Intrathoracale injectie voor de studie van volwassen zebravis hart

Biology
 

Summary

Deze methode baseert zich op de injectie van 0.5 − 3 l van oplossing in de thorax van volwassen zebravis. De procedure levert efficiënt proteïnen en chemische samenstellingen in de nabijheid van het zebravis hart zonder het orgaan te beschadigen. De aanpak is geschikt voor het testen van effecten van exogene factoren op verschillende weefsels van het hart.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De volwassen zebravis hart biedt een krachtig model in cardiale regeneratie onderzoek. Hoewel de sterkte van dit systeem is gebaseerd op transgene benaderingen, een snelle levering van exogene factoren biedt een complementaire techniek in functionele studies. Hier presenteren we een methode die berust op toediening van een paar microliter van de oplossing in de pericardiale holte zonder dat myocard schade. Intrathoracale (IT)-injecties kunnen eiwitten en chemische verbindingen op efficiënte wijze rechtstreeks op het hart oppervlak leveren. De ingespoten stoffen diffuse door de epicardium in de onderliggende cardiale weefsels. Vergeleken met intraperitoneale (IP) injecties, het belangrijkste voordeel van intrathoracale injecties is de focale toediening van de geteste factoren op het doelorgaan. De levering van moleculen direct in de pericardium is een geschikte strategie voor de studies van cardiale preconditionering en regeneratie bij volwassen zebravis.

Introduction

Onder gewervelde dieren, zebravis bezit een opmerkelijke capaciteit om hun harten te regenereren1,2. Dit vermogen is gemeld in verschillende schade modellen, namelijk ventriculaire Apex resectie, cryoinjury (CI) en genetische cardiomyocyte ablatie3,4,5,6,7. Na invasieve verwondingen, de beschadigde wand van het ventrikel wordt tijdelijk genezen door fibrotische weefsel, die geleidelijk wordt vervangen door een nieuwe myocardium8,9,10,11. De vroege wond helende reactie impliceert epicardium activering en rekrutering van immune cellen12,13,14,15. Gelijktijdig, cardiomyocytes in de buurt van de gewonde myocardium worden geactiveerd, dedifferentiëren, vermenigvuldigen en geleidelijk vervangen van de gewonde gebied binnen 30 − 90 dagen16,17,18, 19. aanzienlijke vooruitgang bij het ontcijferen van de moleculaire en cellulaire mechanismen van cardiale regeneratie is bereikt dankzij de beschikbaarheid van genetische hulpmiddelen, zoals Cell-Lineage tracing analyse, afleidbaar gen overexpressie, fluorescente de verslaggever lijnen van het weefsel, en scherper/Cas9 gen mutagenese20,21.

We hebben onlangs een model van cardiale voorwaarden in de volwassen zebravis door Thoracotomie22,23. Voor conditionering verhoogt de expressie van cardioprotectief genen en verheft de re-entry in de celcyclus in de intacte en regenererende harten. Deze processen worden geassocieerd met de aanwerving van immuun cellen en matrix remodeling22,24. De mechanismen van preconditionering zijn slecht begrepen, en de invoering van nieuwe technieken is nodig om dit gebied van onderzoek te bevorderen. In het bijzonder, geoptimaliseerde toediening van afgescheiden signalering eiwitten of andere chemische verbindingen is van essentieel belang om verder te onderzoeken dit onderwerp.

Als aquatische dieren, zebravis kan natuurlijk absorberen verschillende stoffen opgelost in water door hun kieuwen en huid. Dit biedt een mogelijkheid voor niet-invasieve druglevering door onderdompeling van vissen in oplossingen met diverse chemische producten, zoals farmacologische inhibitors, steroïde hormonen, tamoxifen, BrdU en antibiotica. Talrijke studies van verschillende laboratoria, waaronder onze25,26,27, hebben immers gebruik gemaakt van deze methode, die bijzonder waardevol is op het gebied van de regeneratieve biologie6, 28. deze benadering is echter niet geschikt voor de levering van peptiden, DNA, RNA, morpholinos of moleculen met een beperkte weefsel doorlaatbaarheid. In deze gevallen, een efficiëntere levering wordt bereikt door de Microinjection in het lichaam, bijvoorbeeld door het plaatsen van de capillaire in de retro-orbitale veneuze sinus, in de intraperitoneale of intrapericardial holte29,30, 31. Hier beschrijven we een procedure van intrathoracale injectie van een kleine hoeveelheid van de oplossing, als een geschikte methode om hart regeneratie en het voorspelen van onderzoek in volwassen zebravis.

Protocol

De Dierenzorg en alle dier procedures die in het volgende protocol zijn beschreven, zijn goedgekeurd door het Cantonal Veterinair Bureau van Fribourg, Zwitserland.

1. tools en oplossingen voor injecties

  1. Trek Microinjection-aangepaste borosilicaatglas glazen capillairen met behulp van een naald trekker volgens Figuur 1a. Winkel getrokken haarvaten in een 9 cm Petri schaaltje met rails van modellering klei of plakband.
  2. Met behulp van gemeenschappelijke schaar, snijd een stuk spons (7 cm x 3 cm x 1 cm) en carve een vis-achtige silhouet in het midden.
  3. Bereid kleine hoeveelheid injectie-oplossing met de geteste eiwitten of andere verbindingen. Pas hun concentratie afhankelijk van de assay door het verdunnen van de stof in 1x Hanks evenwichtige zoutoplossing (Peeters) aangevuld met 10% fenol rood.
    Opmerking: Hier, de concentratie van het geteste eiwit was 100 ng/mL.
  4. Ter voorbereiding van een stockoplossing van gebufferde tricaine verdovingsmiddelen, Los 4 g van tricaine in 980 mL gedestilleerd water. Pas de pH aan op 7,0 − 7.4 met 1 M Tris-HCl pH 9, en vul met water tot 1.000 mL. Bewaar de oplossing in het donker bij 4 °C.
  5. Voor het verkrijgen van de werk concentratie van verdovingsmiddelen, voeg 1 − 2 mL tricaine voorraad oplossing in 50 mL vis water in een bekerglas.
    Opmerking: De werk concentratie van tricaine verdovingsmiddelen moet vers worden bereid voor gebruik.

2. voorbereiding van het injectie station

  1. Zet de stereomicroscoop met het licht van de top en aan te passen vergroting tot 16x.
  2. Week de spons met vis water, plaats het op een 9 cm Petri schaaltje op de Microscoop podium en pas focus.
  3. Onder de stereomicroscoop, snijd het uiteinde van een microcapillaire op ~ 7 mm van de basis met behulp van een iridectomy schaar zoals weergegeven in Figuur 1a. De ideale tip diameter zou ~ 20 µm.
    Opmerking: Het snijden van de punt van het capillair op een schuine manier is optimaal voor het inbrengen in het weefsel.
  4. Plaats de microcapillaire in de naaldhouder van het microinjector apparaat.
  5. Met behulp van microloader tips, laad een controle-oplossing (bijv. 1x Peeters) op te zetten de druk van de injectie, om de juiste stroom, variërend tussen 0,3 µ L/s en 0,5 µ L/s. leeg de naald te verkrijgen.
  6. Laad het geselecteerde volume van de injectie oplossing (bijv. tril neurotrophic factor [CNTF] verdund in 1x Peeters) in het uiteinde van het capillair (Figuur 1b). Er mag geen lucht zeepbel in het capillair.
    Opmerking: Het maximale volume van de injectie oplossing is afhankelijk van de grootte van de vis. Voor een standaard lengte van 2.5 − 3 cm (afstand van de snuit tot de caudale Steel), het maximale injectie volume dat exessive thoracale zwelling en bloeden voorkomt, werd vastgesteld op 5 µ L (Figuur 1f). Grotere volumes kunnen worden geïnjecteerd om grotere vissen.

3. voorbereiding van de vis voor intrathoracale injectie

  1. Catch een volwassen zebravis (Danio rerio) met een netto en breng het in de verdoving oplossing.
  2. Na 1 − 2 min, wanneer de vissen ophoudt zwemmend en de beweging van operculum wordt verminderd, raak de vissen met een plastic lepel om ervoor te zorgen het niet aan om het even welk contact reageert.
  3. Snel en zorgvuldig de overdracht van de vis met de lepel in de groef van de natte spons, met buikkant naar boven. Het hoofd van de vis moet wijzen weg van de dominante van de exploitant-hand.

4. Microinjection in de pericardium

  1. Onder de stereomicroscoop, zorgvuldig observeren de beweging van het kloppend hart onder de huid van de vis. Visueel bepalen van de injectiepunt boven het kloppend hart en in het midden van de driehoek gedefinieerd door de buik kraakbeen platen (figuur 1d). Plaats het uiteinde van het capillair op een hoek van 30 − 45 ° ten opzichte van de lichaamsas (Figuur 1e). Doordring de huid voorzichtig met de punt van de microcapillaire in de pericardium (figuur 1c). Een optimaal ingangspunt is dichter aan de buik dan aan het hoofd.
    Opmerking: Steek het capillair niet te diep in het lichaam en het hart, omdat dit zal leiden tot letsel aan het orgel. In het geval van een hart punctie, de naald in het algemeen vult met bloed. Als dit gebeurt, verwijder het capillair en sluit de vis uit het experiment.
  2. Zodra de naald binnen de pericardium, volledige injectie door het indrukken van de pedaal van de microinjector apparaat.
    Opmerking: Wees voorzichtig niet om de lucht te injecteren in de thoracale holte.
  3. Na injectie, trek zachtjes het capillair van de thorax en breng de vis onmiddellijk in een tank met systeem water voor herstel.
  4. Monitor de vis tot het totale herstel van de anesthesie.
  5. Verzamel hart op het gewenste tijdstip en bereid het voor op verdere analyse.
    Opmerking: In het geval de vis niet hervat beweging van de Operculum binnen 30 s, reanimeren de vis door te knijpen water in de kieuwen met een plastic pipet.

Representative Results

Na intrathoracale (IT) injecties kunnen de effecten van exogene oplossing geanalyseerd worden. Voor dit doel, de vis moet worden euthanized en de harten verzameld, vast en histologisch verwerkt, volgens eerder gepubliceerde protocollen32,33.

Om de methode te valideren, hebben we eerst twee test experimenten uitgevoerd door het injecteren van kleur en fluorescerende verfstoffen. Ten eerste, we euthanized vis en post-mortem geïnjecteerd 3 µ L inkt in de thorax. De harten werden verzameld na 5 min, gewassen in fosfaat-gebufferde zoutoplossing (PBS), vast in 2% formaline, gewassen in PBS en gefotografeerd onder de Microscoop. Ten tweede hebben we geïnjecteerd 3 µ L van 1 µ g/mL 4 ′, 6-diamidino-2-phenylindole (DAPI) in vivo, en vast het hart na 2 uur. In beide analyses, whole-Mount analyse bleek etikettering van het hele hart met inbegrip van het ventrikel, het atrium en de bulbus arteriosus (Figuur 2a, B). Deze resultaten onthullen een efficiënte verspreiding van de geïnjecteerde oplossing op het hart oppervlak.

Een gemeenschappelijk protocol voor de levering van exogene stoffen in de volwassen vis is intraperitoneale (IP) injectie. Om de geschiktheid van het versus IP injecties voor de studies van het hart te vergelijken, injecteerde wij een gelijkaardige hoeveelheid DAPI gebruikend beide methodes en bevestigden de harten na 5 min en 120 min (Figuur 3a). De harten werden doorsnede en gekleurd met phalloidin Alexa Fluor (AF) 568 dat de etiketten F-actine in hartspier. Geen DAPI-positieve cellen werden waargenomen in de harten na IP injectie op beide tijdpunten (Figuur 3b). De injectie resulteerde daarentegen in de aanwezigheid van DAPI kernen in de myocardium (Figuur 3b). Deze resultaten tonen aan dat het injectie verbeterde de levering van de verbinding naar het hart, in vergelijking met de IP-injectie.

Voor het testen van de geschiktheid van deze methode voor hart regeneratie studies, we cryoinjured ventrikels8, en voerde het injecties van 3 µ l van 1 µ g/ml DAPI en 1 µ g/ml phalloidin AF649 op 3 en 7 dagen post-cryoinjury (dpci) (figuur 4a). Bij 1 h post-injectie, werden de harten verzameld, vast, sectie en bevlekt met phalloidin AF568 om de intacte myocardium te visualiseren. We vonden dat zowel de myocardium en het gewonde weefsel bevatte tal van DAPI positieve cellen, met vermelding van een efficiënte penetratie van deze kleurstof in de intacte hart en fibrotische weefsel (figuur 4b). Bovendien werd geïnjecteerde phalloidin AF649 ook opgenomen door cardiomyocytes van de peri-blessure zone en een aantal aangeworven fibroblasten van het gewonde gebied. Dit experiment laat zien dat de drugs de epicardium kunnen passeren en doordringen in de onderliggende myocardium.

Na het testen van de efficiëntie van het injecties met behulp van kleurstoffen, analyseerden we de effecten van geïnjecteerde eiwitten op het hart. We synthetized een cytokine, genaamd CNTF, die is upgereguleerd na Thoracotomie24. We onderzochten de effecten van de exogene CNTF op verschillende processen, namelijk cardiomyocyte proliferatie, extracellulaire matrix depositie, immune Cell recruitment en cardioprotectief genexpressie. We vonden dat al deze biologische aspecten werden geactiveerd door het injecteren van CNTF, in vergelijking met de controle immunoglobulinen (Figuur 5)24. Deze resultaten tonen aan dat de methode van intrathoracale injectie een geschikte strategie voor gerichte levering van proteïnen verstrekt om hun gevolgen voor verschillende hart weefsels in een verscheidenheid van analyses te bestuderen.

Figure 1
Figuur 1: Intrathorascic (IT) injectie bij volwassen zebravis. (A) foto van een getrokken microinjectie capillaire met gloeidraad (6 ", 1,0 mm in diameter) en de waarden van de gebruikte naald trekker programma. (B) foto van een getrokken microinjectie capillaire met gloeidraad (6 ", 1,0 mm in diameter) gevuld met 2,5 µ l van oplossing met 10% fenol rood. Het getrokken uiteinde van de naald is maximaal 7 mm lang. Cschematische weergave van de IT-injectie procedure. Dfoto's van de IT-injectie procedure. Dit cijfer is gewijzigd van Bise et al.24. Getallen in deelvensters C en D komen overeen met dezelfde stappen van de procedure: (1) vis wordt geplaatst buikzijde omhoog op een bevochtigde spons. De punctie site (rode stip in de driehoek) is gelegen in het midden van de borst bij de kieuwen. (2) penetratie van de naald in de pericardium. Rode stip geeft prik site. (3) de injectie wordt gecontroleerd door de verspreiding van de rode oplossing in de pericardiale holte te observeren. (E) regeling van de IT-injectie. De hoek tussen de injectie capillaire en de lichaamsas moet tussen 30 ° en 45 ° zijn om hart punctie te voorkomen. (F) foto's van vis thorax op 1 uur na het injecteren van de aangegeven volumes. Witte pijlen wijzen op de redish weefsel, die kunnen duiden interne bloeden. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: het injecteerde oplossingen die bijna uniform op de hart oppervlakte worden uitgespreid. (A) stereomicroscoop beelden van hele harten van vissen onderworpen aan post-mortem-injectie met 2,5 µ l peeters of 2,5 µ l inkt. Inkt gekleurd het oppervlak van het ventrikel (V), Atrium (A) en bulbus arteriosus (BA). De staaf van de schaal = 300 µm. (B) helder-gebied en fluorescente stereomicroscoop beelden van gehele harten van vissen onderworpen aan het injectie met Peeters en 3 µ l van 1 µ g/ml DAPI. DAPI fluorescentie wordt gedetecteerd op de hart delen kort na het injecteren. Schaalbalk = 300 µm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: vergelijking van twee injectie methoden voor de levering van DAPI naar het hart. Aschema van het experimentele ontwerp. Intraperitoneale (IP) en Intrathorascic (IT) injecties werden uitgevoerd met hetzelfde bedrag van 1 µ g/mL DAPI (3 µ L). De harten werden verzameld bij 5 en 120 min na injectie. (B) confocale microscopie beelden van hart secties gekleurd met fluorescerende phalloidin (rood) dat overvloedig etiketten spiervezels. Geïnjecteerde DAPI werd gevisualiseerd in het juiste kanaal weergegeven in het groen. Na IP-injectie, DAPI wordt niet gedetecteerd in het hart op elk moment punt. Na het injecteren, DAPI positieve cellen aanwezig zijn in het ventrikel na beide tijdpunten. Schaalbalk = 500 µm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: het injecteren om te studeren hart regeneratie. Aschema van het experimentele ontwerp. Op 3 en 7 dagen na cryoinjury, een mix van DAPI en phalloidin AF649 was het-geïnjecteerd (3 µ L van 1 µ g/mL). De harten werden verzameld 1 uur na het injectie, vast, sectie en bevlekt met phalloidin AF568 (rood). (B) confocale microscopie beelden van longitudinale hart secties bij 3 en 7 dpci. Geïnjecteerde DAPI (groen) en phalloidin AF649 (blauw) label cellen van het benadeelde gebied (begrensd door witte stippellijn) en de intacte myocardium (rode kleuring). Witte pijlen wijzen op DAPI (groen) verdeling door intact compact en trabeculated myocardia en de epicardium. Schaalbalk = 500 µm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: EXOGENE it-geïnjecteerde CNTF stimuleert verschillende biologische processen in het hart. Aschema van het experimentele ontwerp. Ten eerste 2,5 µ L van een oplossing met 250 ng van zebravis CNTF of controle immunoglobulinen (hIgG) werd geïnjecteerd in de pericardium van transgene vis uitdrukken van nucleaire DsRed2 in cardiomyocytes. De harten werden verzameld bij 7 en 1 dagen post-injectie (dpi) en werden geanalyseerd door immunofluorescentie en in situ kruising, respectievelijk. (B-D) Confocale microscopie beelden van ventriculaire secties van controle en CNTF-geïnjecteerde harten. (B) immunokleuring tegen een celcyclus, minichromosome onderhouds complex onderdeel 5 (MCM5; groen), onthult een groter aantal proliferatie cardiomyocytes in reactie op exogene CNTF. Scale Bar = 500 µm. (C) immunokleuring tegen collageen XII toont verhoogde afzetting van collageen XII in de MYOCARDIUM na CNTF injectie. In het hart van de controle, collageen XII is beperkt tot de epicardium34. De staaf van de schaal = 500 µm. (D) immunokleuring tegen een immune cel teller, L-plastin, ontdekt een verbeterde rekrutering van immune cellen in de CNTF ingespoten vissen. Schaal Bar = 500 µm. (E) Bright-veld Microscoop beelden van ventriculaire dwarsdoorsneden na in situ hybridisatie met behulp van een antisense mRNA sonde tegen cystatin, een cardioprotectief factor, geeft transcriptie upregulering van dit gen in het hart van CNTF-geïnjecteerde vis. Schaalbalk = 500 µm. Dit cijfer is gewijzigd van Bise et al.24. Klik hier om een grotere versie van dit cijfer te bekijken.

Discussion

Hier beschrijven we een methode voor het leveren van exogene verbindingen en eiwitten in de pericardiale Holte om hun effecten op het hart in volwassen zebravis te bestuderen. De procedure is gebaseerd op intrathoracale injectie, wat resulteert in de levering van een klein volume van de oplossing in de nabijheid van het orgel. Deze techniek werd ontwikkeld en beschreven voor het bestuderen van cardiale voorwaarden en regeneratie.

De kritieke stap in deze procedure is de penetratie van het glas capillair in de thoracale holte. Deze stap hangt af van drie parameters die zijn: de stijfheid en de scherpte van de capillaire tip, de hoek van penetratie, en de punctie site. Om de penetratie door de huid te optimaliseren, zou het getrokken deel van het capillair niet te lang moeten zijn, aangezien dergelijke naalden te flexibel zijn en in contact met de huid buigen. Om dit te voorkomen, kan de stijfheid worden aangepast door het verminderen van de tip grootte met de iridectomy schaar. Hoewel de hoek van penetratie kan variëren tussen 30 ° en 45 °, kan het worden aangepast aan de stijfheid van de tip. Inderdaad, een dunne tip zal doordringen van de huid beter met een smallere hoek.

Om de naald penetratie te optimaliseren, zou de plaatsings plaats onmiddellijk boven het kloppende hart moeten zijn. Het risico op hart punctie is meestal laag tussen 5% en 8%. Het inbrengen van de naald posterior aan het hart verhoogt het risico van hart punctie, zoals gezien door verbeterde bloeden. In dergelijke gevallen moeten de dieren uit de experimenten worden verwijderd.

Een andere bron van problemen tijdens de IT-injectie optreedt op het capillair niveau. Inderdaad het capillair kan breken wanneer laterale krachten worden uitgeoefend op. Om dit te voorkomen, moet de naald bewegen langs de as van de injectie op een rechte manier. Af en toe kan de capillaire worden geblokkeerd door weefsel residuen die de vloeistof te voorkomen stromen. De naald kan worden gedeblokkeerd door voorzichtig intrekking van de tip, terwijl injecteren. Als dit de stroom niet verbetert, raden wij u aan de naald van de borstkas volledig in te trekken en de naald te vervangen.

De letsels kunnen door een te diep opgenomen naald in pericardium worden veroorzaakt. Om letsels in de pericardiale zak te vermijden, moet de naald niet te veel (1 − 2 mm) in de thorax worden opgenomen. Sommige lekken werden waargenomen wanneer het injectie volume was groter dan 8 µ L.

In zebravis, de exacte samenstelling van de pericardiale vloeistof is onbekend. Echter, het volume van de pericardiale holte wordt geschat op ~ 10 µ L31. Aangezien het volume van de volwassen zebravis ventrikel ongeveer 1 − 2 mm3is, veronderstellen wij dat de pericardiale holte dienovereenkomstig een uiterst klein volume heeft, dat vóór injecties moet worden overwogen. Uit onze voorbereidende studies, hebben we vastgesteld dat het optimale bereik van het geïnjecteerde volume is tussen de 0,5 en 3 µ L voor vissen meten 2,5 − 2,8 cm (afstand van de snuit naar de caudale Steel). Dit volume kan worden aangepast afhankelijk van de grootte van de vis. De injectie van tot 5 µ L veroorzaakte geen letsel in de vissen van deze grootte. Echter, volumes van 8 µ L waren voldoende om te veroorzaken uitpuilende en interne bloeden zoals weergegeven in Figuur 1f. Op basis van deze gegevens schatten we dat een hoeveelheid oplossing groter dan 3 µ L fysieke en fysiologische stress op het orgel kan veroorzaken. Deze beperking concludeert de noodzaak om een hogere concentratie van moleculen te kiezen in plaats van het verhogen van de hoeveelheid van de geïnjecteerde oplossing.

Een andere belangrijke factor is het osmotische bezit van de ingespoten oplossing, die in de fysiologische waaier zou moeten zijn. Inderdaad, om een risico van osmotische stress te voorkomen, raden wij Peeters als injectie medium.

In zebravis, de gemeenschappelijke methoden die worden gebruikt om drugs te leveren zijn door middel van waterbehandeling en intraperitoneale injectie30,35. Hoewel beide technieken zijn geschikt voor vele toepassingen, het injecties bieden experimentele en economische voordelen, door het verminderen van de Risico's van ongewenste systemische bijwerkingen en het verminderen van het gebruik van dure moleculen, respectievelijk. Deze methode kan geschikt zijn voor de levering van Tamoxifen het activeren van de CRE-ERT2 transgene systeem wordt gebruikt voor cel Lineage tracing analyse, en gids gemodificeerde ASE voor functionele studies in regeneratie onderzoek.

De IT-injectie methode in zebravis is eerder beschreven31,36. In deze rapporten, intrathoracale injecties werden uitgevoerd met insuline naald, prikken van de voorste zijde. In tegenstelling, ons protocol presenteert een alternatieve strategie met het getrokken glas capillaire ingevoegd uit de achterste richting. Concreet, onze aanpak houdt rekening met de anatomie van de vis pericardium om de injectie te optimaliseren met een verminderd risico op hart punctie. Bovendien, tijdens de procedure, is de vis niet in het bezit van metalen Tang, maar door een vochtige en zachte spons, dat is een meer geschikte methode om een externe verwonding van de vis te voorkomen. Aldus, zou de voorgestelde methode beter geschikt kunnen zijn voor studies van cardiale homeostase, het conditioneren en regeneratie in volwassen zebravis.

De injecties zijn reeds in zoogdier modelorganismen vastgesteld. Inderdaad, deze methode is ook toegepast in experimenten met varkens en klinische studies bij de mens37,38. Bij muizen, transthoracale intramyocardial injecties geleid door echografie zijn gebruikt om hun hart39uitdaging. Binnen dit artikel stellen wij een gedetailleerd protocol voor om het gebruik van de injectie van IT voor zebravis te verlichten. Dit zal bijzonder waardevol zijn voor het gebied, om een aanvulling op genetische benaderingen in cardiale homeostase, preconditionering en regeneratie onderzoek.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken V. Zimmermann voor uitstekende technische bijstand en voor de verzorging van vissen, D. König (Universiteit van Fribourg) voor het kritisch lezen van het manuscript, D. Kressler (Universiteit van Fribourg) voor hulp bij zCNTF eiwitsynthese, F. Ruggiero (Institut de Génomique Fonctionnelle de Lyon) voor het verstrekken van ColXII antilichaam, en P. Martin (Universiteit van Bristol) voor L-plastin antilichaam. Wij danken de Imaging Core Facility en het Proteomics platform aan de Universiteit van Fribourg. Dit werk werd ondersteund door de Zwitserse National Science Foundation, Grant Number 310030_179213, en door de Schweizerische Herzstiftung (Swiss Heart Foundation).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics