Intrathoraxinjektion för studiet av vuxna Zebrafish hjärta

Biology
 

Summary

Denna metod bygger på en injektion av 0,5 − 3 μL lösning i bröst korgen hos vuxna Zebrafiskar. Förfarandet levererar effektivt proteiner och kemiska föreningar i närheten av zebra fiskar hjärta utan att skada orgeln. Metoden är lämplig för att testa effekter av exogena faktorer på olika vävnader i hjärtat.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den vuxna zebra fiskar hjärta ger en kraftfull modell i hjärt förnyelse forskning. Även om styrkan i detta system är baserad på transgena metoder, en snabb leverans av exogena faktorer ger en kompletterande teknik i funktionella studier. Här presenterar vi en metod som förlitar sig på administrering av några mikroliter lösning i perikardiell hålighet utan att orsaka hjärt infarkt skador. Intrathoracic (IT) injektioner kan effektivt leverera proteiner och kemiska föreningar direkt på hjärtats yta. De injicerade ämnena sprider sig genom epikardium till de underliggande kardiella vävnaderna. Jämfört med intraperitoneal (IP) injektioner, den största fördelen med intrathorakal injektioner är den fokus administrationen av de testade faktorerna på mål organet. Leveransen av molekyler direkt in i hjärtsäcken är en lämplig strategi för studier av hjärt prekonditionering och förnyelse hos vuxna zebra fiskar.

Introduction

Bland ryggradsdjur äger zebra fisken en anmärknings värd förmåga att regenerera sina hjärtan1,2. Denna förmåga har rapporter ATS i flera skade modeller, nämligen ventrikulär Apex resektion, krysskada (CI) och genetisk återskapande ablation3,4,5,6,7. Efter invasiva skador, den skadade väggen i ventrikeln blir transitivt läkt av fibrotiska vävnad, som successivt ersätts av en ny hjärt muskeln8,9,10,11. Den tidiga sårläkning svar innebär kardium aktivering och rekrytering av immun celler12,13,14,15. Samtidigt blir cardiomyocyter nära den skadade hjärt muskeln aktive rad, dedifferentiera, förökar sig och successivt ersätta det sårade området inom 30 − 90 dagar16,17,18, 19. avsevärda framsteg när det gäller att dechiffrera de molekyl ära och cellulära mekanismerna för hjärtats förnyelse har uppnåtts tack vare till gången på genetiska verktyg, såsom cell-Lineage tracing analys, inducerbara gen överuttryck, linjer för fluorescerande vävnads reporter och crispr/Cas9 Gene mutesis20,21.

Vi har nyligen etablerat en modell av hjärt prekonditionering i den vuxna zebra fiskar av thorakotomi22,23. Prekonditionering ökar uttryck för hjärt skyddande gener och höjer återinträdein i cell cykeln i intakt och regenererande hjärtan. Dessa processer är förknippade med rekrytering av immun celler och Matrix remodeling22,24. Mekanismerna för prekonditionering är dåligt förstådda, och inrättandet av nya tekniker krävs för att främja detta forsknings område. I synnerhet, optimerad administrering av utsöndras signalering proteiner eller andra kemiska föreningar är viktigt att ytterligare undersöka detta ämne.

Att vara vatten levande djur, zebra fiskar kan naturligt absorbera olika ämnen upplösta i vatten genom sina gälar och hud. Detta ger en möjlighet för icke-invasiva läkemedel leverans genom nedsänkning av fisk i lösningar med olika kemikalier, såsom farmakologiska hämmare, Steroidhormoner, tamoxifen, BrdU och antibiotika. Många studier från olika laboratorier, inklusive vår25,26,27, har faktiskt utnyttjat denna metod, som är särskilt värdefull inom området regenerativ biologi6, 28. detta tillvägagångs sätt är dock inte lämpligt för tillförsel av PEPTIDER, DNA, RNA, morfolinos eller molekyler med begränsad vävnads permeabilitet. I dessa fall, en effektivare leverans uppnås genom mikroinjektion i kroppen, till exempel genom att sätta in kapillär i retro-orbital venös sinus, i intraperitoneal eller intraperikardiell hålighet29,30, och 31. Här beskriver vi ett förfarande för intrathoraxinjektion av en liten mängd lösning, som en lämplig metod för att studera hjärt förnyelse och prekonditionering hos vuxna Zebrafish.

Protocol

Djur skötsel och alla djur försök som beskrivs i följande protokoll godkändes av det kantonala veterinär kontoret i Fribourg, Schweiz.

1. verktyg och lösningar för injektioner

  1. Dra mikroinjektions-anpassade borosilikatglaskapillärer med hjälp av en nål avdragare enligt figur 1a. Förvara dragna kapillärer i en 9 cm petriskål med skenor av modellerings lera eller tejp.
  2. Använd vanliga saxar, skär en bit svamp (7 cm x 3 cm x 1 cm) och hugga en fiskliknande silhuett i mitten.
  3. Förbered små portioner injektions vätska med de testade proteiner eller andra föreningar. Justera koncentrationen beroende på analysen genom att späda ut ämnet i 1x Hanks bal anse rad saltlösning (HBSS) kompletterat med 10% fenolrött.
    Anmärkning: Här var koncentrationen av det testade proteinet 100 ng/mL.
  4. Lös upp 4 g trikain i 980 ml destillerat vatten för att bereda en stam lösning av buffrade trikainmesilat anestetika. Justera pH till 7,0 − 7,4 med 1 M Tris-HCl pH 9 och fyll på med vatten till 1 000 mL. Förvara lösningen i mörker vid 4 ° c.
  5. För att få den arbetsföra koncentrationen av anestetika, tillsätt 1 − 2 mL av trikain stam lösning i 50 mL fisk vatten i en bägare.
    Anmärkning: Arbets koncentrationen av trikain bedövnings medel bör beredas färskt före användning.

2. beredning av insprutnings station

  1. Slå på stereomicroskopet med ljuset uppifrån och justera förstoringen till 16X.
  2. Blötlägg svampen med fisk vatten, placera den på en 9 cm petriskål på Mikroskop scenen och justera fokus.
  3. Under stereomicroscope, skär änden av en microcapillary på ~ 7 mm från grunden med hjälp av en iridektomi sax som visas i figur 1a. Den idealiska spets diametern skulle vara ~ 20 μm.
    Anmärkning: Kapning spetsen av kapillär i ett sned sätt är optimalt för infogningar i vävnaden.
  4. För in mikrokapillärskyddet i mikroinjektorapparatens nålhållare.
  5. Med hjälp av microloader tips, ladda en kontroll lösning (t. ex., 1x HBSS) för att ställa in trycket av injektionen, för att få ett lämpligt flöde mellan 0,3 μL/s och 0,5 μL/s. Töm nålen.
  6. Fyll på den valda volymen av injektions lösningen (t. ex. ciliär neurotrofisk faktor [CNTF] utspädd i 1x HBSS) i spetsen av kapillär (figur 1b). Det bör inte finnas någon luft bubbla i kapillär.
    Anmärkning: Den maximala volymen injektions lösning beror på fisk storlek. För en standard längd på 2,5 − 3 cm (avstånd från nos till stjärtfenan stjälk), den maximala injektions volym som förhindrar exessive bröst korg svullnad och blödning fastställdes till 5 μl (figur 1f). Större volymer kan injiceras till större fiskar.

3. beredning av fisken för Intrathoraxinjektion

  1. Fånga en vuxen zebra fiskar (Danio rerio) med ett nät och överföra det till anestesi lösning.
  2. Efter 1 − 2 min, när fisken slutar simma och förflyttningen av operculum reduceras, vidrör fisken med en plastsked för att se till att den inte reagerar på någon kontakt.
  3. Snabbt och försiktigt överföra fisken med skeden i spåret av den våta svampen, med ventrala sidan upp. Chefen för fisken bör peka bort från operatörens dominerande hand.

4. mikroinjektion i Perikardium

  1. Under stereomicroscope, noggrant Observera förflyttning av det slående hjärtat under huden på fisken. Bestäm visuellt injektions stället ovanför det pulserande hjärtat och i mitten av triangeln som definieras av de ventrala brosk plattorna (figur 1d). För in spetsen på kapillärvinkeln vid 30 − 45 ° graders vinkel i förhållande till kropps axeln (figur 1e). Penetrera försiktigt huden med mikrokapillärspetsen i hjärtsäcken (figur 1c). En optimal ingångs punkt är närmare buken än till huvudet.
    Anmärkning: Sätt inte in kapillär alltför djupt in i kroppen och hjärtat, eftersom detta kommer att orsaka skada på orgeln. Vid hjärt punktering fyller nålen vanligt vis med blod. Om detta händer, ta bort kapillär och utesluta fisken från experimentet.
  2. När nålen är inne i hjärtsäcken, komplett injektion genom att trycka på pedalen på mikroinjektor enheten.
    Anmärkning: Var noga med att inte injicera luft i bröst hålan.
  3. Efter injektionen, dra försiktigt ut kapillär från bröst korgen och omedelbart överföra fisken till en tank med system vatten för återhämtning.
  4. Övervaka fisken tills total återhämtning från anestesi.
  5. Samla hjärta vid önskad tidpunkt och förbereda den för ytterligare analys.
    Anmärkning: Om fisken inte återuppta operculum inom 30 s, animera fisken genom att klämma vatten i gälarna med en plastpipett.

Representative Results

Efter intrathorakal (IT) injektioner, effekterna av exogena lösning kan analyseras. För detta ändamål bör fisken avlivas och hjärtan samlas in, fixeras och histologiskt bearbetas enligt tidigare publicerade protokoll32,33.

För att validera metoden utförde vi först två test experiment genom att injicera färger och fluorescerande färg ämnen. Först euthanized fisk och obduktion injiceras 3 μL bläck i bröst korgen. Hjärtan samlades efter 5 min, tvättade i fosfatbuffrad saltlösning (PBS), fast i 2% formalin, tvättad i PBS och fotograferad under Mikroskop. För det andra injicerade vi 3 μL 1 μg/mL 4 ′, 6-diamidino-2-fenylindole (DAPI) in vivo, och fast hjärtat efter 2 h. I båda analyser, hela Mount analys avslöjade märkning av hela hjärtat inklusive ventrikeln, atriumet och bulbus arteriosus (figur 2A, B). Dessa resultat avslöjar effektiv spridning av den injicerade lösningen på hjärtats yta.

Ett gemensamt protokoll för tillförsel av exogena ämnen till den vuxna fisken är intraperitoneal (IP) injektion. För att jämföra lämpligheten av IT kontra IP injektioner för hjärt studier, injicerade vi en liknande mängd DAPI med båda metoderna och fast hjärtan efter 5 min och 120 min (figur 3a). Hjärtan var snittas och färgas med phalloidin Alexa fluor (AF) 568 som etiketter F-aktin i hjärt muskeln. Inga DAPI-positiva celler observerades i hjärtan efter IP-injektion vid båda tidpunkter (figur 3b). Däremot resulterade IT-injektionen i närvaron av DAPI-märkta kärnor i hjärt muskeln (figur 3b). Dessa resultat visar att IT-injektionen förbättrat leveransen av föreningen till hjärtat, jämfört med IP-injektionen.

För att testa lämpligheten av denna metod för hjärt förnyelse studier, vi kryoskadade ventriklarna8, och utförde IT-injektioner av 3 μl av 1 μg/ml DAPI och 1 μg/ml phalloidin AF649 vid 3 och 7 dagar efter kryoskada (dpci) (figur 4a). Vid 1 h efter injektionen, hjärtan samlades, fast, snittas och färgas med phalloidin AF568 att visualisera intakt myocardium. Vi fann att både hjärt muskeln och den skadade vävnaden innehöll många DAPI-positiva celler, vilket indikerar en effektiv penetration av detta färg ämne i intakt hjärta och fibrotisk vävnad (figur 4b). Dessutom, injiceras phalloidin AF649 inkorporerades också av cardiomyocyter av Peri-skada zonen och några rekryterade fibroblaster av det sårade området. Detta experiment avslöjar att läkemedlen kan korsa epikardium och tränga in i den underliggande myocardium.

Efter att ha testat effektiviteten av IT injektioner med hjälp av färg ämnen, analyserade vi effekterna av injicerade proteiner på hjärtat. Vi syntetiserade en cytokin, som kallas cntf, som är uppreglerad efter thorakotomi24. Vi undersökte effekterna av exogena CNTF på olika processer, nämligen kardiomyocyte proliferation, extracellulär matrix deposition, immun cell rekrytering och hjärt skyddande gen uttryck. Vi fann att alla dessa biologiska aspekter aktiverades av IT-insprutning av CNTF, jämfört med kontroll immunglobuliner (figur 5)24. Dessa resultat visar att metoden för intrathoraxinjektion ger en lämplig strategi för riktad leverans av proteiner för att studera deras effekter på distinkta hjärt vävnader i en mängd olika analyser.

Figure 1
Figur 1: Intrathorascisk (IT) injektion hos vuxna Zebrafiskar. (A) fotografi av en dragen mikroinjektion kapillär med filament (6 ", 1,0 mm i diameter) och värden av nålen avdragare program som används. Bfotografi av en dragen mikroinjektions kapillär med glöd tråden 6, 1,0 mm i diameter, fylld med 2,5 μl lösning innehåll ande 10% fenolrött. Den dragna spetsen på nålen är maximally 7 mm lång. C) Schematisk representation av IT-injektionen. Dfotografier av förfarandet för IT-injektion. Denna siffra har modifierats från bise et al.24. Numren i panelerna C och D motsvarar samma steg i förfarandet: (1) fisken placeras på en fuktad svamp. Punkteringsstället (röd prick i triangeln) ligger i mitten av bröstet nära gälarna. (2) nålen tränger in i hjärtsäcken. Röd prick indikerar punkteringsstället. (3) injektionen övervakas genom att observera spridningen av den röda lösningen i perikardiell hålighet. (E) schema av det injektionen. Vinkeln mellan injektionen kapillär och kroppen axeln bör vara mellan 30 ° och 45 ° för att undvika hjärtpunktion. Ffotografier av fisk Thorax vid 1 timme efter IT-injektionen av indikerade volymer. Vita pilar pekar på rödaktig vävnad, vilket kan tyda på inre blödning. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: IT-injicerade lösningar sprids nästan jämnt på hjärtats yta. (A) stereomicroscope bilder av hela hjärtan av fisk som utsätts för post-mortem IT-injektion med 2,5 ΜL Hbss eller 2,5 μl bläck. Bläck färgade ytan av ventrikeln (V), Atrium (A) och bulbus arteriosus (ba). Skalbar = 300 μm.b) ljus-och fluorescerande stereo Mikroskop bilder av hela hjärtan av fisk som utsätts för IT-injektion med Hbss och 3 μl av 1 μg/ml DAPI. DAPI-fluorescens upptäcks på hjärtats delar strax efter IT-injektionen. Scale bar = 300 μm. vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: jämförelse av två injektions metoder för tillförsel av DAPI till hjärtat. (A) schema för experimentell design. Intraperitoneal (IP) och Intrathorascic (IT) injektioner utfördes med samma mängd 1 μg/mL DAPI (3 μL). Hjärter samlades in vid 5 och 120 min efter injektionen. (B) konfokalmikroskopi bilder av hjärtat sektioner färgade med fluorescerande phalloidin (röd) som rikligt etiketter muskel fibrer. Injected DAPI visualiserades i lämplig kanal visas i grönt. Efter IP-injektionen detekteras inte DAPI i hjärtat vid något tillfälle. Efter det injektion, DAPI positiva celler finns i ventrikeln efter båda tidpunkter. Scale bar = 500 μm. vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: IT-injektion för att studera hjärt förnyelse. (A) schema för experimentell design. Vid 3 och 7 dagar efter kryoskada var en blandning av DAPI och phalloidin AF649 IT-injiceras (3 μL 1 μg/mL). Hjärtan samlades 1 timme efter det injektion, fast, snittas och färgas med phalloidin AF568 (röd). (B) konfokalmikroskopi bilder av längsgående hjärt avsnitt vid 3 och 7 dpci. Injiceras DAPI (grön) och phalloidin AF649 (blå) etikett celler i det skadade området (avgränsade med vit streckad linje) och intakt hjärt muskeln (röd färgning). Vita pilar pekar på DAPI (grön) distribution genom intakt kompakt och trabeculated myokardi och epicardium. Scale bar = 500 μm. vänligen klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: exogena IT-injicerade CNTF stimulerar flera biologiska processer i hjärtat. (A) schema för experimentell design. För det första, 2,5 μL av en lösning som innehåller 250 ng av zebra fisk CNTF eller kontroll immunoglobuliner (hIgG) injicerades i hjärtsäcken av transgena fiskar som uttrycker nukleära DsRed2 i cardiomyocyter. Hjärter samlades in vid 7 och 1 dagar efter injektion (dpi) och analyseras av immunofluorescens och in situ hybridisering, respektive. (B-D) Konfokalmikroskopi bilder av ventrikulära sektioner av kontroll och CNTF-injicerade hjärtan. (B) immunofärgning mot en cell cykel markör, minikromosom underhåll komplex komponent 5 (MCM5; grön), avslöjar ett större antal prolifererande cardiomyocyter som svar på exogena cntf. Skalbar = 500 μm. (C) immuninfärgning mot kollagen XII visar ökad deposition av kollagen XII i hjärt muskeln efter CNTF injektion. I kontroll hjärta, kollagen XII är begränsad till kardium34. Skala bar = 500 μm. (D) immuninfärgning mot en immun cell markör, L-plastin, upptäcker en förbättrad rekrytering av immun celler i CNTF injiceras fisk. Skalbar = 500 μm. (E) ljus-fält Mikroskop bilder av ventrikulära tvärsnitt efter in situ hybridisering med hjälp av en antisense mRNA sond mot Cystatin, en hjärt skyddande faktor, visar transkriptionell uppreglering av denna gen i hjärtat av CNTF-injicerad fisk. Skalbar = 500 μm. Denna siffra har modifierats från bise et al.24. Vänligen klicka här för att se en större version av denna siffra.

Discussion

Här beskriver vi en metod för att leverera exogena föreningar och proteiner in i perikardiell hålighet för att studera deras effekter på hjärtat hos vuxna Zebrafish. Proceduren är baserad på intrathoraxinjektion, vilket resulterar i leveransen av en liten mängd lösning i närheten av orgeln. Denna teknik utvecklades och beskrevs för att studera hjärt prekonditionering och förnyelse.

Det kritiska steget i detta förfarande är inträngning av glaset kapillär i bröst hålan. Detta steg beror på tre parametrar som är: styvhet och skärpa kapillärspetsen, vinkeln på penetration, och punkteringsstället. För att optimera penetrationen genom huden, bör den dragna delen av kapillär inte vara för lång, eftersom sådana nålar är för flexibla och böja i kontakt med huden. För att undvika detta kan stelheten anpassas genom att minska spets storleken med iridektomi saxen. Även om vinkeln för penetration kan variera mellan 30 ° och 45 °, kan den anpassas till styvheten i spetsen. I själva verket kommer en tunn spets tränga igenom huden bättre med en smalare vinkel.

För att optimera nålen penetration, insättnings stället bör vara omedelbart ovanför hjärt slagen. Risken för hjärtpunktion är vanligt vis låg mellan 5% och 8%. Införandet av nålen posteriort om hjärtat ökar risken för hjärtpunktion, som ses av ökad blödning. I sådana fall bör djuren avlägsnas från experimenten.

En annan källa till problem under IT-injektionen sker på kapillärnivå. I själva verket kapillär kan bryta när laterala krafter utövas på den. För att undvika detta måste nålen röra sig längs injektions axeln på ett rakt sätt. Ibland kan kapillär blockeras av vävnad rester som hindrar vätskan från att flöda. Nålen kan avblockeras genom att försiktigt dra ut spetsen medan du injicerar. Om detta inte förbättrar flödet, rekommenderar vi helt dra tillbaka nålen från bröst korgen och ersätta nålen.

Lesioner kan orsakas av en alltför djupt insatt nål i hjärtsäcken. För att undvika skador i hjärtsäcken får nålen inte sättas in för mycket (1 − 2 mm) i bröst korgen. Vissa läckor observerades när injektions volymen var större än 8 μL.

I Zebrafish är den exakta sammansättningen av den perikardiella vätskan okänd. Volymen av perikardiell hålighet uppskattas dock till ~ 10 μL31. Med tanke på att volymen av den vuxna zebra fiskar ventrikeln är cirka 1 − 2 mm3, vi antar att perikardiell kaviteten därmed har en liten volym, som måste övervägas före injektioner. Från våra preliminära studier har vi fastställt att det optimala intervallet för den injicerade volymen är mellan 0,5 och 3 μL för fisk som mäter 2,5 − 2,8 cm (avstånd från nos till kaudala stjälk). Denna volym kan anpassas beroende på storleken på fisken. Injektion av upp till 5 μL inducerade inte någon lesion i fisken av denna storlek. Emellertid, volymer från 8 μL var tillräckliga för att orsaka utbuktning och inre blödning som visas i figur 1F. Baserat på dessa data uppskattar vi att en mängd lösning som är större än 3 μL kan orsaka fysisk och fysiologisk påfrestning på orgeln. Denna begränsning kräver att välja en högre koncentration av molekyler i stället för att öka mängden av den injicerade lösningen.

En annan viktig faktor är den osmotiska egenskapen hos den injicerade lösningen, som bör vara i det fysiologiska intervallet. I själva verket, för att undvika en risk för osmotisk stress, rekommenderar vi HBSS som injektion medium.

I Zebrafish, de gemensamma metoder som används för att leverera droger är genom vattenrening och intraperitoneal injektion30,35. Även om båda dessa tekniker är lämpliga för många tillämpningar, IT-injektioner ger experimentella och ekonomiska fördelar, genom att minska riskerna för oönskade systemiska biverkningar och minska användningen av kostsamma molekyler, respektive. Denna metod kan vara lämplig för leverans av tamoxifen för att aktivera CRE-ERT2 transgena system som används för cell Lineage tracing analys, och vägleda modifierade RNAs för funktionella studier i regenereringsforskning.

IT-injektionmetoden i zebra fisk har tidigare beskrivits31,36. I dessa rapporter, intrathorakal injektioner utfördes med insulin nål, punktuell från den främre sidan. Däremot presenterar vårt protokoll en alternativ strategi med den dragna glas kapillär infogas från bakre riktningen. Specifikt tar vår strategi hänsyn till anatomin av fiskperikardium för att optimera injektionen med en minskad risk för hjärtpunktion. Dessutom, under förfarandet, fisken inte innehas av metalliska pincett, utan av en fuktig och mjuk svamp, som är en mer lämplig metod för att undvika någon yttre skada av fisken. Sålunda, den presenterade metoden kan vara bättre lämpad för studier av hjärthomeostas, prekonditionering och förnyelse hos vuxna Zebrafish.

IT-injektioner har redan fastställts i däggdjurs modellorganismer. Denna metod har faktiskt också tillämpats i experiment med svin och kliniska studier på människa37,38. Hos möss, transthorakala intramyokardiella injektioner styrs av ultraljud har använts för att utmana deras hjärta39. Inom denna artikel föreslår vi ett detaljerat protokoll för att under lätta användningen av IT-injektion för Zebrafish. Detta kommer att vara särskilt värdefullt för området, för att komplettera genetiska metoder i hjärthomeostas, prekonditionering och förnyelse forskning.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Vi tackar V. Zimmermann för utmärkt tekniskt stöd och för fisk vård, D. König (universitetet i Fribourg) för kritisk läsning av manuskriptet, D. Kressler (University of Fribourg) för hjälp med zCNTF protein syntes, F. Ruggiero (Institut de Génomique Fonctionnelle de Lyon) för att ge ColXII anti kropp, och P. Martin (University of Bristol) för L-plastin anti kropp. Vi tackar Imaging Core Facility och proteomik plattform vid universitetet i Fribourg. Detta arbete stöddes av Swiss National Science Foundation, Grant nummer 310030_179213, och av Schweizerische Herzstiftung (Swiss Heart Foundation).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics