Intrathorakische Injektion für die Erforschung des erwachsenen Zebrafischherz

Biology
 

Summary

Diese Methode basiert auf der Injektion von 0,5 − 3 μL der Lösung in den Thorax von erwachsenen Zebrafischen. Das Verfahren liefert Proteine und chemische Verbindungen effizient in die Nähe des Zebrafisch-Herzens, ohne das Organ zu beschädigen. Der Ansatz eignet sich für die Untersuchung von Wirkungen exogener Faktoren auf verschiedene Gewebe des Herzens.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Das erwachsene Zebrafischherz ist ein leistungsfähiges Modell in der Herzregenerationsforschung. Obwohl die Stärke dieses Systems auf transgenen Ansätzen beruht, bietet eine schnelle Lieferung exogener Faktoren eine komplementäre Technik in funktionellen Studien. Hier stellen wir eine Methode vor, die auf die Verabreichung von wenigen Mikrolitern der Lösung in die Perikardhöhle setzt, ohne Myokardschäden zu verursachen. Intrathorakische (IT) Injektionen können Proteine und chemische Verbindungen effizient direkt auf die Herzoberfläche liefern. Die injizierten Stoffe diffundieren durch das Epizentrum in das darunter liegende Herzgewebe. Im Vergleich zu Intraperitoneal-Injektionen (IP) ist der Hauptvorteil der intrathorakischen Injektionen die fokale Verabreichung der getesteten Faktoren am Zielorgan. Die Zufuhr von Molekülen direkt ins Perikardium ist eine geeignete Strategie für Studien zur Herzpräkonditionierung und Regeneration bei erwachsenen Zebrafischen.

Introduction

Unter Wirbeltieren besitzen Zebrafische eine bemerkenswerte Fähigkeit, ihr Herz 1,2 zu regenerieren. Diese Fähigkeit wurde in mehreren Verletzungsmodellen berichtet, nämlich ventrikuläre Aschnittrressreektion, Kryoinjury (CI) und genetische Kardiomyozyten-Ablation3,4, 5, 6,7. Nach invasiven Verletzungen wird die beschädigte Wand der Herzkammer durch fibrotisches Gewebe vorübergehend geheilt, das nach und nach durch ein neues Myokardium8,9,10,11 ersetzt wird. Die frühe Wundheilungsreaktion beinhaltet die Epilzaktivierung und die Rekrutierung von Immunzellen12,13, 14,15. Gleichzeitig werden Kardiomyozyten in der Nähe des verletzten Myokardiums aktiviert, dedifferenziert, vermehrt und ersetzen den verwundeten Bereich innerhalb von 30 − 90 Tagen16, 17,18, 19. Durch die Verfügbarkeit von genetischen Werkzeugen, wie z. B. Zelllinie, Nachdruck, induzierbare Genüberexpression, wurden erhebliche Fortschritte bei der Entschlüsselung der molekularen und zellulären Mechanismen der Herzregeneration erzielt, Fluoreszenzgewebe-Reporter-Linien, und CRISPR/Cas9 gene Mutagenese20, 21.

Wir haben vor kurzem ein Modell der Herzprägung in den erwachsenen Zebrafischen durch Thorakotomie22,23. Die Vorkonditionierung steigert die Expression von kardioprotektiven Genen und erhöht den Wiedereintritt in den Zellkreislauf in den intakten und regenerierenden Herzen. Diese Prozesse sind mit der Rekrutierung von Immunzellen und Matrix-Umbau22,24verbunden. Die Mechanismen der Vorkonditionierung werden schlecht verstanden, und die Etablierung neuer Techniken ist erforderlich, um diesen Forschungsbereich zu fördern. Insbesondere eine optimierte Verabreichung von ausgeschienen Signalproteinen oder anderen chemischen Verbindungen ist unerlässlich, um dieses Thema weiter zu untersuchen.

Als Wassertiere können Zebrafische auf natürliche Weise verschiedene Substanzen aufnehmen, die durch ihre Kiemen und ihre Haut im Wasser aufgelöst werden. Dies bietet die Möglichkeit, die nicht-invasive Arzneimittelzufuhr durch das Eintauchen von Fischen in Lösungen mit verschiedenen Chemikalien wie pharmakologische Inhibitoren, Steroidhormone, Tamoxifen, BrdU und Antibiotika zu ermöglichen. In der Tat haben zahlreiche Studien aus verschiedenen Labors, darunter unsere 25,26 ,27,dieseMethode, die im Bereich der regenerativen Biologie besonders wertvoll ist, genutzt. 28. Dieser Ansatz ist jedoch nicht geeignet für die Lieferung von Peptiden, DNA, RNA, Morpholinos oder Molekülen mit eingeschränkter Gewebedurchlässigkeit. In diesen Fällen wird eine effizientere Zufuhr durch Mikroinjektion in den Körper erreicht, zum Beispiel durch das Einsetzen der Kapillare in den Retro-orbitalen venösen Sinus,indie intraperitoneale oder intrapericardiale Höhle 29,30, 31. Hier beschreiben wir ein Verfahren der intrathorakischen Injektion einer kleinen Menge von Lösungen, als eine geeignete Methode, um Herzregeneration und Vorkonditionierung in erwachsenen Zebrafischen zu untersuchen.

Protocol

Die Tierpflege und alle tierischen Verfahren, die im folgenden Protokoll beschrieben sind, wurden vom kantonalen Veterinäramt Freiburg, Schweiz, genehmigt.

1. Werkzeuge und Lösungen für Injektionen

  1. Ziehen Sie mikroinjektionsangepasste Borosilikatglaskapillaren mit einem Nadelzieher nach Abbildung 1A. Ziehende Kapillaren in einer 9 cm großen Petrischale mit Schienen aus Modelliermasse oder Klebeband aufbewahren.
  2. Mit der gemeinsamen Schere ein Stück Schwamm (7 cm x 3 cm x 1 cm) schneiden und in der Mitte eine fischähnliche Silhouette schnitzen.
  3. Bereiten Sie kleine Aliquots der Injektionslösung mit den getesteten Proteinen oder anderen Verbindungen vor. Stellen Sie ihre Konzentration abhängig vom Test ab, indem Sie den Stoff in 1x Hanks ausbalancierter Salzlösung (HBSS) verdünnen, ergänzt um 10% Phenolrot.
    NOTE: Hier lag die Konzentration des getesteten Proteins bei 100 ng/mL.
  4. Um eine Bestandslösung der gepufferten Tricaine-Anästhesie vorzubereiten, lösen Sie 4 g Tricaine in 980 ml destilliertem Wasser auf. PH auf 7,0 − 7.4 mit 1 M Tris-HCl pH 9 anbringen und mit Wasser bis 1.000 ml füllen. Die Lösung bei 4 ° C dunkel aufbewahren.
  5. Um die Arbeitskonzentration der Anästhesie zu erhalten, fügen Sie 1 − 2 ml Tricainlager-Lösung in 50 ml Fischwasser in einem Becher.
    NOTE: Die Arbeitskonzentration der Trikaanästik sollte vor dem Gebrauch frisch zubereitet werden.

2. Vorbereitung der Injektionsstation

  1. Schalten Sie das Stereomikroskop mit dem Licht von oben ein und stellen Sie die Vergrößerung auf 16x ein.
  2. Den Schwamm mit Fischwasser einweichen, auf eine 9 cm große Petrischale auf der Mikroskop-Stufe legen und den Fokus einstellen.
  3. Unter dem Stereomikroskop das Ende einer Mikrokapillare mit einer Iridektomie-Schere, wie in Abbildung 1Agezeigt, auf ca. 7 mm von der Basis schneiden. Der ideale Spitzdurchmesser würde ~ 20 μm betragen.
    NOTE: Das Schrägwerden der Kapillarspitze ist optimal für Einfügungen in das Gewebe.
  4. Die Mikrokapillare in den Nadelhalter des Mikroinjektor-Geräts einlegen.
  5. Mit Hilfe von Mikrolader-Spitzen wird eine Steuerungslösung (z.B. 1x HBSS) geladen, um den Injektionsdruck zu erzeugen, um den entsprechenden Durchfluss zwischen 0,3 μL/und 0,5 μL/s zu erhalten.
  6. Laden Sie das ausgewählte Volumen der Injektionslösung (z.B. in 1x HBSS verdünnter, zerklimischer neurotropher Faktor [CNTF]) in die Kapillarspitze(Abbildung 1B). Es sollte keine Luftblase in der Kapillare geben.
    NOTE: Das maximale Volumen der Einspritzlösung hängt von der Größe der Fische ab. Bei einer Standardlänge von 2,5 − 3 cm (Abstandvon der Schnauze zum kaudalen Pedonkel) wurde das maximale Einspritzvolumen, das exzessive Thoraxschwellungen und Blutungen verhindert, auf 5 μL (Abbildung 1F) ermittelt. Größere Mengen könnten zu größeren Fischen injiziert werden.

3. Zubereitung des Fisches für die intrathorakische Injektion

  1. Fangen Sie einen erwachsenen Zebrafisch (Danio rerio)mit einem Netz und übertragen Sie ihn in die Anästhesie-Lösung.
  2. Nach 1 − 2 min, wenn der Fisch aufhört zu schwimmen und die Bewegung des Operculums reduziert wird, berühren Sie die Fische mit einem Plastiklöffel, um sicherzustellen, dass sie nicht auf Kontakt reagieren.
  3. Den Fisch mit dem Löffel schnell und vorsichtig in die Nut des nassen Schwammes mit ventraler Seite nach oben übertragen. Der Kopf der Fische sollte von der dominanten Hand des Betreibers abweichen.

4. Mikroinjektion ins Pericardium

  1. Unter dem Stereomikroskop die Bewegung des schlagenden Herzens unter der Haut der Fische sorgfältig beobachten. Den Injektionspunkt oberhalb des schlagenden Herzens und in der Mitte des Dreiecks, das durch die ventralen knorpeligen Platten definiert wird (Abbildung 1D), bestimmen. Legen Sie die Spitze der Kapillare bei 30 ° 45 ° Grad Winkel im Verhältnis zur Körperachse ein (Abbildung 1E). Mit der Spitze der Mikrokapillare sanft in das Perikardium eindringen (Abbildung 1C). Ein optimaler Einstiegspunkt ist näher am Bauch als am Kopf.
    NOTE: Legen Sie die Kapillare nicht zu tief in den Körper und das Herz, da dies Verletzungen der Orgel verursachen wird. Bei Herzpunktion füllt sich die Nadel in der Regel mit Blut. Wenn dies geschieht, entfernen Sie die Kapillare und schließen Sie die Fische aus dem Experiment.
  2. Sobald sich die Nadel im Perikardium befindet, wird die komplette Injektion durch Drücken des Pedals des Mikroinjektors durchgeführt.
    NOTE: Achten Sie darauf, keine Luft in die Thoraxhöhle zu spritzen.
  3. Nach der Injektion die Kapillare vorsichtig aus dem Brustkorb nehmen und den Fisch sofort in einen Tank mit Systemwasser zur Genesung geben.
  4. Überwachen Sie die Fische bis zur vollständigen Genesung von der Narkose.
  5. Sammeln Sie das Herz zum gewünschten Zeitpunkt und bereiten Sie es für die weitere Analyse vor.
    NOTE: Wenn der Fisch die Bewegung des Operculums nicht innerhalb von 30 Jahren wieder aufnimmt, reanimieren Sie die Fische, indem Sie Wasser mit einer Plastikpipette in die Kiemen pressen.

Representative Results

Nach intrathorakischen (IT) Injektionen können die Wirkungen exogener Lösungen analysiert werden. Dazu sollten die Fische euthanisiert und die Herzen gesammelt, fixiert und histologisch verarbeitet werden, nach den zuvor veröffentlichten Protokollen 32, 33.

Um die Methode zu validieren, haben wir zunächst zwei Testversuche durchgeführt, indem wir Farb-und Fluoreszenzfarbstoffe injizierten. Zuerst haben wir Fische und Post-Mortem 3 μL Tinte in den Thorax injiziert. Die Herzen wurden nach 5 Minuten gesammelt, in phosphatgepufferter Saline (PBS) gewaschen, in 2% Formalin fixiert, in PBS gewaschen und unter dem Mikroskop fotografiert. Zweitens spritzten wir 3 μL von 1 μg/mL 4 ', 6-diamidino-2-Phenylindole (DAPI) in vivo und fixierten das Herz nach 2 Stunden. In beiden Assays ergab die Ganzmondanalyse die Kennzeichnung des gesamten Herzens einschließlich der Herzkammer, des Atriums und des Bulbus-Arteriosus(Abbildung 2A, B). Diese Ergebnisse zeigen eine effiziente Ausbreitung der injizierten Lösung auf der Herzfläche.

Ein gängiges Protokoll für die Lieferung exogener Substanzen in die erwachsenen Fische ist die Intraperitoneal-Injektion (IP). Um die Eignung von IT und IP-Injektionen für Herzstudien zu vergleichen, haben wir eine ähnliche Menge DAPI mit beiden Methoden injiziert und die Herzen nach 5 Minuten und 120 Minuten (Abbildung 3A) fixiert. Die Herzen wurden abgetrennt und mit Phalloidin Alexa Fluor (AF) 568 befleckt, die F-actin im Herzmuskel kennzeichnet. Nach der IP-Injektion an beiden Zeitpunkten wurden in den Herzen keine DAPI-positiven Zellen beobachtet (Abbildung 3B). Im Gegensatz dazu führte die IT-Injektion dazu, dass im Myokardium (Abbildung 3B) DAPI-beschriftete Kerne vorhanden waren. Diese Ergebnisse zeigen, dass die IT-Injektion die Zustellung der Verbindung an das Herz gegenüber der IP-Injektion verbessert hat.

Um die Eignung dieser Methode für Herz-Regenerationsstudien zu testen, haben wir Herzkammern8 Kryoverletzte und IT-Injektionen von 3 μg/mL DAPI und 1 μg/mL Phalloidin AF649 bei 3 und 7 Tagen Nachkryoinjury (dpci) durchgeführt (Abbildung 4A). Bei 1 h Nachspritze wurden die Herzen gesammelt, fixiert, abgetrennt und mit Phalloidin AF568 befleckt, um das intakte Myokardium zu visualisieren. Wir fanden heraus, dass sowohl das Myokardium als auch das verletzte Gewebe zahlreiche DAPI-Positivzellen enthielten, was auf eine effiziente Durchdringung dieses Farbstoffs in das intakte Herz und das fibrotische Gewebe hindeutet (Abbildung 4B). Darüber hinaus wurde Phalloidin AF649 auch von Kardiomyozyten der Peri-Verletzungszone und einigen rekrutierten Fibroblasten des verwundeten Gebietes eingearbeitet. Dieses Experiment zeigt, dass die Medikamente das Epizentrum durchqueren und in das darunter liegende Myokardium eindringen können.

Nachdem wir die Effizienz von IT-Injektionen mit Farbstoffen getestet hatten, analysierten wir die Auswirkungen von injizierten Proteinen auf das Herz. Wir synthetisierten ein Zytokin, CNTF genannt, das nach der Thorakotomie24upreguliert wird. Wir untersuchten die Auswirkungen des exogenen CNTF auf verschiedene Prozesse, nämlich die Kardiomyozytenvermehrung, die extrazelluläre Matrix-Ablagerung, die Rekrutierung von Immunzellen und die kardioprotektive Genexpression. Wir fanden heraus, dass alle diese biologischen Aspekte durch IT-Injektion von CNTF aktiviert wurden, im Vergleich zur Kontrolle von Immunglobulinen (Abbildung5)24. Diese Ergebnisse zeigen, dass die Methode der intrathorakischen Injektion eine geeignete Strategie für die gezielte Lieferung von Proteinen bietet, um ihre Auswirkungen auf verschiedene Herzingewebgewebe in einer Vielzahl von Assays zu untersuchen.

Figure 1
Abbildung 1: Intrathorascic (IT) Injektion bei erwachsenen Zebrafischen. (A) Fotografie einer gezogenen Mikroinjektionskapillare mit Filament (6 ", 1,0 mm Durchmesser) und Werten des verwendeten Nadelziehers. (B) Foto einer gezogenen Mikroinjektionskapillare mit Filament (6 ", 1,0 mm Durchmesser) gefüllt mit 2,5 μL Lösung, die 10% Phenolrot enthält. Die gezogene Nadelspitze ist maximal 7 mm lang. (C) Schematische Darstellung des IT-Einspritzverfahrens. D) Fotos vom IT-Injektionsverfahren. Diese Figur wurde von Bise et al. 24geändert. Die Zahlen in den Panels C und D entsprechen den gleichen Schritten des Verfahrens: (1) Der Fisch wird ventral auf einen befeuchteten Schwamm gelegt. Die Punktionsstelle (roter Punkt im Dreieck) befindet sich in der Mitte der Brust in der Nähe der Kiemen. (2) Penetration der Nadel in das Perikardium. Der rote Punkt zeigt die Punktionsstelle an. (3) Die Injektion wird durch die Beobachtung der Ausbreitung der roten Lösung in der Perikardialhöhle überwacht. (E) Schema der IT-Injektion. Der Winkel zwischen der Injektionskapillare und der Körperachse sollte zwischen 30 ° und 45 ° liegen, um Herzstiche zu vermeiden. (F) Fotos von Fisch Thorax um 1 Stunde nach der IT-Injektion der angegebenen Volumina. Weiße Pfeile zeigen auf das Schülmgewebe, was auf innere Blutungen hindeuten könnte. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figure 2
Abbildung 2: IT-injizierte Lösungen breiten sich nahezu gleichmäßig auf die Herzfläche aus. (A) Stereomikroskopizzbilder ganzer Herzen von Fischen, die einer Post-mortem IT-Injektion mit 2,5 μL HBSS oder 2,5 μL Tinte unterzogen werden. Tinte befleckte die Oberfläche der Ventrikel (V), Atrium (A) und Bulbus arteriosus (Ba). (B) Lichtfeld-und fluoreszierende Stereomikroskop-Bilder ganzer Herzen von Fischen, die mit HBSS und 3 μL von 1 μg/mL DAPI einer IT-Injektion unterzogen werden. Die DAPI-Fluoreszenz wird auf den Herzteilen kurz nach der IT-Injektion erkannt. Skalierbalken = 300 μm.

Figure 3
Abbildung 3: Vergleich zweier Injektionsmethoden für die Lieferung von DAPI an das Herz. A) Schema der experimentellen Gestaltung. Intraperitoneal (IP) und Intrathorascic (IT)-Injektionen wurden mit der gleichen Menge von 1 μg/mL DAPI (3 μL) durchgeführt. Die Herzen wurden mit 5 und 120 Minuten nach der Injektion gesammelt. B) Konfokale Mikroskopie Bilder von Herzabschnitten, die mit fluoreszierendem Phalloidin (rot) gefärbt sind, die Muskelfasern reichlich kennzeichnen. Injektierte DAPI wurde in dem entsprechenden Kanal in grün angezeigt. Nach der IP-Injektion wird DAPI zu keinem Zeitpunkt im Herzen erkannt. Nach der IT-Injektion sind DAPI-Positivzellen nach beiden Zeitpunkten in der Herzkammer vorhanden. Skalierbalken = 500 μm.

Figure 4
Abbildung 4: IT-Injektion zur Untersuchung der Herzregeneration. A) Schema der experimentellen Gestaltung. Bei 3 und 7 Tagen nach der Kryoverletzung wurde eine Mischung aus DAPI und Phalloidin AF649 mit IT-injiziert (3 μL von 1 μg/mL). Die Herzen wurden 1 Stunde nach der IT-Injektion gesammelt, fixiert, abgetrennt und mit Phalloidin AF568 (rot) gefärbt. (B) Konfokale Mikroskopie Bilder von Längsherzabschnitten bei 3 und 7 dpci. Injektierte DAPI (grün) und Phalloidin AF649 (blau) Etikettenzellen des verletzten Bereichs (abgegrenzt durch weiße gestrichelte Linie) und des intakten Myokarums (rote Färbung). Weiße Pfeile weisen auf die DAPI (grün)-Verteilung durch intakte kompakte und trabekulierte Myokardie und das Epizentrum hin. Skalierbalken = 500 μm.

Figure 5
Abbildung 5: Exogene IT-injizierte CNTF stimuliert mehrere biologische Prozesse im Herzen. A) Schema der experimentellen Gestaltung. Zunächst wurde 2,5 μL einer Lösung, die 250 ng Zebrafisch CNTF oder Kontroll-Immunglobuline (HIgG) enthält, in das Perikardium von transgenen Fischen injiziert, die nukleare DsRed2 in Kardiomyozyten ausdrückten. Die Herzen wurden bei 7 bzw. 1 Tagen nach der Injektion (dpi) gesammelt und durch Immunfluoreszenz bzw. in situ-Hybridisierung analysiert. (B-D) Konfokale Mikroskopie Bilder von ventrikulären Abschnitten der Kontrolle und CNTF-injizierten Herzen. B) Immunfärbung gegen einen Zellzyklusmarker, Minichromosomenwartung komplexe Komponente 5 (MCM5; grün), zeigt eine höhere Anzahl von sich vermehrenden Kardiomyozyten als Reaktion auf exogene CNTF. (C) Immunostainung gegen Kollagen XII zeigt eine erhöhte Ablagerung von Kollagen XII im Myokardium nach der CNTF-Injektion. Im Steuerherz beschränkt sich Kollagen XII auf das Epizentrum34. (D) Immunostainung gegen einen Immunzellmarker, L-Plastin, erkennt eine verbesserte Rekrutierung von Immunzellen in den CNTF-injizierten Fischen. (E) Bright-Feld-Mikroskop-Bilder von ventrikulären Querschnitten nach In-situ-Hybridisierung mit einer Antisense-mRNA-Sonde gegen Cystatin, einem kardioprotektiven Faktor, zeigt die transkriptionale Upregulation dieses Gens im Herzen. Von CNTF-injizierten Fischen. Skalierbalken = 500 μm. Diese Figur wurde von Bise et al. 24geändert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Discussion

Hier beschreiben wir eine Methode, um exogene Verbindungen und Proteine in die Perikardhöhle zu liefern, um deren Auswirkungen auf das Herz bei erwachsenen Zebrafischen zu untersuchen. Das Verfahren basiert auf einer intrathorakischen Injektion, die zur Lieferung eines kleinen Lösungsvolumens in der Nähe der Orgel führt. Diese Technik wurde entwickelt und beschrieben, um Herzpräkonditionierung und Regeneration zu studieren.

Der entscheidende Schritt bei diesem Verfahren ist das Eindringen der Glaskapillare in die Brusthöhle. Dieser Schritt hängt von drei Parametern ab: Die Steifigkeit und Schärfe der Kapillarspitze, den Eindringungswinkel und den Punktionsort. Um das Eindringen durch die Haut zu optimieren, sollte der gezogene Teil der Kapillare nicht zu lang sein, da solche Nadeln zu flexibel sind und sich in Kontakt mit der Haut biegen. Um dies zu vermeiden, kann die Steifigkeit durch die Reduzierung der Spitze mit der Iridektomie-Schere angepasst werden. Obwohl der Eindringungswinkel zwischen 30 ° und 45 ° variieren kann, kann er an die Steifigkeit der Spitze angepasst werden. Tatsächlich wird eine dünne Spitze mit einem schmaleren Winkel besser in die Haut eindringen.

Um die Nadeldurchdringung zu optimieren, sollte die Einsteckstelle unmittelbar über dem schlagenden Herzen liegen. Das Risiko einer Herzpunktion liegt in der Regel bei 5% bis 8%. Das Einsetzen des Nadelpostes zum Herzen erhöht das Risiko einer Herzpunktion, wie durch verstärkte Blutungen zu sehen ist. In solchen Fällen sollten die Tiere aus den Experimenten entfernt werden.

Eine weitere Quelle von Problemen während der IT-Injektion tritt auf der Kapillarebene auf. In der Tat kann die Kapillare brechen, wenn seitliche Kräfte auf sie ausgeübt werden. Um dies zu vermeiden, muss sich die Nadel gerade entlang der Einspritzachse bewegen. Gelegentlich kann die Kapillare durch Gewebeschstände blockiert werden, die das Abfließen der Flüssigkeit verhindern. Die Nadel kann durch sanftes Abziehen der Spitze beim Injektieren entriegelt werden. Wenn dies den Durchfluss nicht verbessert, empfehlen wir, die Nadel vollständig aus dem Brustkorb zu ziehen und die Nadel zu ersetzen.

Die Läsionen können durch eine zu tief eingelegte Nadel im Perikardium verursacht werden. Um Läsionen im Pericardial-Sack zu vermeiden, darf die Nadel nicht zu viel (1 − 2 mm) in den Thorax eingesetzt werden. Einige Lecks wurden beobachtet, wenn das Einspritzvolumen größer als 8 μL war.

Bei Zebrafischen ist die genaue Zusammensetzung der Pericardialflüssigkeit unbekannt. Das Volumen der Perikardialhöhle wird jedoch auf ~ 10 μL31geschätzt. Da das Volumen der erwachsenen Zebrafischventrikel etwa 1 − 2 mm 3beträgt, gehen wir davon aus, dass die Perikarthöhle entsprechend ein winziges Volumen hat, das vor der Injektion zu berücksichtigen ist. Aus unseren Vorstudien haben wir festgestellt, dass der optimale Bereich des injizierten Volumens zwischen 0,5 und 3 μL für Fische von 2,5 − 2,8 cm (Abstand von der Schnauze zum kaudalen Pedonkel) liegt. Dieses Volumen kann je nach Größe der Fische angepasst werden. Die Injektion von bis zu 5 μL führte zu keiner Läsion in den Fischen dieser Größe. Die Bände von 8 μL reichten jedoch aus, um eine Wollung und innere Blutung zuverursachen, wie in Abbildung 1F dargestellt. Auf der Grundlage dieser Daten schätzen wir, dass eine Menge von Lösungen, die größer als 3 μL sind, zu physischer und physiologischer Belastung des Organs führen kann. Diese Einschränkung macht die Notwendigkeit erhöht, eine höhere Konzentration von Molekülen zu wählen, anstatt die Menge der injizierten Lösung zu erhöhen.

Ein weiterer wichtiger Faktor ist die osmotische Eigenschaft der injizierten Lösung, die im physiologischen Bereich liegen sollte. Um ein Risiko für osmotischen Stress zu vermeiden, empfehlen wir HBSS als Injektionsmittel.

Bei Zebrafischen sind die gängigen Methoden zur Lieferung von Medikamenten durch die Wasseraufbereitung und die Intraperitonealspritze 30,35. Obwohl beide Techniken für viele Anwendungen geeignet sind, bieten IT-Injektionen experimentelle und wirtschaftliche Vorteile, indem sie die Risiken unerwünschter systemischer Nebenwirkungen verringern und den Einsatz kostspieliger Moleküle verringern. Diese Methode kann für die Lieferung von Tamoxifen geeignet sein, um das transgene System Cre-ERT2 zu aktivieren, das für die Zelllinie verwendet wird, und modifizierte RNAs für funktionelle Studien in der Regenerationsforschung zu leiten.

Die IT-Injektionsmethode in Zebrafischen wurde zuvor31,36 beschrieben. In diesen Berichten wurden intrathorakische Injektionen mit Insulinnadel durchgeführt, die von der Vorderseite aus punkteten. Im Gegensatz dazu stellt unser Protokoll eine alternative Strategie mit der gezogenen Glaskapillare dar, die aus der hinteren Richtung eingelegt wird. Unser Ansatz berücksichtigt insbesondere die Anatomie des Fischpericardiums, um die Injektion mit einem reduzierten Risiko für Herzpunktion zu optimieren. Darüber hinaus wird der Fisch während des Eingriffs nicht von metallischen Zangen gehalten, sondern von einem feuchten und weichen Schwamm, der eine geeignetere Methode ist, um eine äußere Verletzung der Fische zu vermeiden. So könnte sich die vorgestellte Methode besser für Studien über Herzhomöostase, Vorkonditionierung und Regeneration bei erwachsenen Zebrafischen eignen.

In Säugetiermodellorganismen wurden bereits IT-Injektionen festgestellt. In der Tat wurde diese Methode auch in Experimenten mit Schweinen und klinischen Studien amMenschen 37,38angewendet. Bei Mäusen wurden transthorakische intramyokardiale Injektionen, die von Ultraschall geleitet werden, eingesetzt, um ihr Herz zu fordern 39. In diesem Artikel schlagen wir ein detailliertes Protokoll vor, um die Verwendung von IT-Injektionen für Zebrafische zu erleichtern. Dies wird für das Feld besonders wertvoll sein, um genetische Ansätze in der kardialen Homöostase, Präkonditionierung und Regenerationsforschung zu ergänzen.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Wir danken V. Zimmermann für die hervorragende technische Hilfe und die Fischpflege, D. König (Universität Freiburg) für die kritische Lektüre des Manuskripts, D. Kressler (Universität Freiburg) für die Hilfe bei der ZCNTF-Proteinsynthese, F. Ruggiero (Institut de Génomique) Fonctionnelle de Lyon) für die Bereitstellung von ColXII Antikörper, und P. Martin (Universität von Bristol) für L-Plastin Antikörper. Wir danken der Bildgebung und der Proteomics-Plattform der Universität Freiburg. Unterstützt wurde diese Arbeit von der Schweizerischen Nationalstiftung für Wissenschaft, Fördernummer 310030 _ 179213, und von der Schweizerischen Herzstiftung.

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics