et al. Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS One. 5, (12), e15004 (2010).
  26. Zhuo, Z., et al. Recent Advances in SELEX Technology and Aptamer Applications in Biomedicine. International Journal of Molecular Sciences. 18, (10), (2017).
  27. Blind, M., Blank, M. Aptamer Selection Technology and Recent Advances. Molecular Therapy. Nucleic Acids. 4, e223 (2015).
  28. Jijakli, K., et al. The in vitro selection world. Methods. 106, 3-13 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics