حقن داخل الصفاق لدراسة القلب البالغ زبرافيش

Biology
 

Summary

يعتمد هذا الأسلوب علي حقن 0.5 − 3 μL من محلول في الصدر من zebrafish الكبار. الاجراء بكفاءة يسلم البروتينات والمركبات الكيميائية في القرب من القلب الزبرافيش دون الاضرار الجهاز. هذا النهج هو مناسبه لاختبار اثار العوامل الخارجية علي انسجه مختلفه من القلب.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

يوفر القلب الزبرفيش البالغ نموذجا قويا في أبحاث تجديد القلب. وعلي الرغم من ان قوه هذا النظام تستند إلى نهج محوره وراثيا ، فان التسليم السريع للعوامل الخارجية يوفر تقنيه تكميليه في الدراسات الوظيفية. هنا ، نقدم طريقه تعتمد علي أداره بضعة ميكروليتر من المحلول في تجويف التامور دون التسبب في تلف عضله القلب. حقن داخل الجسم (IT) يمكن ان تقدم بكفاءة البروتينات والمركبات الكيميائية مباشره علي سطح القلب. تنتشر المواد المحقونة من خلال الخلايا القلبية في انسجه القلب الاساسيه. المقارنة مع حقن الملكية الفكرية (IP) ، فان الميزة الرئيسية للحقن داخل الجسم هي الاداره المركزية للعوامل المختبرة علي الجهاز المستهدف. تسليم الجزيئات مباشره في التامور هو استراتيجية مناسبه للدراسات القلبية المسبقة والتجديد في zebrafish الكبار.

Introduction

بين الفقاريات ، وتمتلك الزرد قدره ملحوظة لتجديد قلوبهم1،2. وقد تم الإبلاغ عن هذه القدرة في عده نماذج الاصابه ، وهي استئصال قمة البطين ، كريوينجوري (CI) والوراثية عضله الاجتثاث3،4،5،6،7. بعد الإصابات الغازية ، يصبح الجدار التالف من البطين شفي بشكل عابر من قبل الانسجه الليفية ، والتي يتم استبدالها تدريجيا بعضله الام الجديدة8،9،10،11. العلاج المبكر للتئام الجروح ينطوي علي تنشيط الخلايا المناعية وتجنيدها12،13،14،15. في السياق المتزامن ، عضلي بالقرب من عضله الام المصابة تصبح نشطه ، والتفريق ، وتتكاثر وتدريجيا استبدال المنطقة المصابة في غضون 30 − 90 يوما16،17،18، 19. تم تحقيق تقدم كبير في فك رموز أليات الجزيئية والخلوية لتجديد القلب بفضل توافر الاداات الجينية ، مثل تحليل تتبع سلاله الخلية ، والتعبير المفرط الجينات المحرض ، خطوط مراسل الانسجه الفلورية ، و crispr/كاس 9 الجينات الطفرة20،21.

لقد انشانا مؤخرا نموذجا لتكييف القلب في البالغ الزرد بواسطة بضع الصدر22،23. التكييف يزيد من التعبير عن الجينات الواقية للقلب ويرفع أعاده الدخول إلى دوره الخلية في القلوب السليمة والمجددة. وترتبط هذه العمليات مع تجنيد الخلايا المناعية وأعاده عرض مصفوفة22,24. واليات الخاصة بالتكييف غير مفهومه علي نحو رديء ، ويلزم إنشاء تقنيات جديده لتعزيز مجال البحث هذا. وعلي وجه الخصوص ، فان الاداره المثلي للبروتينات التي تفرز الإشارات أو المركبات الكيميائية الأخرى ضرورية لمواصله التحقيق في هذا الموضوع.

كونها الحيوانية المائية ، الزرد يمكن بطبيعة الشكل امتصاص المواد المختلفة المذابة في الماء من خلال الخياشيم والجلد. وهذا يوفر امكانيه لتسليم المخدرات غير الغازية من خلال غمر الأسماك في الحلول مع المواد الكيميائية المتنوعة, مثل مثبطات الدوائية, هرمونات الستيرويد, تاموكسيفين, BrdU والمضادات الحيوية. في الواقع ، العديد من الدراسات من مختبرات مختلفه ، بما في ذلك لنا25،26،27، استفادت من هذه الطريقة ، والتي هي ذات قيمه خاصه في مجال الاحياء التجديدية6، 28. هذا النهج ، ومع ذلك ، ليست مناسبه لتسليم الببتيدات ، الحمض النووي ، RNA ، مورفولينوس أو جزيئات مع نفاذيه الانسجه محدوده. في هذه الحالات ، يتم تحقيق تسليم أكثر كفاءه عن طريق الحقن المجهري في الجسم ، علي سبيل المثال ، عن طريق إدخال الشعرية في الجيوب الوريدية المدارية الرجعية ، في تجويف داخل الصفاق أو داخل الصفاق29،30، 31- هنا ، ونحن وصف اجراء حقن داخل النظام الداخلي لكميه صغيره من الحل ، كطريقه مناسبه لدراسة تجديد القلب والمسبق في zebrafish الكبار.

Protocol

تمت الموافقة علي الرعاية الحيوانية وجميع الإجراءات الحيوانية الموصوفة في البروتوكول التالي من قبل مكتب البيطرية كانتون فريبورغ ، سويسرا.

1. أدوات وحلول للحقن

  1. سحب الحقن المجهري-تكييفها الشعيرات الدموية الزجاج بوروسيليكات باستخدام ساحبه ابره وفقا لشكل 1A. متجر سحبت الشعيرات الدموية في طبق بيتري 9 سم مع القضبان من الطين النمذجة أو شريط لاصق.
  2. باستخدام مقص المشتركة ، وقطع قطعه من الإسفنج (7 سم × 3 سم × 1 سم) ونحت صوره ظليه مثل الأسماك في وسطها.
  3. اعداد الارصفه الصغيرة من محلول الحقن مع البروتينات المختبرة أو غيرها من المركبات. ضبط تركيزها بالتبعية علي الفحص عن طريق تمييع المادة في 1x هانكس محلول الملح متوازن (HBSS) تستكمل مع 10 ٪ الفينول الأحمر.
    ملاحظه: هنا ، كان تركيز البروتين المختبر 100 نانوغرام/مل.
  4. لاعداد حل الأسهم من التخدير tricaine المخزنة ، تذوب 4 غرام من tricaine في 980 مل من الماء المقطر. ضبط درجه الحموضة إلى 7.0 − 7.4 باستخدام 1 M تريس-HCl pH 9 ، وتملا مع الماء إلى 1,000 مل. تخزين الحل في الظلام في 4 ° c.
  5. للحصول علي تركيز العمل من التخدير ، أضافه 1 − 2 مل من محلول الأسهم tricaine إلى 50 مل من مياه السمك في الكاس.
    ملاحظه: وينبغي اعداد تركيز العمل من التخدير tricaine طازجه قبل الاستخدام.

2. اعداد محطه الحقن

  1. قم بتشغيل المجسم الفراغي مع الضوء من الأعلى واضبط التكبير علي 16x.
  2. نقع الإسفنج مع ماء السمك ، وضعه علي طبق بيتري 9 سم علي مرحله المجهر وضبط التركيز.
  3. تحت المجسمة ، وقطع نهاية ميكروشعري في ~ 7 ملم من الأساس باستخدام مقص الزائدة الدودية كما هو مبين في الشكل 1A. وقطر غيض المثالي يكون ~ 20 μm.
    ملاحظه: قطع غيض من الشعرية بطريقه منحرف هو الأمثل لعمليات الادراج في الانسجه.
  4. ادخل الشعيرات الدقيقة في حامل الابره لجهاز الحقن المجهري.
  5. باستخدام تلميحات اللودر الصغير ، قم بتحميل حل تحكم (علي سبيل المثال ، 1x HBSS) لاعداد ضغط الحقن ، من أجل الحصول علي التدفق المناسب الذي يتراوح بين 0.3 μL/s و 0.5 μL/s. إفراغ الابره.
  6. تحميل وحده التخزين المحددة من محلول الحقن (علي سبيل المثال ، عامل التغذية العصبية الهدبيه [CNTF] المخفف في 1x HBSS) في غيض من الشعرية (الشكل 1X). يجب ان يكون هناك اي فقاعه الهواء في الشعرية.
    ملاحظه: يعتمد الحجم الأقصى لمحلول الحقن علي حجم السمكة. لمده قياسيه من 2.5 − 3 سم (المسافة من الخطم إلى العم الذيليه) ، والحد الأقصى لحجم الحقن الذي يمنع تورم الصدر ذلك والنزيف وقد تقرر ان يكون 5 μl (الشكل 1f). ويمكن حقن كميات أكبر من الأسماك أكبر.

3. اعداد الأسماك للحقن داخل الصفاق

  1. قبض علي الزرد الكبار (danio rerio) مع صافي ونقله إلى محلول التخدير.
  2. بعد 1 − 2 دقيقه ، عندما توقف الأسماك السباحة ويتم تقليل حركه غطاء الخيشومي ، لمس الأسماك مع ملعقة بلاستيكية للتاكد من انها لا تتفاعل مع اي اتصال.
  3. بسرعة وبعناية نقل الأسماك مع ملعقة في الأخدود من الإسفنج الرطب ، مع الجانب البطني حتى. يجب ان يشير رئيس السمكة بعيدا عن الجهة المهيمنة للمشغل.

4. الحقن المجهري في غشاء التامور

  1. تحت المجسم ، راقب بعناية حركه القلب النابض تحت جلد السمكة. بصريا تحديد نقطه الحقن فوق القلب النابض وفي منتصف المثلث المحدد من قبل الصفائح الغضروفية البطنية (الشكل 1D). ادراج غيض من الشعرية في 30 − 45 درجه درجه زاوية نسبه إلى محور الجسم (الشكل 1E). تخترق برفق الجلد مع غيض من ميكروشعري في التامور (الشكل1C). نقطه الدخول المثلي أقرب إلى البطن من الراس.
    ملاحظه: لا تقم بإدخال الشعرية عميقا جدا في الجسم والقلب ، لان هذا سوف يسبب أصابه للجهاز. في حاله ثقب القلب ، تملا الابره عموما بالدم. إذا حدث هذا ، أزاله الشعرية واستبعاد الأسماك من التجربة.
  2. بمجرد ان الابره داخل التامور ، والحقن الكامل عن طريق الضغط علي دواسة الجهاز ميكروحاقن.
    ملاحظه: يجب الحرص علي عدم ضخ الهواء في التجويف الصدري.
  3. بعد الحقن ، برفق سحب الشعرية من الصدر ونقل الأسماك علي الفور إلى خزان مع نظام المياه للانتعاش.
  4. مراقبه الأسماك حتى الشفاء التام من التخدير.
  5. جمع القلب في الوقت المطلوب نقطه واعداده لمزيد من التحليل.
    ملاحظه: في حاله الأسماك لا تستانف حركه الغطاء الخيشومي في غضون 30 ثانيه ، وأعاده تحريك الأسماك عن طريق الضغط علي المياه في الخياشيم مع ماصه بلاستيكية.

Representative Results

بعد حقن داخل الصفاق (IT) ، يمكن تحليل اثار الحل الخارجي. ولهذا الغرض ، ينبغي ان رحيم الأسماك وان تجمع القلوب ، وان تكون ثابته ومختبره ، وفقا للبروتوكولات المنشورة سابقا32،33.

للتحقق من صحة الأسلوب ، قمنا أولا باجراء تجربتين اختباريين عن طريق حقن اللون والاصباغ الفلورية. أولا ، نحن رحيم الأسماك وبعد الوفاة حقن 3 μL من الحبر في الصدر. تم جمع القلوب بعد 5 دقائق ، وغسلها في الفوسفات-مخزنه المالحة (تلفزيوني) ، الثابتة في 2 ٪ formalin ، غسلها في التلفزيونية وتصويرها تحت المجهر. الثانية ، ونحن حقن 3 μL من 1 ميكروغرام/مل 4 ′ ، 6-diamidino-2-فينيلانديول (DAPI) في فيفو ، وإصلاح القلب بعد 2 ساعة. وفي كلا الاختبارين ، كشف تحليل التركيب بالبالكامل عن وسم القلب بأكمله بما في ذلك البطين والأذين والشرايين الشريانية (الشكل 2 ا، ب). تكشف هذه النتائج عن انتشار فعال للحل المحقون علي سطح القلب.

وهناك بروتوكول مشترك لتسليم المواد الخارجية إلى الأسماك البالغة هو حقن داخل العين (IP). لمقارنه ملاءمة تكنولوجيا الوصول الكتروني مقابل حقن الملكية الفكرية لدراسات القلب ، قمنا بحقن كميه مماثله من DAPI باستخدام كلا الأسلوبين وإصلاح القلوب بعد 5 دقائق و 120 دقيقه (الشكل 3A). وقد اومات القلوب وملطخه phمسبوكه اليكسا فلور (AF) 568 التي تسمي F-actin في عضله القلب. لم يلاحظ وجود خلايا موجبه لل DAPI في القلوب بعد حقن IP في كلا النقطتين الزمنيين (الشكل 3 ب). علي النقيض من ذلك ، ادي حقن تكنولوجيا المعرفة في وجود نوى DAPI المسمي في عضله الام (الشكل 3B). وتبين هذه النتائج ان حقن تكنولوجيا النقل تحسين تسليم المركب إلى القلب ، بالمقارنة مع حقن الملكية الفكرية.

لاختبار مدي ملاءمة هذه الطريقة لدراسات تجديد القلب ، ونحن كريوينجوريد البطينين8، وأجريت حقن تكنولوجيا المعرفة من 3 μl من 1 ميكروغرام/مل dapi و 1 ميكروغرام/مل phخلائط IDIN AF649 في 3 و 7 أيام بعد الكريوينجوري (dapi) (الشكل 4a). في 1 ح بعد الحقن ، تم جمع القلوب ، ثابته ، مقسمه وملطخه مع phسبائك AF568 لتصور عضله القلب سليمه. وجدنا ان كل من عضله القلب والانسجه المصابة تحتوي علي العديد من الخلايا الايجابيه DAPI ، مما يدل علي اختراق فعال لهذه الصبغة في القلوب السليمة والانسجه الليفية (الشكل 4B). وعلاوة علي ذلك ، فان حقن الفيفيبين AF649 أدرج أيضا من قبل عضلي المنطقة المحيطة بالاصابه وبعض الخلايا الليفية المجندة في المنطقة المصابة. وتكشف هذه التجربة ان المخدرات يمكن ان تعبر الابيارديوم وتخترق عضله الأعماق الكامنة.

بعد اختبار كفاءه حقن تكنولوجيا الطاقة باستخدام الاصباغ ، حللنا اثار البروتينات المحقونة علي القلب. نحن المتزامنة السايسيسيني ، ودعا cntf ، الذي هو اوبريجولاتيد بعد بضع الصدر24. حققنا في اثار CNTF الخارجية علي عمليات مختلفه ، وهي الانتشار عضله ، ترسب مصفوفة خارج الخلية ، وتجنيد الخلايا المناعية والتعبير الجيني القلبية. وجدنا ان كل هذه الجوانب البيولوجية تم تنشيطها بواسطة حقن تكنولوجيا الكربون CNTF ، بالمقارنة مع السيطرة الغلوبولين المناعي (الشكل 5)24. وتبين هذه النتائج ان طريقه الحقن داخل الجسم توفر استراتيجية مناسبه للتسليم المستهدف للبروتينات لدراسة اثارها علي انسجه القلب المتميزة في مجموعه متنوعة من الاختبارات.

Figure 1
الشكل 1: حقن داخل الصورة (IT) في البالغين. (ا) صوره لحقنه مجهريه سحبت الشعرية مع خيوط (6 "، 1.0 مم في القطر) وقيم البرنامج الابره ساحبه المستخدمة. (ب) صوره لحقنه مجهريه سحبت الشعرية مع خيوط (6 "، 1.0 مم في القطر) تملا مع 2.5 μl من محلول يحتوي علي 10 ٪ الفينول الأحمر. ال يسحب راس من الابره باقصي 7 [م] طويلة. (ج) التمثيل التخطيطي لاجراء حقن تكنولوجيا البيانات. (د) صور لاجراء حقن تكنولوجيا التطوير. وقد تم تعديل هذا الرقم من Bise وآخرون24. الأرقام في لوحات C و D تتوافق مع نفس الخطوات من الاجراء: (1) يتم وضع الأسماك الجانب البطني حتى علي إسفنجه مرطبه. يقع موقع الثقب (النقطة الحمراء في المثلث) في وسط الصدر بالقرب من الخياشيم. (2) تغلغل الابره في التامور. نقطه حمراء تشير إلى موقع ثقب. (3) يتم رصد الحقن من خلال مراقبه انتشار المحلول الأحمر في تجويف التامور. (ه) مخطط الحقن. يجب ان تكون الزاوية بين الحقن الشعرية ومحور الجسم بين 30 ° و 45 درجه لتجنب ثقب القلب. (و) صور لسمك الصدر في 1 ساعة بعد حقن تكنولوجيا التخزين من الاحجام المشار اليها. السهام البيضاء تشير إلى النسيج المعاد للصحن والذي قد يشير إلى نزيف داخلي يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 2
الشكل 2: الحلول التي تحقن بالحقن تنتشر بصوره موحده تقريبا علي سطح القلب. (ا) الصور المجسمة لقلوب كامله من الأسماك التي تعرضت لحقن تكنولوجيا المعلوماتية بعد الوفاة مع 2.5 ΜL hbss أو 2.5 μl الحبر. الحبر ملطخه سطح البطين (V) ، الأذين (A) والشرايين الشريانية (Ba). شريط مقياس = 300 μm. (ب) الصور المجسمة الساطعة المجال والفلورسنت لقلوب كامله من الأسماك الخاضعة لحقن تكنولوجيا المعلوماتية مع hbss و 3 μl من 1 ميكروغرام/مل dapi. يتم الكشف عن الفلورية DAPI علي أجزاء القلب بعد وقت قصير من حقن تكنولوجيا التشغيل. شريط مقياس = 300 μm. الرجاء النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 3
الشكل 3: مقارنه بين طريقتين للحقن لتوصيل DAPI إلى القلب. (ا) مخطط التصميم التجريبي. وأجريت الحقن داخل الصفاق (IP) وداخل الصفاق (IT) بنفس الكمية من 1 ميكروغرام/مل من DAPI (3 μL). تم جمع القلوب في 5 و 120 دقيقه بعد الحقن. (ب) الصور المجهرية البؤرية لأقسام القلب الملطخة بالفلورية الفوليداين (الأحمر) التي تسمي بوفره ألياف العضلات. تم تصور DAPI حقن في القناة المناسبة المبينة باللون الأخضر. بعد حقن الملكية الفكرية ، لم يتم الكشف عن DAPI في القلب في اي نقطه زمنيه. بعد حقن تكنولوجيا البرمجيات, خلايا ايجابيه DAPI موجودة في البطين بعد كلا النقطتين الزمنيين. شريط مقياس = 500 μm. الرجاء النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 4
الشكل 4: حقن التكنولوجيا لدراسة تجديد القلب. (ا) مخطط التصميم التجريبي. في 3 و 7 أيام بعد كريوينجوري ، وكان مزيج من DAPI و phسبائك idin AF649 هو حقنها (3 μL من 1 ميكروغرام/مل). تم جمع القلوب بعد ساعة واحده من حقن تكنولوجيا الAF568 ، الثابتة ، والملطخة والملونة مع phخلائط idin (الأحمر). (ب) الصور المجهرية البؤرية لأقسام القلب الطولية في 3 و 7 dpci. حقن DAPI (الأخضر) و phخلائط idin AF649 (الأزرق) خلايا التسمية من المنطقة المصابة (محدده بواسطة خط متقطع ابيض) وعضله الام سليمه (تلطيخ الحمراء). وتشير الأسهم البيضاء في التوزيع DAPI (الأخضر) من خلال المدمجة سليمه والتعرض الترابية والابيارديوم. شريط مقياس = 500 μm. الرجاء النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 5
الشكل 5: يحفز CNTF الخارجي الذي يحقن التكنولوجيا العديد من العمليات البيولوجية في القلب. (ا) مخطط التصميم التجريبي. أولا ، تم حقن 2.5 μl من محلول يحتوي علي 250 ng من cntf الزرد أو السيطرة الغلوبولين المناعي (higg) في التامور من الأسماك المحورة وراثيا التعبير عن DsRed2 النووية في عضلي. تم جمع القلوب في 7 و 1 أيام بعد الحقن (dpi) وتحليلها عن طريق التهجين المناعي وفي الموقع ، علي التوالي. (ب-د) صور المجهر البؤري لأقسام البطين للسيطرة وقلوب حقن CNTF. (ب) التحصين ضد علامة دوره الخلية ، المكون المعقد للصيانة minichromosome 5 (MCM5 ؛ الأخضر) ، يكشف عن عدد أكبر من العضلي المنتشرة ردا علي CNTF الخارجية. شريط مقياس = 500 μm. (ج) التحصين ضد الكولاجين الثاني عشر يظهر زيادة ترسب الكولاجين الثاني عشر في عضله الام بعد حقن CNTF. في السيطرة علي القلب ، ويقتصر الكولاجين الثانيعشر إلى ال34 الابيديديوم. شريط مقياس = 500 μm. (د) التحصين ضد علامة الخلية المناعية ، L-plastin ، يكشف عن تعزيز تجنيد الخلايا المناعية في الأسماك CNTF حقن. شريط مقياس = 500 μm. (ه) الصور المجهر الميدانية الساطعة للأقسام المتقاطعة البطينية بعد التهجين في الموقع باستخدام مسبار mrna المضاد للتحسس ضد المثانة ، وهو عامل تقويم القلب ، ويعرض الحامل التبادلي لهذا الجين في الصميم من الأسماك CNTF حقن. شريط مقياس = 500 μm. وقد تم تعديل هذا الرقم من Bise وآخرون24. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Discussion

هنا ، ونحن وصف طريقه لتسليم المركبات الخارجية والبروتينات في تجويف التامور من أجل دراسة اثارها علي القلب في zebrafish الكبار. ويستند الاجراء إلى الحقن داخل الجسم ، مما يؤدي إلى تسليم كميه صغيره من المحلول في المنطقة المجاورة للجهاز. تم تطوير هذه التقنية ووصفها لدراسة ما قبل القلب والتجديد.

الخطوة الحاسمة في هذا الاجراء هو اختراق الزجاج الشعرية في التجويف الصدري. هذه الخطوة تعتمد علي ثلاثه المعلمات التي هي: صلابة والحده من طرف الشعرية ، وزاوية الاختراق ، وموقع ثقب. لتحسين الاختراق من خلال الجلد ، فان الجزء المسحوب من الشعرية لا ينبغي ان يكون طويلا جدا ، لان هذه الابر هي مرنه جدا وينحني في اتصال مع الجلد. لتجنب هذا ، يمكن تكييف صلابة عن طريق الحد من حجم غيض مع مقص الزائدة الدودية. علي الرغم من ان زاوية الاختراق يمكن ان تختلف بين 30 ° و 45 درجه مئوية ، فانه يمكن تكييفها لصلابة الطرف. في الواقع ، سوف غيض رقيقه تخترق الجلد بشكل أفضل مع زاوية أضيق.

من أجل تحسين اختراق الابره ، يجب ان يكون موقع الادراج فوق القلب النابض مباشره. مخاطر ثقب القلب عاده ما تكون منخفضه تتراوح بين 5 ٪ و 8 ٪. ان إدخال الابره الخلفية إلى القلب يزيد من خطر ثقب القلب ، كما يراه النزيف المعزز. في مثل هذه الحالات ، يجب أزاله الكائنات من التجارب.

مصدر آخر من المتاعب اثناء حقن تكنولوجيا التي تحدث علي مستوي الشعرية. في الواقع يمكن ان الشعرية كسر عندما تمارس القوات الجانبية علي ذلك. لتجنب هذا ، يجب ان تتحرك الابره علي طول محور الحقن بطريقه مستقيمة. أحيانا, الشعرية يستطيع كنت سدت بنسيج بقايا ان يمنع السائل من يتدفق. يمكن إلغاء حظر الابره عن طريق سحب الطرف برفق اثناء الحقن. إذا كان هذا لا يحسن تدفق ، ونحن نوصي تماما سحب الابره من الصدر واستبدال الابره.

يمكن ان يكون سبب آلافات عن طريق إدخال ابره عميقة جدا في التامور. من أجل تجنب آلافات في كيس التامور ، يجب ان لا تدرج الابره كثيرا (1 − 2 ملم) في الصدر. لوحظت بعض التسريبات عندما كان حجم الحقن أكبر من 8 μL.

في zebrafish ، التكوين الدقيق للسائل التامور غير معروف. ومع ذلك ، ويقدر حجم تجويف التامور في ~ 10 μL31. النظر إلى ان حجم البطين الزيبرافيش البالغ هو ما يقرب من 1 − 2 مم3، ونحن نفترض ان تجويف التامور وفقا لذلك حجم صغير ، والتي يجب النظر فيها قبل الحقن. من الدراسات الاوليه لدينا ، قررنا ان النطاق الأمثل لحجم الحقن بين 0.5 و 3 μl للأسماك قياس 2.5 − 2.8 سم (المسافة من الخطم إلى العم الذيليه). ويمكن تكييف هذا الحجم اعتمادا علي حجم الأسماك. حقن ما يصل إلى 5 μL لم يحفز اي افه في الأسماك من هذا الحجم. ومع ذلك ، وحدات التخزين من 8 μL كانت كافيه للتسبب انتفاخ ونزيف داخلي كما هو مبين في الشكل 1F. استنادا إلى هذه البيانات ، ونحن نقدر ان كميه من الحل أكبر من 3 μL قد يسبب الإجهاد الجسدي والفسيولوجي علي الجهاز. وهذا القيد ينغرس الحاجة إلى اختيار تركيز اعلي من الجزيئات بدلا من زيادة كميه المحلول المحقون.

وثمة عامل مهم آخر هو الخاصية الاسموزي للحل المحقون ، الذي ينبغي ان يكون في النطاق الفسيولوجي. في الواقع ، لتجنب خطر الإجهاد الاسموزي ، ونحن نوصي HBSS كوسيلة حقن.

في zebrafish ، والأساليب الشائعة المستخدمة لتسليم المخدرات من خلال معالجه المياه وحقن داخل الصفاق30،35. علي الرغم من ان كلا من هذه التقنيات هي مناسبه للعديد من التطبيقات, حقن تقنيه التكنولوجيا توفر مزايا التجريبية والاقتصادية, من خلال تقليل مخاطر الآثار الجانبية الجهازية غير المرغوب فيها والحد من استخدام جزيئات مكلفه, علي التوالي. هذا الأسلوب يمكن ان تكون مناسبه لتسليم تاموكسيفين لتنشيط نظام ERT2 المعدلة وراثيا المستخدمة لتحليل تتبع سلاله الخلية ، وتوجيه RNAs تعديل للدراسات الوظيفية في بحوث التجديد.

وقد وصفت طريقه حقن IT في الزرد سابقا31,36. في تلك التقارير ، أجريت حقن داخل الصفاق مع ابره الانسولين ، ثقب من الجانب الامامي. وعلي النقيض من ذلك ، يقدم بروتوكولنا استراتيجية بديله مع الشعرية الزجاجية المسحوبة المدرجة من الاتجاه الخلفي. علي وجه التحديد ، ياخذ نهجنا في الاعتبار تشريح الأسماك التامور لتحسين الحقن مع انخفاض خطر الاصابه بثقب في القلب. وعلاوة علي ذلك ، اثناء الاجراء ، لا يتم عقد الأسماك بواسطة ملقط معدني ، ولكن بواسطة إسفنجه رطبه وناعمه ، وهو أسلوب أكثر ملاءمة لتجنب اي أصابه خارجيه للأسماك. وهكذا ، فان الطريقة المعروضة قد تكون أكثر ملاءمة للدراسات من التوازن القلب ، والتجديد المسبق والتجدد في zebrafish الكبار.

وقد تم بالفعل وضع حقن التكنولوجيا في الكائنات الحية نموذج الثدييات. في الواقع ، وقد طبقت هذه الطريقة أيضا في التجارب مع الخنازير والدراسات السريرية في البشر37،38. في الفئران ، وقد استخدمت حقن إينتراميوكارديال الصدرية تسترشد الموجات فوق الصوتية لتحدي قلوبهم39. في هذه المقالة نقترح بروتوكول مفصل لتخفيف استخدام حقن تكنولوجيا المواد لل zebrafish. وهذا سيكون له قيمه خاصه في الميدان ، من أجل تكمله النهج الوراثية في التوازن القلبي ، والبحث المسبق والتجديد.

Disclosures

وليس لدي المؤلفين ما يفصحون عنه.

Acknowledgments

نشكر v. زيمرمان علي المساعدة التقنية الممتازة والعناية بالأسماك ، d. كونيغ (جامعه فريبورغ) للقراءة النقدية للمخطوطة ، d. كريسسلر (جامعه فريبورغ) للمساعدة في تخليق البروتين zCNTF ، f. روغييرو (معهد دي Génomique Fonctionnelle دي ليون) لتوفير الأجسام المضادة ColXII ، و p. مارتن (جامعه بريستول) للأجسام المضادة L-plastin. نشكر مرفق التصوير الأساسي والمنصة البروتينية في جامعه فريبورغ. وقد تم دعم هذا العمل من قبل مؤسسه العلوم الوطنية السويسرية ، ومنحه رقم 310030_179213 ، ومن قبل Schweizerische هرفتتونغ (مؤسسه القلب السويسري).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics