Injeção intratorácica para o estudo do coração de zebrafish adulto

Biology
 

Summary

Este método baseia-se na injeção de 0,5 − 3 μL de solução no tórax de zebrafish adulto. O procedimento entrega eficientemente proteínas e compostos químicos na proximidade do coração de zebrafish sem danificar o órgão. A abordagem é adequada para efeitos de teste de fatores exógenos em vários tecidos do coração.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

O coração de zebrafish adulto fornece um modelo poderoso na pesquisa da regeneração cardíaca. Embora a força deste sistema seja baseada em aproximações transgénicas, uma entrega rápida de fatores exógenos fornece uma técnica complementar em estudos funcionais. Aqui, apresentamos um método que se baseia na administração de alguns microlitros de solução na cavidade pericárdica sem causar dano miocárdico. As injeções intratorácicas (IT) podem fornecer eficientemente proteínas e compostos químicos diretamente sobre a superfície do coração. As substâncias injetadas difusas através do epicárdio nos tecidos cardíacos subjacentes. Em comparação com as injeções intraperitoneal (IP), a principal vantagem das injeções intratorácicas é a administração focal dos fatores testados no órgão-alvo. A entrega de moléculas diretamente no pericárdio é uma estratégia adequada para estudos de pré-condicionamento cardíaco e regeneração em zebrafish adulto.

Introduction

Entre os vertebrados, o zebrafish possui uma capacidade notável para regenerar seus corações1,2. Essa habilidade tem sido relatada em diversos modelos de lesão, ou seja, ressecção do ápice ventricular, crioferimento (IC) e ablação genética de cardiomiócitos3,4,5,6,7. Após lesões invasivas, a parede danificada do ventrículo torna-se transitoriamente curada pelo tecido fibrótico, que é progressivamente substituído por um novo miocárdio8,9,10,11. A resposta precoce da cicatrização de feridas envolve ativação do epicárdio e recrutamento de células imunes12,13,14,15. Concomitantemente, os cardiomiócitos próximos ao miocárdio lesionado tornam-se ativados, desdiferenciam-se, proliferam e substituem progressivamente a área ferida dentro de 30 − 90 dias16,17,18, 19. progressos substanciais na decifragem dos mecanismos moleculares e celulares da regeneração cardíaca foram alcançados graças à disponibilidade de ferramentas genéticas, como a análise de rastreamento de linhagem celular, a superexpressão genética inducível, linhas fluorescentes do repórter do tecido, e crispr/mutagênese do gene Cas920,21.

Recentemente,estabeleceu-se um modelo de pré-condicionamento cardíaco no zebrafish adulto por toracotomia22,23. O pré-condicionamento aumenta a expressão de genes cardioprotetores e eleva a reentrada no ciclo celular nos corações íntegros e regenerantes. Esses processos estão associados ao recrutamento de células imunológicas e remodelamento de matrizes22,24. Os mecanismos de pré-condicionamento são pouco compreendidos, e o estabelecimento de novas técnicas é necessário para fomentar essa área de pesquisa. Em particular, a administração otimizada de proteínas de sinalização secretadas ou outros compostos químicos é essencial para aprofundar a investigação deste tópico.

Sendo animais aquáticos, o zebrafish pode absorver naturalmente várias substâncias dissolvidas na água através de suas guelras e pele. Isto oferece uma possibilidade para a entrega não invasora da droga com a imersão dos peixes nas soluções com produtos químicos diversos, tais como inibidores farmacológicos, hormonas esteróides, tamoxifen, BrdU e antibióticos. Na verdade, numerosos estudos de vários laboratórios, incluindo os nossos25,26,27, aproveitaram este método, que é particularmente valioso no campo da biologia regenerativa6, 28. esta abordagem não é, no entanto, adequada para a entrega de peptídeos, DNA, RNA, morfolinos ou moléculas com uma permeabilidade tecidual limitada. Nestes casos, uma entrega mais eficiente é conseguida pela microinjeção no corpo, por exemplo, inserindo o capilar no seio venoso retro-orbital, na cavidade intraperitoneal ou intrapericardial29,30, a 31. Aqui, nós descrevemos um procedimento da injeção intratorácica de uma pequena quantidade de solução, como um método apropriado para estudar a regeneração e o pré-condicionamento do coração no zebrafish adulto.

Protocol

O cuidado animal e todos os procedimentos animais descritos no seguinte protocolo foram aprovados pelo escritório veterinário Cantonal de Fribourg, Switzerland.

1. ferramentas e soluções para injeções

  1. Puxe os capilares de vidro borossilicato adaptados por microinjeção usando um extrator de agulhas de acordo com a Figura 1a. Armazene capilares puxados em um prato de Petri de 9 cm com os trilhos da argila de modelagem ou da fita adesiva.
  2. Usando tesouras comuns, corte um pedaço de esponja (7 cm x 3 cm x 1 cm) e esculpir uma silhueta de peixe-like em seu meio.
  3. Prepare pequenas alíquotas de solução injetável com as proteínas testadas ou outros compostos. Ajuste sua concentração dependente no ensaio diluindo a substância na solução de sal equilibrada de 1x Hanks (HBSS) complementada com o vermelho de phenol de 10%.
    Nota: Aqui, a concentração da proteína testada foi 100 ng/mL.
  4. Para preparar uma solução conservada em estoque de anestésicos tamponados do tricaina, dissolva 4 g do tricaina em 980 ml da água destilada. Ajuste o pH a 7.0 − 7.4 usando 1 M Tris-HCl pH 9, e encha acima com água a 1.000 mL. Armazene a solução em escuro a 4 ° c.
  5. Para obter a concentração de trabalho dos anestésicos, adicione 1 − 2 ml da solução conservada em estoque do tricaina em 50 ml da água de peixes em um béaker.
    Nota: A concentração de trabalho dos anestésicos do tricaina deve ser preparada recentemente antes do uso.

2. preparação da estação de injecção

  1. Gire sobre o estereomicroscópio com a luz da parte superior e ajuste a ampliação a 16x.
  2. Mergulhe a esponja com água de peixe, coloque-a em um prato de Petri de 9 cm no estágio do microscópio e ajuste o foco.
  3. o stereomicroscope, corte a extremidade de um microcapilar em ~ 7 milímetros da base usando uma tesoura Iridectomia como mostrado na Figura 1a. O diâmetro ideal da ponta seria ~ 20 μm.
    Nota: Cortando a ponta do capilar de forma oblíqua é ideal para inserções no tecido.
  4. Insira o microcapilar no suporte da agulha do aparelho microinjetor.
  5. Usando pontas do microloader, carregue uma solução do controle (por exemplo, 1x HBSS) para ajustar acima a pressão da injeção, a fim obter o fluxo apropriado que varia entre 0,3 μL/s e 0,5 μL/s. Esvazie a agulha.
  6. Carregar o volume selecionado da solução de injeção (por exemplo, fator neurotrófico ciliar [CNTF] diluído em 1x HBSS) na ponta do capilar (Figura 1b). Não deve haver bolha de ar no capilar.
    Nota: O volume máximo de solução de injecção depende do tamanho dos peixes. Para um comprimento padrão de 2,5 − 3 cm (distância do foco ao pedúnculo caudal), o volume máximo de injeção que previne inchaço torácico exessivo e sangramento foi determinado como sendo 5 μL (Figura 1F). Volumes maiores podem ser injetados em peixes maiores.

3. preparação do peixe para injeção intratorácica

  1. Pegue um zebrafish adulto (Danio rerio) com uma rede e transferi-lo para a solução anestésica.
  2. Após 1 − 2 min, quando o peixe pára de nadar e o movimento do opérculo é reduzido, toque o peixe com uma colher de plástico para se certificar de que não reage a qualquer contato.
  3. Transfira rápida e cuidadosamente o peixe com a colher para o sulco da esponja molhada, com o lado ventral para cima. A cabeça do peixe deve apontar para longe da mão dominante do operador.

4. microinjeção no pericárdio

  1. o estereomicroscópio, observar cuidadosamente o movimento do coração batendo a pele do peixe. Determine visualmente o ponto de injeção acima do coração pulsante e no meio do triângulo definido pelas placas cartilaginosas ventrais (Figura 1D). Insira a ponta do capilar no ângulo de 30 − 45 ° de grau em relação ao eixo do corpo (Figura 1e). Penetre suavemente a pele com a ponta do microcapilar no pericárdio (Figura 1C). Um ponto de entrada ideal é mais perto do abdômen do que para a cabeça.
    Nota: Não insira o capilar muito profundamente no corpo e no coração, pois isso causará ferimentos no órgão. Em caso de punção cardíaca, a agulha geralmente se enche de sangue. Se isso acontecer, retire o capilar e exclua o peixe do experimento.
  2. Uma vez que a agulha está dentro do pericárdio, injeção completa pressionando o pedal do dispositivo microinjector.
    Nota: Tenha cuidado para não injetar ar na cavidade torácica.
  3. Após a injeção, retire suavemente o capilar do tórax e transfira imediatamente o peixe para um tanque com água do sistema para recuperação.
  4. Monitore o peixe até a recuperação total da anestesia.
  5. Colete o coração no ponto de tempo desejado e prepare-o para uma análise mais aprofundada.
    Nota: No caso de o peixe não retomar o movimento do opérculo dentro de 30 s, reanimar o peixe por espremer água nas brânquias com uma pipeta de plástico.

Representative Results

Após injeções intratorácicas (TI), os efeitos da solução exógena podem ser analisados. Para isso, os peixes devem ser eutanasiados e os corações coletados, fixos e processados histologicamente, de acordo com os protocolos previamente publicados32,33.

Para validar o método, nós executamos primeiramente duas experiências do teste injetando a cor e as tinturas fluorescentes. Primeiramente, nós eutanasiamos peixes e post-mortem injectámos 3 μL de tinta no tórax. Os corações foram coletados após 5 min, lavado em solução salina tampão fosfato (PBS), fixado em formalina a 2%, lavado em PBS e fotografado o microscópio. Em segundo, nós injetamos 3 μL de 1 μg/mL 4 ′, 6-diamidino-2-phenylindole (DAPI) in vivo, e fixa o coração após 2 h. Em ambos os ensaios, a análise de montagem total revelou rotulagem de todo o coração, incluindo o ventrículo, o átrio e o bulbus arterial (Figura 2a, B). Estes resultados revelam a disseminação eficiente da solução injetada na superfície do coração.

Um protocolo comum para a entrega de substâncias exógenas no peixe adulto é a injeção intraperitoneal (IP). Para comparar a adequação das injeções de ti versus IP para estudos cardíacos, injetamos uma quantidade semelhante de DAPI usando ambos os métodos e fixámos os corações após 5 min e 120 min (Figura 3a). Os corações foram seccionados e corados com faloidina Alexa fluor (AF) 568 que rótulos F-Actina no músculo cardíaco. Não foram observadas células DAPI positivas nos corações após a injeção de IP em ambos os momentos (Figura 3B). Por outro lado, a injeção de ti resultou na presença de núcleos rotulados com DAPI no miocárdio (Figura 3B). Estes resultados demonstram que a injeção de ti melhorou a entrega do composto para o coração, em comparação com a injeção IP.

Para testar a adequação deste método para estudos de regeneração cardíaca, nós crioferidos ventrículos8e executamos injeções de ti de 3 μL de 1 μg/ml de DAPI e 1 μg/ml de faloidina AF649 aos 3 e 7 dias pós-criotrauma (DPCI) (figura 4a). Em 1 h após a injeção, os corações foram coletados, fixos, seccionados e corados com faloidina AF568 para visualizar o miocárdio intacto. Verificou-se que tanto o miocárdio quanto o tecido lesionado continham numerosas células DAPI positivas, indicando uma penetração eficiente desse corante no coração intacto e no tecido fibrótico (Figura 4B). Além disso, o faloidina injetado AF649 foi incorporado igualmente por cardiomiócitos da zona do Peri-ferimento e de alguns fibroblasto recrutados da área ferida. Este experimento revela que os fármacos podem atravessar o epicárdio e penetrar no miocárdio subjacente.

Após testar a eficiência das injeções de ti usando corantes, analisamos os efeitos das proteínas injetadas no coração. Nós sintetizado um cytokine, chamado CNTF, que é upregulated após o toracotomia24. Investigaram-se os efeitos da CNTF exógena em vários processos, ou seja, proliferação de cardiomiócitos, deposição de matriz extracelular, recrutamento de células imunológicas e expressão gênica cardioprotetora. Verificou-se que todos esses aspectos biológicos foram ativados por injeção de ti de CNTF, em comparação com as imunoglobulinas de controle (Figura 5)24. Estes resultados demonstram que o método da injeção intratorácica fornece uma estratégia apropriada para a entrega alvejada das proteínas para estudar seus efeitos em tecidos distintos do coração em uma variedade de ensaios.

Figure 1
Figura 1: injeção Intrathorascic (IT) em zebrafish adulto. (A) fotografia de um capilar de microinjeção puxado com filamento (6 ", 1,0 mm de diâmetro) e valores do programa de extrator de agulhas usado. (B) fotografia de um capilar de microinjeção puxado com filamento (6 ", 1,0 mm de diâmetro) preenchido com 2,5 μL de solução contendo 10% de fenol vermelho. A ponta puxada da agulha é maximamente 7 milímetros de comprimento. (C) representação esquemática do procedimento de injeção de ti. (D) fotografias do procedimento de injeção de ti. Este número foi modificado a partir de Bise et al.24. Os números nos painéis C e D correspondem às mesmas etapas do procedimento: (1) o peixe é colocado lado ventral em uma esponja umidificada. O local de punção (ponto vermelho no triângulo) está localizado no centro do tórax perto das guelras. (2) penetração da agulha no pericárdio. Ponto vermelho indica local de punção. (3) a injeção é monitorada observando-se a disseminação da solução vermelha na cavidade pericárdica. (E) esquema de injecção. O ângulo entre o capilar da injeção e a linha central do corpo deve estar entre 30 ° e 45 ° para evitar a punctura do coração. (F) fotografias de tórax de peixe em 1 hora após a injeção de ti de volumes indicados. As setas brancas estão apontando para o tecido redish, o que pode indicar hemorragia interna. Estale por favor aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: soluções injetadas de ti se espalham quase uniformemente na superfície do coração. (A) imagens de stereomicroscope de corações inteiros de peixes submetidos à injeção de ti pós-morte com 2,5 ΜL HBSS ou 2,5 μL de tinta. A tinta manchou a superfície do ventrículo (V), átrio (A) e bulbus arterial (BA). Barra de escala = 300 μm. (B) imagens de campo brilhante e estereomicroscópio fluorescente de corações inteiros de peixes submetidos à injeção de ti com HBSS e 3 μL de 1 μg/ml de DAPI. A fluorescência DAPI é detectada nas partes cardíacas logo após a injeção de ti. Barra de escala = 300 μm. por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: comparação de dois métodos de injeção para a entrega de DAPI ao coração. A) esquema do desenho experimental. Injeções intraperitoneal (IP) e Intrathorascic (TI) foram realizadas com a mesma quantidade de 1 μg/mL de DAPI (3 μL). Os corações foram coletados em 5 e 120 minutos após a injeção. (B) imagens de microscopia confocal de seções cardíacas coradas com faloidina fluorescente (vermelho) que abundantemente rótulos de fibras musculares. A DAPI injetada foi visualizada no canal apropriado mostrado em verde. Após a injeção IP, DAPI não é detectado no coração a qualquer momento. Após a injeção de ti, as células DAPI positivas estão presentes no ventrículo após ambos os pontos de tempo. Barra de escala = 500 μm. por favor clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: injeção de ti para estudar a regeneração do coração. A) esquema do desenho experimental. Aos 3 e 7 dias após a criolesão, uma mistura de DAPI e faloidina AF649 foi injetada por ti (3 μL de 1 μg/ml). Os corações foram coletados 1 hora após a injeção de ti, fixa, seccionada e corada com faloidina AF568 (vermelho). (B) imagens de microscopia confocal de secções cardíacas longitudinais a 3 e 7 DPCI. Injetado DAPI (verde) e faloidina AF649 (azul) células de rótulo da área lesada (delimitado por branco tracejado linha) e o miocárdio intacto (coloração vermelha). As setas brancas estão apontando na distribuição de DAPI (verde) através do miocárdio compacto e trabeculado intacto e do epicardium. Barra de escala = 500 μm. por favor clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: a CNTF exógena injetada em ti estimula vários processos biológicos no coração. A) esquema do desenho experimental. Em primeiro lugar, 2,5 μL de uma solução contendo 250 ng de CNTF zebrafish ou imunoglobulinas de controle (hIgG) foi injetado no pericárdio de peixes transgênicos expressando DsRed2 nucleares em cardiomiócitos. Os corações foram coletados aos 7 e 1 dias após a injeção (DPI) e analisados por imunofluorescência e hibridização in situ, respectivamente. (B-D) Imagens Confocal da microscopia de seções ventriculares do controle e de corações CNTF-injetados. (B) imunocoloração contra um marcador de ciclo celular, componente complexo de manutenção minicromossoma 5 (MCM5; verde), revela um número maior de cardiomiócitos proliferantes em resposta à CNTF exógena. Barra de escala = 500 μm. (C) a imunocoloração contra o colágeno XII mostra aumento da deposição de colágeno XII no miocárdio após a injeção de CNTF. No coração do controle, o colagénio XII é confinado ao epicárdio34. Barra de escala = 500 μm. (D) imunocoloração contra um marcador de células imunes, L-Plastina, detecta um recrutamento melhorado de células imunes no peixe injetado CNTF. Barra de escala = 500 μm. (E) imagens do microscópio do brilhante-campo de seções transversais ventriculares após a hibridação in situ usando uma ponta de prova antisense de mRNA de encontro ao Cystatin, um fator cardioprotetores, indica o upregulation transcricional deste gene no coração de peixes com injeção de CNTF. Barra de escala = 500 μm. Este número foi modificado a partir de Bise et al.24. Estale por favor aqui para ver uma versão maior desta figura.

Discussion

Aqui, nós descrevemos um método para entregar compostos e proteínas exógenas na cavidade pericárdico a fim estudar seus efeitos no coração no zebrafish adulto. O procedimento é baseado na injeção intratorácica, o que resulta na entrega de um pequeno volume de solução nas imediações do órgão. Esta técnica foi desenvolvida e descrita para estudar o precondicionamento cardíaco e a regeneração.

A etapa crítica neste procedimento é a penetração do capilar de vidro na cavidade torácica. Esta etapa depende de três parâmetros que são: a rigidez e a agudeza da ponta capilar, o ângulo da penetração, e o local da punctura. Para otimizar a penetração através da pele, a parte puxada do capilar não deve ser muito longa, como tais agulhas são muito flexíveis e dobrar em contato com a pele. Para evitar isso, a rigidez pode ser adaptada, reduzindo o tamanho da ponta com a Iridectomia tesoura. Embora o ângulo de penetração possa variar entre 30 ° e 45 °, pode ser adaptado à rigidez da ponta. Na verdade, uma ponta fina vai penetrar a pele melhor com um ângulo mais estreito.

A fim de otimizar a penetração da agulha, o local de inserção deve ser imediatamente acima do coração batendo. O risco de punção cardíaca geralmente é baixo variando entre 5% e 8%. A inserção da agulha posterior ao coração aumenta o risco de punção cardíaca, como visto pelo sangramento aumentado. Nesses casos, os animais devem ser removidos dos experimentos.

Outra fonte de problemas durante a injeção de ti ocorre no nível capilar. Na verdade, o capilar pode quebrar quando as forças laterais são exercidas sobre ele. Para evitar isso, a agulha deve mover-se ao longo do eixo de injeção de forma reta. Ocasionalmente, o capilar pode ser obstruído por resíduos do tecido que impedem que o líquido flua. A agulha pode ser desbloqueada retirando suavemente a ponta durante a injecção. Se isto não melhorar o fluxo, recomendamos retirar completamente a agulha do tórax e substituir a agulha.

As lesões podem ser causadas por uma agulha muito profundamente inserida no pericárdio. A fim de evitar lesões no saco pericárdico, a agulha não deve ser inserida muito (1 − 2 mm) no tórax. Alguns vazamentos foram observados quando o volume de injeção foi maior que 8 μL.

Na zebrafish, a composição exata do fluido pericárdico é desconhecida. No entanto, o volume da cavidade pericárdica é estimado em ~ 10 μL31. Dado que o volume do ventrículo adulto do zebrafish é aproximadamente 1 − 2 milímetros3, nós supor que a cavidade pericárdico tem conformemente um volume minúsculo, que tem que ser considerado antes das injeções. De nossos estudos preliminares, nós determinamos que a escala óptima do volume injetado está entre 0,5 e 3 μl para os peixes que medem 2.5 − 2.8 cm (distância do focinho ao pedúnculo caudal). Este volume pode ser adaptado dependendo do tamanho do peixe. A injeção de até 5 μL não induziu nenhuma lesão nos peixes deste tamanho. No entanto, os volumes de 8 μL foram suficientes para causar abaulamento e hemorragia interna, como mostrado na Figura 1F. Com base nesses dados, estimamos que uma quantidade de solução maior que 3 μL pode causar estresse físico e fisiológico no órgão. Esta limitação infere a necessidade de escolher uma concentração mais elevada de moléculas em vez de aumentar a quantidade da solução injetada.

Outro fator importante é a propriedade osmótica da solução injetada, que deve estar na faixa fisiológica. De fato, para evitar um risco de estresse osmótico, recomendamos HBSS como meio de injeção.

Em zebrafish, os métodos comuns usados para entregar drogas são através do tratamento da água e da injeção intraperitoneal30,35. Embora ambas as técnicas sejam apropriadas para muitas aplicações, as injeções de ti proporcionam vantagens experimentais e econômicas, diminuindo os riscos de efeitos colaterais sistêmicos indesejados e reduzindo o uso de moléculas dispendiosas, respectivamente. Este método pode ser adequado para a entrega de tamoxifeno para ativar o sistema transgênico CRE-ERT2 usado para análise de rastreamento de linhagem celular, e orientar RNAs modificadas para estudos funcionais em pesquisa de regeneração.

O método de injeção de it em zebrafish tem sido descrito anteriormente em31de36. Naqueles relatórios, as injeções intratorácicas foram executadas com agulha do insulin, puncionando do lado anterior. Em contrapartida, nosso protocolo apresenta uma estratégia alternativa com o capilar de vidro puxado inserido a partir da direção posterior. Especificamente, nossa abordagem leva em conta a anatomia do pericárdio de peixes para otimizar a injeção com um risco reduzido de punção cardíaca. Além disso, durante o procedimento, o peixe não é mantido por fórceps metálico, mas por uma esponja úmida e macia, que é um método mais adequado para evitar qualquer ferimento externo do peixe. Assim, o método apresentado pode ser mais adequado para estudos de homeostase cardíaca, pré-condicionamento e regeneração em zebrafish adulto.

As injeções de ti já foram estabelecidas em organismos modelo de mamíferos. De fato, este método também foi aplicado em experimentos com suínos e estudos clínicos em humanos37,38. Em camundongos, injeções intramiocárdicas transtorácicas guiadas por ultra-sons têm sido usadas para desafiar seu coração39. Dentro deste artigo, propomos um protocolo detalhado para facilitar o uso da injeção de ti para o zebrafish. Isto será particularmente valioso para o campo, a fim de complementar as abordagens genéticas na homeostase cardíaca, pré-condicionamento e pesquisa de regeneração.

Disclosures

Os autores não têm nada a divulgar.

Acknowledgments

Agradecemos a V. Zimmermann pela excelente assistência técnica e pelo cuidado dos peixes, D. König (Universidade de Friburgo) para a leitura crítica do manuscrito, D. Kressler (Universidade de Friburgo) para ajuda com a síntese proteica zCNTF, F. Ruggiero (Institut de Génomique Fonctionnelle de Lyon) para fornecer o anticorpo de ColXII, e P. Martin (Universidade de Bristol) para o anticorpo de L-plastin. Agradecemos a instalação de núcleo de imagem e a plataforma de proteômica da Universidade de Friburgo. Este trabalho foi apoiado pela Swiss National Science Foundation, Grant Number 310030_179213, e pelo Schweizerische Herzstiftung (Swiss Heart Foundation).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics