Iniezione intrathoracica per lo studio del cuore di zebrafish adulto

Biology
 

Summary

Questo metodo si basa sull'iniezione di 0,5 − 3 μL di soluzione nel torace di zebrafish adulto. La procedura trasporta efficacemente proteine e composti chimici nella vicinanza del cuore del pesce zebra senza danneggiare l'organo. L'approccio è adatto per testare gli effetti di fattori esogeni su vari tessuti del cuore.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il cuore pesce zebra adulto fornisce un modello potente nella ricerca di rigenerazione cardiaca. Anche se la forza di questo sistema si basa su approcci transgenici, una rapida consegna di fattori esogeni fornisce una tecnica complementare negli studi funzionali. Qui, presentiamo un metodo che si basa sulla somministrazione di pochi microlitri di soluzione nella cavità pericardica senza causare danni al miocardio. Le iniezioni intratoraciche possono consegnare efficacemente proteine e composti chimici direttamente sulla superficie cardiaca. Le sostanze iniettate diffondono attraverso l'epicardio nei tessuti cardiaci sottostanti. Rispetto alle iniezioni intraperitoneali (IP), il principale vantaggio delle iniezioni intratoraciche è la somministrazione focale dei fattori testati sull'organo bersaglio. La consegna di molecole direttamente nel pericardio è una strategia adatta per gli studi di precondizionamento cardiaco e rigenerazione nel pesce zebra adulto.

Introduction

Tra i vertebrati, i pesce zebra possiedono una notevole capacità di rigenerare i loro cuori1,2. Questa capacità è stata riportata in diversi modelli di lesione, vale a dire resezione dell'apice ventricolare, criolesione (ci) e ablazione genetica dei cardiomiociti3,4,5,6,7. Dopo le ferite invasive, la parete danneggiata del ventricolo viene guarita transitoriamente dal tessuto fibrotico, che viene progressivamente sostituito da un nuovo miocardio8,9,10,11. La risposta di guarigione precoce della ferita comporta l'attivazione di epicardio e il reclutamento di cellule immunitarie12,13,14,15. In concomitanza, i cardiomiociti vicino al miocardio ferito si attivano, dedifferenziano, proliferano e sostituiscono progressivamente l'area ferita entro 30 − 90 giorni16,17,18, 19. progressi sostanziali nella decifratura dei meccanismi molecolari e cellulari della rigenerazione cardiaca sono stati raggiunti grazie alla disponibilità di strumenti genetici, come l'analisi di tracciatura delle cellule, l'iperespressione genica inducibile, linee reporter di tessuto fluorescente e mutagenesi genica CRISPR/Cas920,21.

Abbiamo recentemente istituito un modello di precondizionamento cardiaco nel pesce zebra adulto di toracotomia22,23. Il precondizionamento accresce l'espressione dei geni cardioprotettivi ed elesse il rientro nel ciclo cellulare nei cuori integri e rigeneranti. Questi processi sono associati all'assunzione di cellule immunitarie e al rimodellamento delle matrici22,24. I meccanismi di precondizionamento sono scarsamente compresi e la creazione di nuove tecniche è necessaria per promuovere questo settore della ricerca. In particolare, la somministrazione ottimizzata di proteine di segnalazione seccato o di altri composti chimici è essenziale per indagare ulteriormente su questo argomento.

Essendo animali acquatici, il pesce zebra può naturalmente assorbire varie sostanze disciolte in acqua attraverso le loro branchie e la pelle. Questo offre la possibilità per la consegna di farmaci non invasivi attraverso l'immersione del pesce in soluzioni con diverse sostanze chimiche, come gli inibitori farmacologici, ormoni steroidei, tamoxifene, BrdU e antibiotici. Infatti, numerosi studi di vari laboratori, tra cui25,26,27, hanno approfittato di questo metodo, che è particolarmente prezioso nel campo della biologia rigenerativa6, 28. questo approccio non è tuttavia appropriato per la consegna di peptidi, DNA, RNA, morfololinos o molecole con una limitata permeabilità tissutale. In questi casi, una consegna più efficiente è ottenuta mediante microiniezione nel corpo, ad esempio inserendo il capillare nel seno venoso retro-orbitale, nella cavità intraperitoneale o intrapericardiale29,30, al 31. Qui, descriviamo una procedura di iniezione intratoracica di una piccola quantità di soluzione, come metodo adatto per studiare la rigenerazione del cuore e il precondizionamento nel pesce zebra adulto.

Protocol

La cura degli animali e tutte le procedure animali descritte nel seguente protocollo sono state approvate dall'ufficio veterinario cantonale di Friburgo, in Svizzera.

1. strumenti e soluzioni per iniezioni

  1. Tirare capillari di vetro borosilicato adattato microiniezione utilizzando un estrattore di aghi secondo la Figura 1a. Conservare i capillari estratti in una piastra di Petri da 9 cm con rotaie di argilla modellante o nastro adesivo.
  2. Utilizzando le forbici comuni, tagliare un pezzo di spugna (7 cm x 3 cm x 1 cm) e intagliare una silhouette simile a un pesce nel suo mezzo.
  3. Preparare piccole aliquote di soluzione iniettabile con le proteine testate o altri composti. Regolare la loro concentrazione in modo dipendente sul saggio diluendo la sostanza in 1x soluzione salina bilanciata di Hanks (HBSS) completata con il 10% di rosso fenolo.
    Nota: Qui, la concentrazione della proteina testata era 100 ng/mL.
  4. Per preparare una soluzione di stock di anestetici tricaina tamponata, sciogliere 4 g di tricaina in 980 mL di acqua distillata. Regolare il pH a 7,0 − 7,4 utilizzando 1 M Tris-HCl pH 9 e riempire con acqua fino a 1.000 mL. Conservare la soluzione al buio a 4 ° c.
  5. Per ottenere la concentrazione di lavoro di anestetici, aggiungere 1 − 2 mL di soluzione di stock di tricaina in 50 mL di acqua di pesce in un beaker.
    Nota: La concentrazione di lavoro di anestetici tricaina deve essere preparata appena prima dell'uso.

2. preparazione della stazione di iniezione

  1. Accendere lo stereomicroscopio con la luce dalla parte superiore e regolare l'ingrandimento a 16x.
  2. Immergere la spugna con acqua di pesce, posizionarla su una piastra di Petri da 9 cm sulla fase del microscopio e regolare la messa a fuoco.
  3. Sotto lo stereomicroscopio, tagliare l'estremità di un microcapillare a ~ 7 mm dalla base utilizzando una forbici iridectomia come mostrato nella Figura 1a. Il diametro della punta ideale sarebbe ~ 20 μm.
    Nota: Tagliare la punta del capillare in modo obliquo è ottimale per inserimenti nel tessuto.
  4. Inserire il microcapillare nel supporto dell'ago dell'apparato microiniettore.
  5. Utilizzando punte microloader, caricare una soluzione di controllo (ad esempio, 1x HBSS) per impostare la pressione di iniezione, al fine di ottenere il flusso appropriato compreso tra 0,3 μL/s e 0,5 μL/s. svuotare l'ago.
  6. Caricare il volume selezionato della soluzione iniettabile (ad esempio, fattore neurotrofico ciliare [CNTF] diluito in 1x HBSS) nella punta del capillare (Figura 1B). Non dovrebbe esserci una bolla d'aria nel capillare.
    Nota: Il volume massimo di soluzione iniettabile dipende dalla dimensione del pesce. Per una lunghezza standard di 2,5 − 3 cm (distanza dal muso al peduncolo caudale), il volume massimo di iniezione che previene il gonfiore e il sanguinamento toracico esessivo è stato determinato a 5 μL (Figura 1F). Volumi più grandi potrebbero essere iniettati a pesci più grandi.

3. preparazione del pesce per l'iniezione intrathoracic

  1. Prendere un pesce zebra adulto (Danio rerio) con una rete e trasferirlo nella soluzione anestetico.
  2. Dopo 1 − 2 min, quando il pesce smette di nuotare e il movimento dell'opercolo è ridotto, toccare il pesce con un cucchiaio di plastica per assicurarsi che non reagisca a qualsiasi contatto.
  3. Trasferire rapidamente e con cautela il pesce con il cucchiaio nella scanalatura della spugna bagnata, con il lato ventrale verso l'alto. La testa del pesce dovrebbe puntare lontano dalla mano dominante dell'operatore.

4. microiniezione nel pericardio

  1. Sotto lo stereomicroscopio, osservare attentamente il movimento del cuore pulsante sotto la pelle del pesce. Determinare visivamente il punto di iniezione sopra il cuore pulsante e al centro del triangolo definito dalle piastre cartilaginose ventrale (Figura 1D). Inserire la punta del capillare a un angolo di 30 − 45 ° rispetto all'asse del corpo (Figura 1e). Penetrare delicatamente la pelle con la punta del microcapillare nel pericardio (Figura 1C). Un punto di ingresso ottimale è più vicino all'addome che alla testa.
    Nota: Non inserire il capillare troppo profondamente nel corpo e nel cuore, in quanto ciò causerà lesioni all'organo. In caso di puntura cardiaca, l'ago generalmente si riempie di sangue. In questo caso, rimuovere il capillare ed escludere il pesce dall'esperimento.
  2. Una volta che l'ago è all'interno del pericardio, iniezione completa premendo il pedale del dispositivo microiniettore.
    Nota: Fare attenzione a non iniettare aria nella cavità toracica.
  3. Dopo l'iniezione, prelevare delicatamente il capillare dal torace e trasferire immediatamente il pesce in un serbatoio con acqua di sistema per il recupero.
  4. Monitorare il pesce fino al recupero totale dall'anestesia.
  5. Raccogliere il cuore al punto di tempo desiderato e prepararlo per ulteriori analisi.
    Nota: Nel caso in cui il pesce non riprende il movimento dell'opercolo entro 30 s, rianimare il pesce schiacciando l'acqua nelle branchie con una pipetta di plastica.

Representative Results

Dopo iniezioni intratoracica (it), gli effetti della soluzione esogena possono essere analizzati. A tale scopo, il pesce deve essere eutanizzato e i cuori raccolti, fissi e istologicamente elaborati, secondo i protocolli pubblicati in precedenza32,33.

Per convalidare il metodo, abbiamo prima eseguito due esperimenti di test iniettando colori e coloranti fluorescenti. In primo luogo, abbiamo eutanizzato pesce e post-mortem iniettato 3 μL di inchiostro nel torace. I cuori sono stati raccolti dopo 5 minuti, lavati in soluzione salina tampone fosfato (PBS), fissato in 2% formalina, lavato in PBS e fotografato al microscopio. In secondo luogo, abbiamo iniettato 3 μL di 1 μg/mL 4 ′, 6-diamidino-2-phenylindole (DAPI) in vivo e fissato il cuore dopo 2 h. In entrambi i saggi, l'analisi di montaggio completo ha rivelato l'etichettatura di tutto il cuore compreso il ventricolo, l'atrio e l'arterioso del bulbo (Figura 2a, B). Questi risultati rivelano una diffusione efficiente della soluzione iniettata sulla superficie cardiaca.

Un protocollo comune per la consegna di sostanze esogene nel pesce adulto è l'iniezione intraperitoneale (IP). Per confrontare l'idoneità delle iniezioni di IT versus IP per gli studi cardiaci, abbiamo iniettato una quantità simile di DAPI utilizzando entrambi i metodi e fissato i cuori dopo 5 min e 120 min (Figura 3A). I cuori sono stati sezionati e macchiati con Phalloidin Alexa Fluor (AF) 568 che etichetta F-actina nel muscolo cardiaco. Non sono state osservate cellule DAPI positive nei cuori dopo l'iniezione IP in entrambi i punti temporali (Figura 3B). Al contrario, l'iniezione di IT ha provocato la presenza di nuclei etichettati con DAPI nel miocardio (Figura 3B). Questi risultati dimostrano che l'iniezione di IT ha migliorato la consegna del composto al cuore, rispetto all'iniezione IP.

Per testare l'idoneità di questo metodo per gli studi di rigenerazione cardiaca, abbiamo crioferiti ventricoli8, ed eseguito iniezioni di it di 3 μL di 1 μg/ml DAPI e 1 μg/ml Phalloidin AF649 a 3 e 7 giorni post-crioinfortunio (DPCI) (Figura 4a). A 1 h post-iniezione, i cuori sono stati raccolti, fissi, sezionati e macchiati con Phalloidin AF568 per visualizzare il miocardio intatto. Abbiamo scoperto che sia il miocardio che il tessuto ferito contenevano numerose cellule positive DAPI, indicando una penetrazione efficiente di questo colorante nel cuore intatto e nel tessuto fibrotico (Figura 4B). Inoltre, l'iniezione di Phalloidin AF649 è stata anche incorporata dai cardiomiociti della zona peri-infortunio e da alcuni fibroblasti reclutati nell'area ferita. Questo esperimento rivela che i farmaci possono attraversare l'epicardio e penetrare nel miocardio sottostante.

Dopo aver testato l'efficienza delle iniezioni IT utilizzando coloranti, abbiamo analizzato gli effetti delle proteine iniettate sul cuore. Abbiamo sintetizzato una citochina, chiamato CNTF, che è upregulate dopo toracotomia24. Abbiamo studiato gli effetti del CNTF esogeno su vari processi, vale a dire la proliferazione dei cardiomiociti, la deposizione della matrice extracellulare, il reclutamento delle cellule immunitarie e l'espressione genica cardioprotettiva. Abbiamo scoperto che tutti questi aspetti biologici sono stati attivati dall'iniezione IT di CNTF, rispetto alle immunoglobuline di controllo (Figura 5)24. Questi risultati dimostrano che il metodo di iniezione intratoracica fornisce una strategia adeguata per la consegna mirata di proteine per studiare i loro effetti su tessuti cardiaci distinti in una varietà di saggi.

Figure 1
Figura 1: iniezione Intrathorascica (it) nel pesce zebra adulto. A) fotografia di un capillare di microiniezione tirato con filamento (6 ", 1,0 mm di diametro) e valori del programma di estrazione dell'ago utilizzato. B) fotografia di un capillare di microiniezione tirato con filamento (6 ", 1,0 mm di diametro) riempito con 2,5 μl di soluzione contenente il 10% di rosso fenolo. La punta estratta dell'ago è massima di 7 mm di lunghezza. C) rappresentazione schematica della procedura di iniezione it. D) fotografie della procedura di iniezione it. Questa cifra è stata modificata da Bise et al.24. I numeri nei pannelli C e D corrispondono alle stesse fasi della procedura: (1) il pesce viene posto ventrale verso l'alto su una spugna umidificata. Il sito di puntura (punto rosso nel triangolo) si trova al centro del torace vicino alle branchie. (2) penetrazione dell'ago nel pericardio. Punto rosso indica sito di puntura. (3) l'iniezione è monitorata osservando la diffusione della soluzione rossa nella cavità pericardico. (E) schema di iniezione di esso. Angolo tra il capillare di iniezione e l'asse del corpo dovrebbe essere tra 30 ° e 45 ° per evitare la puntura del cuore. F) fotografie del torace di pesce a 1 ora dopo l'iniezione di it di volumi indicati. Le frecce bianche puntano al tessuto ripiatto, che potrebbe indicare un sanguinamento interno. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Figure 2
Figura 2: le soluzioni IT iniettate si diffondono quasi uniformemente sulla superficie cardiaca. A) immagini stereomicroscopio di cuori interi di pesci sottoposti a iniezione di it post mortem con 2,5 ΜL di hbss o 2,5 μl di inchiostro. Inchiostro macchiato la superficie del ventricolo (V), atrio (A) e bulbo arterioso (BA). Barra di scala = 300 μm.B) immagini di Stereomicroscopio a campo e fluorescente di cuori interi di pesci sottoposti ad iniezione di it con HBSS e 3 ΜL di DAPI da 1 μg/ml. La fluorescenza DAPI viene rilevata sulle parti cardiache subito dopo l'iniezione di IT. Barra di scala = 300 μm. fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: confronto di due metodi di iniezione per la consegna di DAPI al cuore. A) schema del progetto sperimentale. Le iniezioni intraperitoneali (IP) e Intrathorascic (IT) sono state eseguite con la stessa quantità di 1 μg/mL di DAPI (3 μL). I cuori sono stati raccolti a 5 e 120 minuti dopo l'iniezione. B) immagini di microscopia confocale di sezioni cardiache macchiate con Phalloidin fluorescente (rosso) che etichettare abbondantemente le fibre muscolari. DAPI iniettato è stato visualizzato nel canale appropriato mostrato in verde. Dopo l'iniezione IP, DAPI non viene rilevata nel cuore in qualsiasi punto temporale. Dopo l'iniezione di IT, le cellule positive di DAPI sono presenti nel ventricolo dopo entrambi i punti temporali. Barra di scala = 500 μm. fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: iniezione it per studiare la rigenerazione cardiaca. A) schema del progetto sperimentale. A 3 e 7 giorni dopo la criolesione, è stata iniettata una miscela di DAPI e Phalloidin AF649 (3 μL di 1 μg/mL). I cuori sono stati raccolti 1 ora dopo l'iniezione di IT, fisso, sezionato e macchiato con Phalloidin AF568 (rosso). B) immagini di microscopia confocale di sezioni cardiache longitudinali a 3 e 7 DPCI. DAPI iniettato (verde) e Phalloidin AF649 (blu) etichette delle celle dell'area lesa (delimitate da una linea tratteggiata bianca) e del miocardio intatto (colorazione rossa). Le frecce bianche puntano alla distribuzione DAPI (verde) attraverso la miocardia compatta e trabecolata intatta e l'epicardio. Barra di scala = 500 μm. fare clic qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: il CNTF esogeno a iniezione it stimola diversi processi biologici nel cuore. A) schema del progetto sperimentale. In primo luogo, 2,5 μl di una soluzione contenente 250 ng di CNTF di pesce zebra o immunoglobuline di controllo (hIgG) è stata iniettata nel pericardio di pesci transgenici che esprimono DsRed2 nucleari in cardiomiociti. I cuori sono stati raccolti a 7 e 1 giorni dopo l'iniezione (dpi) e analizzati da immunofluorescenza e in situ ibridazione, rispettivamente. (B-D) Immagini di microscopia confocale di sezioni ventricolari di controllo e cuori iniettati CNTF. B) immunostaining contro un marcatore di ciclo cellulare, componente complesso di manutenzione minichromosoma 5 (MCM5; verde), rivela un numero più elevato di cardiomiociti proliferanti in risposta al CNTF esogeno. Barra di scala = 500 μm.c) immunostaining contro il collagene XII Mostra un aumento della deposizione di collagene XII nel miocardio dopo l'iniezione di CNTF. Nel cuore di controllo, il collagene XII è confinato all'epicardio34. Barra di scala = 500 μm. (D) immunostaining contro un marcatore di cellule immunitarie, L-Plastina, rileva un aumento del reclutamento di cellule immunitarie nel pesce iniettato CNTF. Barra di scala = 500 μm. (E) immagini di microscopio a campo luminoso di sezioni trasversali ventricolari dopo ibridazione in situ utilizzando una sonda mRNA antisenso contro la cistatina, un fattore cardioprotettivo, Mostra l'upregulation trascrizionale di questo gene nel cuore di pesce iniettato in CNTF. Barra di scala = 500 μm. Questa cifra è stata modificata da Bise et al.24. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Discussion

Qui, descriviamo un metodo per la consegna di composti esogeni e proteine nella cavità pericardica al fine di studiare i loro effetti sul cuore in zebrafish adulto. La procedura si basa su iniezione intratoracica, che si traduce nella consegna di un piccolo volume di soluzione in prossimità dell'organo. Questa tecnica è stata sviluppata e descritta per studiare il precondizionamento cardiaco e la rigenerazione.

Il passo critico in questa procedura è la penetrazione del capillare di vetro nella cavità toracica. Questo passaggio dipende da tre parametri che sono: la rigidità e la nitidezza della punta capillare, l'angolo di penetrazione e il sito di puntura. Per ottimizzare la penetrazione attraverso la pelle, la parte estratta del capillare non deve essere troppo lunga, poiché tali aghi sono troppo flessibili e si piegano a contatto con la pelle. Per evitare questo, la rigidità può essere adattata riducendo la dimensione della punta con l'iridectomia Scissor. Anche se l'angolo di penetrazione può variare tra 30 ° e 45 °, può essere adattato alla rigidità della punta. Infatti, una punta sottile penetrerà la pelle meglio con un angolo più stretto.

Al fine di ottimizzare la penetrazione dell'ago, il sito di inserimento deve essere immediatamente sopra il cuore pulsante. Il rischio di puntura cardiaca è solitamente basso compreso tra il 5% e l'8%. L'inserimento dell'ago posteriore al cuore aumenta il rischio di puntura cardiaca, come visto da un aumento del sanguinamento. In questi casi, gli animali devono essere rimossi dagli esperimenti.

Un'altra fonte di problemi durante l'iniezione IT si verifica a livello capillare. Infatti il capillare può rompersi quando le forze laterali sono esercitate su di esso. Per evitare questo, l'ago deve muoversi lungo l'asse di iniezione in modo rettilineo. Occasionalmente, il capillare può essere bloccato da residui di tessuto che impediscono il flusso del liquido. L'ago può essere sbloccato ritirando delicatamente la punta mentre si inietta. Se questo non migliora il flusso, si consiglia di ritirare completamente l'ago dal torace e di sostituire l'ago.

Le lesioni possono essere causate da un ago troppo profondamente inserito nel pericardio. Al fine di evitare lesioni nel sacco pericardico, l'ago non deve essere inserito troppo (1 − 2 mm) nel torace. Alcune perdite sono state osservate quando il volume di iniezione era superiore a 8 μL.

Nel pesce zebra, la composizione esatta del fluido pericardico è sconosciuta. Tuttavia, il volume della cavità pericardico è stimato a ~ 10 μL31. Dato che il volume del ventricolo pesce zebra adulto è di circa 1 − 2 mm3, supponiamo che la cavità pericardica abbia di conseguenza un volume minuscolo, che deve essere considerato prima delle iniezioni. Dai nostri studi preliminari, abbiamo stabilito che la gamma ottimale del volume iniettato è compresa tra 0,5 e 3 μL per i pesci che misurano 2,5 − 2,8 cm (distanza dal muso al peduncolo caudale). Questo volume può essere adattato a seconda delle dimensioni del pesce. L'iniezione fino a 5 μL non ha indotto alcuna lesione nei pesci di queste dimensioni. Tuttavia, i volumi da 8 μL sono stati sufficienti a causare rigonfiamento e sanguinamento interno come mostrato nella Figura 1F. Sulla base di questi dati, stimiamo che una quantità di soluzione superiore a 3 μL possa causare stress fisico e fisiologico sull'organo. Questa limitazione deduce la necessità di scegliere una maggiore concentrazione di molecole invece di aumentare la quantità della soluzione iniettata.

Un altro fattore importante è la proprietà osmotica della soluzione iniettata, che dovrebbe essere nella gamma fisiologica. In effetti, per evitare il rischio di stress osmotico, raccomandiamo l'HBSS come mezzo di iniezione.

In zebrafish, i metodi comuni utilizzati per consegnare i farmaci sono attraverso il trattamento delle acque e l'iniezione intraperitoneale30,35. Anche se entrambe queste tecniche sono adatte per molte applicazioni, le iniezioni IT forniscono vantaggi sperimentali ed economici, diminuendo i rischi di effetti collaterali sistemici indesiderati e riducendo l'uso di molecole costose, rispettivamente. Questo metodo può essere adatto per la consegna di tamoxifene per attivare il sistema transgenico cre-ERT2 utilizzato per l'analisi di lignaggio delle cellule, e guidare RNA modificati per gli studi funzionali nella ricerca di rigenerazione.

Il metodo di iniezione it in pesce zebra è stato precedentemente descritto31,36. In tali segnalazioni, le iniezioni intratoraciche sono state eseguite con ago di insulina, perforando dal lato anteriore. Al contrario, il nostro protocollo presenta una strategia alternativa con il capillare di vetro tirato inserito dalla direzione posteriore. In particolare, il nostro approccio prende in considerazione l'anatomia del pericardio del pesce per ottimizzare l'iniezione con un rischio ridotto di puntura cardiaca. Inoltre, durante la procedura, il pesce non è detenuto da pinze metalliche, ma da una spugna umida e morbida, che è un metodo più adatto per evitare qualsiasi lesione esterna del pesce. Così, il metodo presentato potrebbe essere più adatto per gli studi di omeostasi cardiaca, precondizionamento e rigenerazione in adulti zebrafish.

Le iniezioni IT sono già state stabilite in organismi modello di mammiferi. Infatti, questo metodo è stato applicato anche in esperimenti con suini e studi clinici in esseri umani37,38. In topi, iniezioni intramiocardica transtoracico guidate da ultrasuoni sono stati utilizzati per sfidare il loro cuore39. All'interno di questo articolo proponiamo un protocollo dettagliato per facilitare l'uso dell'iniezione IT per il pesce zebra. Questo sarà particolarmente prezioso per il settore, al fine di integrare gli approcci genetici nell'omeostasi cardiaca, nella ricerca di precondizionamento e rigenerazione.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Ringraziamo V. Zimmermann per l'eccellente assistenza tecnica e per la cura del pesce, D. König (Università di Friburgo) per la lettura critica del manoscritto, D. Kressler (Università di Friburgo) per l'aiuto con la sintesi proteica zCNTF, F. Ruggiero (Institut de génomique Fonctionnelle de Lyon) per aver fornito l'anticorpo ColXII, e P. Martin (Università di Bristol) per l'anticorpo L-Plastin. Ringraziamo l'impianto di Imaging Core e la piattaforma di proteomica dell'Università di Friburgo. Questo lavoro è stato sostenuto dalla Fondazione Nazionale Svizzera per la scienza, Grant Number 310030_179213, e dalla Schweizerische Herzstiftung (Swiss Heart Foundation).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics