تحفيز وتوصيف التسيادي الحويصلي في خلايا HepaRG المتمايزة

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

في هذه الدراسة، ونحن نصف بروتوكول مفصل لتحفيز الكبد الحويصلي في خلايا HepaRG المتمايزة مع حمض دهني الملح الصوديوم oleate واستخدام أساليب للكشف عن والقياس الكمي لتراكم الدهون، بما في ذلك متماسكة المضادة للستوكس رامان التشتت (CARS) المجهرية، وتحليل السيتوفلورمتري، النفط الأحمر يا تلطيخ، وqPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

يتم تعريف steatosis الكبد يُعرف بتراكم الدهون داخل الكبد، داخل قطرات الدهون المحتوية على الدهون الثلاثية، التي لا تقل عن 5% من وزن الكبد. تخزين الدهون الكبدية لفترات طويلة هو عملية يمكن عكسها، ومع ذلك، فإنه يمكن أن يؤدي إلى خلل في الكبد الأيضي، والتهاب وأشكال متقدمة من أمراض الكبد الدهنية غير الكحولية (NAFLD)، السبب الرئيسي لأمراض الكبد المزمنة في أجزاء كثيرة من العالم1,2. NAFLD هو مرض متعدد العوامل قد يتطور إلى التهاب الكبد غير الكحولي (ناش) الأكثر عدوانية، والذي بدوره يمكن أن يتطور إلى تليف الكبد، وفي نسبة صغيرة من المرضى، إلى سرطان الخلايا الكبدية (HCC)1،3. لا يوجد علاج معتمد متاح حاليا كعلاج محدد لNAFLD ومزيج من النظام الغذائي وتعديلات نمط الحياة لا يزال ركيزة إدارة NAFLD وناش4،5،6.

الآليات الجزيئية المؤدية إلى تطوير steatosis الكبد في مسببات الأمراض من NAFLD لا تزال ليتم توضيحها7. في هذا السياق، تم تطوير نماذج الماوس لدراسة تطور مرض steatosis البشري. يوجد عدد لا يحصى من النماذج المختلفة، ولكل منها مزاياها وعيوبها، بما في ذلك النماذج الوراثية والتغذوية والكيميائية التي تجمع بين نُهج مختلفة. الفئران المعدلة وراثيا (المعدلة وراثيا أو بالضربة القاضية) تلقائيا تطوير أمراض الكبد. ومع ذلك، تجدر الإشارة إلى أن هذه الطفرات نادرة جدا في البشر وحذف أو الإفراط في التعبير عن جين واحد (على سبيل المثال، OB / OB الماوس) قد لا تحاكي مسببات المرض البشري متعدد العوامل على المستوى الجزيئي8،9. وبالمثل ، فإن المرض الذي تكتسبه الفئران بعد التلاعب الغذائي أو الدوائي قد لا يحاكي آثار الوجبات الغذائية البشرية المرتبطة بتطوير NAFLD في الرجل8. غير أن النماذج الحيوانية قد يسرت التطورات في فهم الـ NAFLD، وهذا النهج هو حالياً الاستراتيجية الأكثر استخداماً في البحوث المختبرية. ومع ذلك، فإن تكرار النتائج التي تم الحصول عليها في النماذج الحيوانية في البشر قد فشل مرارا وتكرارا، مما تسبب في سوء الترجمة إلى العيادة10.

ولذلك، فإن النماذج المختبرية من NAFLD قد تلعب دورا أساسيا في توضيح الآليات الجزيئية لتقدم NAFLD، وأنها تمثل أداة قيمة لفحص عدد كبير من المركبات. وقد استخدمت على نطاق واسع ثقافات الخلايا الأولية، وخطوط الخلايا الخالدة والخزعات الكبد لأغراض البحث11. تشبه خلايا الكبد البشرية الأولية الظروف السريرية البشرية بشكل وثيق، ولكن هناك عدد محدود من المتبرعين، وتظهر ثقافات الخلايا الأولية ضعف قابلية الاستعادة بسبب تقلب الخلايا. وقد أدت هذه الملاحظات، إلى جانب القضايا الأخلاقية واللوجستية، إلى الحد من استخدام خلايا الكبد الأولية البشرية12. وهكذا، فإن خطوط الخلايا الكبدية تمثل بديلاً مناسباً، وجود العديد من المزايا الأساسية على الثقافة الأولية، حيث تنمو خطوط الخلايا الكبدية بشكل مطرد، ولها فترة حياة غير محدودة تقريباً، ولها نمط ظاهري مستقر. وعلاوة على ذلك، يمكن الوصول بسهولة إلى خطوط الخلايا الخلوية، كما أن الظروف الثقافية لخطوط الخلايا الكبدية أبسط من تلك الموجودة في خلايا الكبد الأولية وموحدة بين مختبرات مختلفة.

هنا، ونحن نصف بالتفصيل نموذج في المختبر القائم على الخلايا من التهاب الكبد الحويصلي، ممثلة بخلايا الكبد المتمايزة HepaRG تعامل مع حمض دهني أوليات الصوديوم. تم تأسيس خط الخلية HepaRG من المريضة المتضررة من التهاب الكبد C وEdmondson الصف الأول ورم الكبد المتمايزة جيدا14. خط الخلية HepaRG هو خط خلية الذرية ثنائية القدرة البشرية قادرة على التمييز عند التعرض ل2٪ ثنائي ميثيل سولفوكسيد (DMSO) نحو اثنين من الأنماط الظاهرية الخلية المختلفة: الخلايا الشبيهة الصفراوية والكبد ية. خلايا HepaRG المتمايزة (dHepaRG) تشترك في بعض الميزات والخصائص مع خلايا الكبد الكبار وتمتلك القدرة على التعبير عن الجينات الخاصة بالكبد بشكل لا يُقدر مثل الزلال، الألدلاسب، السيتوكروم P450 2E1 (CYP2E1)، وCytochrome P450 3A4 (CYP3A4)13 (الخطوة 3). علاج خلايا dHepaRG مع الأحماض الدهنية الملح الصوديوم oleate (250 درجة مئوية) لمدة 5 أيام يؤدي إلى توليد قطرات الدهون السيتوبلازمية، تقليد آثار الكبد الدهني14،15،17،18 ( الخطوة 4). تراكم قطرات الدهون يمكن الكشف عنها بسهولة عن طريق النفط الأحمر O تلطيخ (الخطوة 5)، صبغة الليسوكروم القابلة للذوبان في الدهون التي تلطيخ الدهون الثلاثية محايدة والدهون الحمراء والبرتقالية. لتحديد الدهون بكفاءة في dHepaRG الدهنية، وهنا نقوم بتوضيح تحليل الفلوروفلوري بعد تلطيخ مع 4،4-difluoro-1،3،5،7-tetramethyl-4-bora-3a،4a-ديازا-s-indacene (بوديبي 505/515) (الخطوة 6)، وهو مسبار الفلورسنت lipophilic أن توطين إلى أجسام الدهون داخل الخلايا، وقد استخدمت لتسمية قطرات الدهون19. وعلاوة على ذلك، هنا نعرض كيفية تقييم steatosis عن طريق تفاعل متسلسل بوليميراز كمي (qPCR) (الخطوة 7) التعبير الجيني إلغاء الضوابط التنظيمية للعديد من الجينات الأيضية في خلايا dHepaRG. لمزيد من توصيف وقياس تراكم قطرات الدهون بعد العلاج الأوليات الصوديوم، قمنا بإجراء متسقة المضادة ستوكس رامان مبعثر (CARS) المجهرية (الخطوة 8)، وهي تقنية مبتكرة تمكن من التصور والقياس الكمي لل قطرات الدهون دون وضع العلامات20،21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. إعداد وسائل الإعلام الثقافية والكواشف

  1. تكاثر المتوسطة: تكملة وليام E المتوسطة مع الجلوتاماكس, 10% مصل البقر الجنيني (FBS), 1% البنسلين / العقديات, 5 ميكروغرام / مل الأنسولين و 0.5 μM هيدروكورتيزون هيميسوتشينات.
  2. التمايز المتوسط: تكملة وليام E المتوسطة مع الجلوتاماكس، 10٪ FBS، 1٪ البنسلين / العقديات، 5 ميكروغرام / مل الأنسولين، 50 ميكروديزون هيميستشينوتينت و 2٪ DMSO.
  3. تجميد المتوسطة: تكملة تنتشر المتوسطة مع 10٪ DMSO.
  4. أوليات الصوديوم: حل في 99٪ الميثانول في تركيز 100 MM، وتحريك O / N، وتخزينها في -20 درجة مئوية.
  5. النفط الأحمر O : إعداد حل الأسهم. وزن 0.35 غرام من النفط الأحمر O وتذوب في 100 مل من إيزوبروبانول. تحريك O / N، مرشح (0.2 متر)، وتخزينها في RT. إعداد حل العمل: مزيج 6 مل من النفط الأحمر س الأوراق المالية الحل مع 4 مل من ddH2O. اسمحوا الجلوس في درجة حرارة الغرفة (RT) لمدة 20 دقيقة، ومن ثم تصفية مع مرشح 0.2 م. ينصح بشدة الترشيح السليم لتلطيخ ناجحة لتجنب الخلفية.
  6. بوديبي (505/515): حل بوديبي (505/515) صبغ في DMSO في تركيز الأوراق المالية 100 درجة مئوية، وتخزين في -20 درجة مئوية في الظلام، واستخدامها في تركيز 100 nM النهائي.
  7. احصل على أطباق شفافة ذات قاع زجاجي لتجارب CARS.

2. ذوبان، تضخيم، والحفظ بالتبريد من خلايا HepaRG

  1. إذابة خلايا HepaRG المحفوظة بالتبريد النيتروجين عن طريق غمر دفعة في حمام 37 درجة مئوية حتى تذويب. حدد دفعة مرور منخفضة (<20). خلايا HepaRG متاحة تجاريا.
  2. نقل الخلايا بسرعة إلى أنبوب 15 مل تحتوي على 10 مل من انتشار المتوسطة والطرد المركزي لمدة 5 دقائق (200 × ز، 4 درجة مئوية).
  3. تجاهل supernatant وإعادة تعليق الخلايا مع 5 مل من المتوسطة الانتشار.
  4. عد الخلايا وتمييع من أجل لوحة 2.5 × 104 خلايا / سم2.
  5. تجديد المتوسط كل 2 أو 3 أيام. تنتشر الخلايا مع وقت مضاعف ة حوالي 24 ساعة.
  6. فصل خلايا HepaRG عندما في 80٪ الملاءمة من قبل 3-5 دقيقة الحضانة مع حل التربسين 0.05٪. جمع الخلايا في انتشار المتوسطة والطرد المركزي لمدة 5 دقائق (200 × ز، 4 درجة مئوية).
  7. تجاهل supernatant وإعادة تعليق الخلايا مع 5 مل من المتوسطة الانتشار.
  8. عد الخلايا وتمييع من أجل لوحة 2.5 × 104 خلايا / سم2.
  9. في هذه المرحلة، تضخيم الخلايا عن طريق تكرار الخطوات 2.5-2.8 من أجل الوصول إلى عدد مناسب من الخلايا لبدء التجارب، أو الحفظ بالتبريد كما هو الحال في الخطوة 2.10.
  10. لخلايا HepaRG التبريد، فصل الخلايا 24 ساعة بعد الطلاء من قبل 3-5 دقيقة الحضانة مع محلول التربسين 0.05٪. جمع الخلايا في انتشار المتوسطة والطرد المركزي لمدة 5 دقائق (200 × ز، 4 درجة مئوية). تخلص من الـ supernatant، وأعيد تعليق الخلايا في 1 مل/دفعة من وسط التجميد، 1.5 × 106 خلايا/دفعة والحفاظ على دفعات النيتروجين السائل بالتبريد.

3. تمايز خلايا HepaRG (اليوم 0-21) (الشكل1A)

  1. اليوم 0. خلايا HepaRG البذور في كثافة منخفضة (2.5 × 104 خلايا / سم2)في الأطباق المعالجة الثقافة مع حجم مناسب من انتشار المتوسطة (الشكل1B). اثنين من الأطباق تحتاج إلى أن تكون مطلية لكل اختبار (النفط الأحمر O تلطيخ، تحليل FACS، qPCR): واحد لخلايا التحكم وواحد للخلايا المعالجة الأوليات. إذا كان إجراء قياسات CARS (الخطوة 8)، قم بزرع الخلايا بالتوازي مع أطباق شفافة ذات قاع زجاجي. كتحكم، قم بحصاد طبق واحد غير معالج (الخلايا المتكاثرة اليوم 0) لإجراء تحليل التعبير الجيني لجينات علامة التمايز (انظر الخطوة 3.6).
  2. اليوم الثاني واليوم الرابع تغيير المتوسطة مع حجم مناسب من انتشار المتوسطة والسماح للخلايا تنمو حتى التقاء.
  3. اليوم السابع يجب أن تكون الخلايا 100٪ confluent (الشكل1C). غسل الخلايا مرة واحدة مع 1X الفوسفات المخزنة المالحة (PBS). إزالة 1X PBS وإضافة حجم مناسب من التمايز المتوسطة.
  4. اليوم الثامن، 9، 12، 15، 18  غسل الخلايا مرة واحدة مع 1X PBS. إزالة 1X PBS وإضافة حجم مناسب من التمايز المتوسطة.
  5. اليوم الحادي والـ21 مراقبة خلايا HepaRG تحت المجهر وضمان أن الخلايا هي الثقافات المتمايزة confluent (الشكل1D).
  6. كتحكم، حصاد طبق تحكم واحد (الخلايا المتمايزة اليوم 21) لإجراء تحليل التعبير الجيني (الخطوة 7) من جينات علامة التمايز (الشكل1هاء).
  7. في اليوم 21، يمكن الحفاظ على خلايا HepaRG المتمايزة بالتبريد في النيتروجين السائل.

4. تحريض التسياق الحويصلي (اليوم 21-26)

  1. اليوم الحادي والـ21 تمييع oleate الصوديوم (100 mM) مع حجم مناسب من التمايز الكامل المتوسطة إلى التركيز النهائي من 250 μM (1:400). إضافة 99٪ الميثانول 1:400 (نفس حجم أوليه الصوديوم) في aliquot آخر من التمايز المتوسطة لجعل العلاج السيطرة على السيارة. (على سبيل المثال: إضافة 25 ميكرولتر من أوليه الصوديوم إلى 10 مل من المتوسط وبالتوازي مع إضافة 25 ميكرولتر من الميثانول 99٪ إلى 10 مل من المتوسط). غسل الخلايا مرة واحدة مع 1X PBS وإضافة السيارة أو الصوديوم oleate المتوسطة.
  2. اليوم الثالث والـ23 تغيير الوسط مع حجم مناسب من المتوسطة المعدة حديثا كما هو الحال في الخطوة 4.1.
  3. اليوم السادس والـ26 لاحظ بواسطة المجهر البصري أن قطرات الدهون تتراكم في الخلايا المعالجة بالأوليات الصوديوم وتكون مرئية بسهولة كقطرات شفافة في السيتوبلازم كما هو الحال في الشكل 2A.

5. تقييم الحمولة الزائدة من الدهون وتحريض Steatosis: النفط الأحمر يا تلطيخ

  1. غسل الخلايا مرة واحدة مع 1X PBS وإزالة 1X PBS تماما.
  2. إضافة 4٪ بارافورمالهايد (المخفف في 1X PBS) وحضانة لمدة 15 دقيقة في RT.
    تحذير: Paraformaldehyde هو سام، لذلك يجب أن يتم تنفيذ هذه الخطوة في غطاء الدخان، مع معدات واقية، بما في ذلك القفازات، ومعطف المختبر، وقناع.
  3. إزالة paraformaldehyde وغسل الخلايا مرتين مع 1X PBS. يمكن الاحتفاظ بالخلايا في 1x PBS عند درجة حرارة 4 درجة مئوية لبضعة أيام قبل تلطيخ. التفاف مع parafilm وغطاء مع رقائق الألومنيوم لمنع الخلايا من التجفيف.
  4. إزالة 1X PBS. حضانة الخلايا مع 60٪ إيزوبروبانول لمدة 5 دقائق في RT.
  5. إزالة إيزوبروبانول والسماح للخلايا تجف تماما في RT.
  6. إضافة النفط الأحمر يا حل العمل وحضانة في RT لمدة 30 دقيقة. يتوافق حجم حل العمل المطلوب لكل عينة مع حجم الوسائط المستخدمة لزراعة الخلايا.
  7. إزالة النفط الأحمر O الحل وعلى الفور إضافة ddH2O. غسل الخلايا 4 مرات مع ddH2O.
  8. الحصول على الصور تحت المجهر للتحليل (الشكل2ب).
  9. إلى elute النفط الأحمر يا صبغ: إزالة جميع المياه والسماح لتجف. إضافة 1 مل من 100٪ إيزوبروبانول وحضانة لمدة 10 دقيقة مع هز لطيف في RT.
  10. Pipet isopropanol مع زيت أحمر مصبغة صعودا وهبوطا عدة مرات، وضمان أن جميع النفط الأحمر O هو في الحل. نقل الحل إلى كوفيت. قياس OD500 نانومتر عن طريق قياس الطيف واستخدام 100٪ isopropanol كما فارغة (الشكل2C).

6. تقييم الحمولة الزائدة للدهون وتحريض Steatosis: تلطيخ بوديبي وتحليل مقياس الفلورة

  1. غسل الخلايا مرة واحدة مع 1X PBS. حضانة مع 100 [نم] من [بوديبي] يخفّف في [1إكس] [ببس] في الظلام ل 40 دقيقة في 37 [ك.]. وينبغي إدراج عنصر تحكم غير ملطخ في قياسات قياس التدفق. من هذه النقطة، وحماية العينات من الضوء قدر الإمكان.
    ملاحظة: حجم محلول تلطيخ المطلوبة لكل عينة يتوافق مع حجم الوسائط المستخدمة لخلايا الزراعة.
  2. إزالة حل تلطيخ وغسل الخلايا مرة واحدة مع PBS 1X. انتقل إلى الخطوات 6-3-6-6. لتحليل FACS (فرز الخلايا المنشطة فلورية) أو إلى الخطوة 6.7 للتصوير المجهر.
  3. كشط بلطف الخلايا مع 1X PBS ونقلها إلى أنبوب 15 مل. الطرد المركزي لمدة 10 دقائق (200 × ز، 4 درجة مئوية).
  4. قم بإزالة الـ supernatants بلطف دون إزعاج الكريات واغسلها بـ 3 مل من 1x PBS. الطرد المركزي لمدة 5 دقائق (200 × ز، 4 درجة مئوية).
  5. إزالة supernatants وإعادة تعليق في 300 درجة مئوية من 1X PBS، ثم نقل إلى أنبوب FACS.
  6. قياس كثافة الفلورة Bodipy على الفور عن طريق تحليل السيتوفلورمتري مع الإثارة / الموجات الموجية للانبعاثات من 505/515 نانومتر (الشكل3ألف،باء).
  7. غسل الخلايا مرة واحدة مع 1X PBS وإزالة PBS تماما.
  8. إضافة 4٪ بارافورمالهايد (المخفف في 1X PBS) وحضانة لمدة 15 دقيقة في RT.
    تحذير: Paraformaldehyde هو سام، لذلك يجب أن يتم تنفيذ هذه الخطوة في غطاء الدخان، مع معدات واقية، بما في ذلك القفازات، ومعطف المختبر، وقناع.
  9. إزالة paraformaldehyde وغسل العينات 3X لمدة 5 دقائق في PBS. يمكن الاحتفاظ بالخلايا في 1x PBS عند درجة حرارة 4 درجة مئوية أو تصويرها على الفور (الشكل3C). للتخزين، التفاف مع parafilm وغطاء مع رقائق الألومنيوم لمنع الخلايا من التجفيف.

7. تقييم الحمولة الزائدة للدهون وتحريض Steatosis: qPCR

  1. غسل الخلايا مرة واحدة مع 1X PBS. كشط الخلايا مع 1X PBS، الطرد المركزي في 200 × ز، وتجاهل supernatant. في هذه الخطوة، يمكن حصاد الخلايا عند -80 درجة مئوية أو معالجتها كما هو الحال في الخطوة 7.2.
  2. تنفيذ عزل RNA الكلي بالطرق القياسية باستخدام الكواشف التجارية باتباع تعليمات الشركة المصنعة.
  3. تقييم تركيز الحمض النووي الريبي عن طريق قياس الطيف الضوئي للأشعة فوق البنفسجية، وضمان أن نقاء الحمض النووي الريبي عالية (ما يقرب من 2.0) استناداً إلى القراءة A260/A280.
  4. توليف cDNA من 1 ميكروغرام من مجموع الحمض النووي الريبي مع مجموعة توليف cDNA القياسية.
  5. تمييع cDNA إلى حجم 50 ميكرولتر النهائي مع H2O.
  6. تحليل كل عينة cDNA في ثلاثة أضعاف من قبل qPCR: إعداد مزيج واحد qPCR الرئيسي (الجدول1)التي تكفي لردود الفعل اللازمة لكل التمهيدي، بما في ذلك التمهيديات المحددة لجينات التدبير المنزلي الثلاثة كضوابط: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB and ribosomal 18S (انظر جدول المواد لتسلسل التمهيدي):
  7. الاستغناء عن 18 درجة مئوية من المزيج الرئيسي لكل بئر في لوحة متعددة الجدران PCR.
  8. إضافة 2 ميكرولتر من عينة cDNA في كل بئر. أغلق الصحن
  9. تشغيل العينات وفقا لتعليمات دورة الحرارية.

8. تقييم الحمولة الزائدة للدهون وتحريض Steatosis: CARS

  1. إصلاح الخلايا التي تم إعدادها مسبقاً على الأطباق ذات القاع الزجاجي، كما هو موضح في الخطوات 5.1-5.3.
  2. قم بتشغيل نظام ليزر نبضي بتقنية بيكوثانية قابل للضبط التجاري، وضبطه للحصول على مخرجين من أطوال موجية مختلفة. يجب أن يكون الفرق التردد بين المخرجات 2,840 سم-1 لتوليد إشارة ضوء السيارات المكثفة المقابلة لتمتد الميثيلين متناظرة; لإنتاج الطول الموجي الثابت في 1,064 نانومتر ("ستوكس" ضوء), وينبغي ضبط الطول الموجي الأخرى إلى 817 نانومتر ("مضخة" ضوء).
  3. تأكد من أن الناتج 817 نانومتر متداخلة مكانيا وزمنيا مع الناتج 1064 نانومتر: استخدام مرآة ثنائية الأوراق مناسبة (أي، مع قطع بين 817 و 1064 نانومتر) للجمع مكانيا الحزم واستخدام خط تأخير البصرية للحصول على التداخل الزمني للليزر البقول.
  4. التأكد من أن كلا ً من الحزم copropagating هي collimated وأن أقطارها لها قيم مماثلة مناسبة للنظام البصري داخل المجهر التي سوف تركز عليها على العينة؛ إذا لزم الأمر، على حدة collimate الحزم قبل المرآة dichroic الذي يجمع بينهما.
  5. قم بتشغيل نظام مجهر مقلوب تجاري، والذي ينبغي أن يتضمن وحدة مسح بالليزر بالأشعة تحت الحمراء ووحدة كشف مزدوجة القنوات باللون الأحمر/الأخضر ومحاذاة أشعة الليزر copropagating في وحدة المسح الضوئي.
  6. فتح وحدة الكشف عن إبي ثنائي القناة، وإزالة مكعب فلتر واستبدال مرشح الكشف عن الطول الموجي الأحمر مع مرشح النطاق التي يمكن تحديد 2840 سم-1 إشارة السيارات التي تتركز في 663 نانومتر لمضخة 817/1,064 نانومتر / ستوكس الإثارة نظام. ويفضل مرشح عرض نطاق ضيق (20 نانومتر) لتجنب جمع مستويات عالية من إشارات الخلفية الفلورية.
  7. وضع طبق على خشبة المسرح من مجهر السيارات المقلوبة، وذلك باستخدام 100X النفط الغمر الهدف، وتحويل الموقف الرأسي للهدف للتركيز على الخلايا.
  8. إعداد برنامج المجهر لجمع عالية الدقة (1024 × 1024 بكسل) الصور عبر حقل عرض يمتد 127 ميكرومتر × 127 ميكرومتر.
  9. قم بتعيين برنامج المجهر للحصول باستمرار على صور لمجال العرض 127 ميكرومتر × 127 م وتحقق من الصور المعروضة مع تحسين معلمات جمع الصور. تأكد من توازن قوى الليزر لجمع الصور بسرعة والحد الأدنى من الضرر، وإدراج مرشحات مناسبة محايدة الكثافة في مسارات شعاع حسب الضرورة، وحدد وقت البكسل الذي يسمح لجمع الصور مع إشارة جيدة إلى الضوضاء نسبة تحت شروط الطاقة الليزر ية مختارة.
  10. الحصول على وحفظ الصور من عدة مجالات مختلفة من الرؤية داخل الطبق في ظل الظروف الأمثل. واختياريًا، يمكن جمع صور الفلورة متعددة الفوتونات، الناتجة عن انبعاث الطول الموجي الأخضر (معظمها من إثارة الفوتونين عند 817 نانومتر)، في وقت واحد عن طريق كاشف إبي الآخر. كرر الخطوات 8.7-8.10 لكل طبق.
  11. لتحليل صور CARS، معالجة الصور باستخدام تنفيذ فيجي من ImageJ. قم بتشغيل وظيفة Despeckle (أو أداة إزالة الضوضاء المماثلة) على كل صورة قبل إجراء مزيد من التحليل لتحسين نسب الإشارة إلى الضوضاء دون فقدان التفاصيل.
  12. استخدام فيجي لتحديد الخلايا يدويا ثم عد تلقائيا قطرات الدهون داخل الخلايا الفردية مجزأة لإنتاج إحصاءات عن مناطق قطرات الدهون والأرقام لكل خلية ولمجموعة بيانات الصورة بأكملها لكل طبق.

9. اختبار صلاحية الخلية MTT

  1. لوحة يميّز [هبرغ] خلايا داخل 96[ولّ] لوحة مع كثافة من 1 x 105 خلايا/بئر في نهائيّة 100 [فل] حجم من تمايز ثقافة وسط.
  2. 24 ساعة بعد البذر، وعلاج الخلايا مع 99٪ الميثانول (مركبة) ومع 100 درجة مئوية، 250 ميكرومتر و 500 ميكرومتر أوليت الصوديوم وبالميتات الصوديوم المخففة في 100 ميكرولتر من ثقافة التمايز المتوسطة / جيدا في الثلاثية.
  3. تغيير المتوسط مع 99٪ الميثانول ومع 100 درجة مئوية، 250 درجة مئوية و 500 ميكرومتر أوليات الصوديوم وبالميتات الصوديوم المخففة في 100 درجة مئوية من ثقافة التمايز المتوسطة / جيدا كل 24 ساعة.
  4. 96 ح بعد الميثانول / الصوديوم oleate / العلاج بالميتات الصوديوم، وعلاج الخلايا مع 2 μM دوكسوروبيسين المخففة في 100 ميكرولتر من ثقافة التمايز المتوسطة / جيدا في الثلاثيكة كسيطرة.
  5. 18 ح بعد العلاج doxorubucin، تغيير المتوسطة مع 100 درجة مئوية من التمايز الثقافة المتوسطة.
  6. Pipet 20 μL من 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazoliumالكاشف MTT (جدول المواد) في كل بئر من لوحة 96-well التبص التي تحتوي على الخلايا في 100 ميكرولتر من وسط التمايز الثقافي . وتشمل السيطرة على الخلفية عن طريق الأنابيب 20 € L من الكاشف في بئر التحكم دون خلايا في 100 درجة مئوية من التمايز وسط الثقافة في الثلاثية.
  7. احتضان لوحة في 37 درجة مئوية في ترطيب، 5٪ CO2 الغلاف الجوي.
  8. بعد حضانة لمدة 30، 60، و 90 دقيقة مع كاشف تي إم تي تي تيزولويوم، سجل الامتصاص في 490 نانومتر باستخدام قارئ لوحة 96 جيدا. طرح امتصاص الخلفية من الآبار التحكم لا خلية من قيم امتصاص للعينات الأخرى.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

يصف هذا البروتوكول طريقة فعالة للحث على وتوصيف steatosis الحويصلي في خلايا HepaRG المختلفة DMSO عن طريق علاج oleate الصوديوم (الشكل1A).

تمايز خلايا HepaRG.
للحث على التمايز بكفاءة، يجب أن تكون الخلايا المتكاثرة بذرًا بكثافة منخفضة (2.5 × 104 خلايا/سم2)في وسط الانتشار. عندما بذر في كثافة منخفضة، والخلايا تقسيم بنشاط والحصول على مورفولوجيا ممدود غير متمايزة (الشكل1ب). وينبغي ترك الخلايا لتنمو في وسط الانتشار لمدة 7 أيام، حتى يتم التوصل إلى الملاءمة 100٪ (الشكل1C). بعد التعرض لDMSO 2٪، تبدأ الخلايا في التمييز وتشكيل مستعمرات نموذجية تشبه خلايا الكبد تحيط بها خلايا تشبه الظهارية الصفراوية (الشكل 1D). تُعبّر خلايا HepaRG المتمايزة عن علامات خاصة بـ hepato، مثل الزلال وCyp3A4 وألدلاس B. للتحقق من التمايز الصحيح، تم تحليل مستويات التعبير لجينات علامات الكبد هذه في الخلايا المتمايزة (اليوم 21) وفي الخلايا المتكاثرة (اليوم 0) بواسطة qPCR (الشكل1E). يجب أن تكون الجينات الزلال، Cyp3A4 وألدلاس B upregulated في خلايا HepaRG المتمايزة بالمقارنة مع خلايا HepaRG المنتشرة، ولاحظنا هذا الاتجاه، مما يؤكد فعالية بروتوكول التمايز لدينا.

تحريض التسيابي الحويصلي في خلايا هيبارغ عن طريق علاج أوليه الصوديوم.
علاج oleate الصوديوم من خلايا dHepaRG يحفز تراكم الدهون، مرئية تحت المجهر البصري كما قطرات الدهون في السيتوبلازمات (الشكل2A). للتحقق من الحث الفعال للإستيطاب، كانت خلايا HepaRG المعالجة بالأوليات والتحكم ملطخة بصبغة الزيت الأحمر O. بعد تلطيخ، قطرات الدهون مرئية بسهولة كما قطرات حمراء (الشكل2B) ويمكن قياسها كميا عن طريق قياس الطيفية من النفط الأحمر يا صبغ eluted مع isopropanol (الشكل2C). امتصاص زيت أحمر من الخلايا يتناسب مباشرة مع تراكم قطرات الدهون السيتوبلازمية.

تم تحديد تركيز أوليه الصوديوم ووقت التعرض من خلال اختبار قابلية صلاحية الخلايا الملونة MTT (الخطوة 9). تمت مقارنة علاج أوليه الصوديوم لعلاج بالميتات الصوديوم وdoxorubucin المخدرات المبرمج (2 μM) تم استخدامه كتحكم (الشكل2D). تم تقييم السمية الخلوية للمركبات بواسطة MTT،مع الاستفادة من مركب تجاري (جدول المواد)، الذي يحتوي على رباعي اتترازوليوم MTT. يتم تقليل مركب تيتيزوليوم MTT الأصفر القابل للذوبان في الماء من خلال الخلايا النشطة أيضًا إلى منتج formazan أرجواني غير قابل للذوبان في الماء. يتم قياس المنتج formazan من خلال امتصاصه في 490 نانومتر والمبلغ يتناسب مباشرة مع عدد الخلايا الحية في الثقافة (الشكل2D).

تحديد كمية من steatosis الحويصلي في خلايا هيبارغ الصوديوم المعالجة بالأوليات
لتحديد كمية زيادة محتوى الدهون الخلوية بعد العلاج oleate الصوديوم، قمنا بتلطيخ مع صبغ ة بوديبي، وهو التحقيق الذي يحدد قطرات الدهون. باستخدام تحليل الخلايا، فمن الممكن لتحديد كمية محتوى الدهون الثلاثية من قبل بوديبي يعني كثافة الفلورسنت، وهو أعلى في الخلايا المعالجة الأوليات بالمقارنة مع خلايا التحكم (الشكل3B)، مما يشير إلى كفاءة الدهون تراكم بعد العلاج oleate. في الواقع، تظهر صور الخلايا الملطخة ببوديفي قطرات الدهون الفلورية الخضراء الزاهية في الخلايا المعالجة بالأوليات غير مرئية في خلايا التحكم (الشكل3C).

علاج oleate الصوديوم من خلايا dHepaRG deregulat التمثيل الغذائي للدهون والتعبير الجيني الالتهابي. لتقييم الحث الفعال للتسيب الحويصلي، قمنا بتحليل مستويات التعبير من الجينات المختارة في الخلايا المعالجة بالصوديوم الأولياتمقارنة بخلايا التحكم (الشكل 4). أسيتيل-كوا كاربوكسيليز بيتا (ACACB), الجلسرين-3-الفوسفات أسيلترانسفيراز الميتوكوندريا (GPAM), riskipins (PLIN2, PLIN4), apolipoprotein B (APOB), بيروفات ديهيدروجيناز كيناز إيزوزيم 4 (PDK4), كارنيتين بالميتويلترانسفيراز 1A (CPT1A) و تم تنظيم interleukin 6 (IL6) في خلايا dHepaRG المعالجة بالأوليات، في حين أن عائلة حامل ة solute 2 عضو 1 (SLC2A1)، والبروتين البلوري C-III(APOC3)، وstearoyl-CoA desaturase (SCD) تم تخفيض تنظيمها (الشكل 4). لمزيد من توصيف وقياس تخزين الدهون في قطرات عند إضافة oleate الصوديوم إلى خلايا HepaRG متباينة، استخدمنا تقنية مجهرية مبتكرة، متماسكة المضادة لستوكس رامان مبعثرة (CARS) المجهرية، والتي تمكن التصور والقياس الكمي لقطرات الدهون دون وضع العلامات (الشكل5A). تم تحديد قطرات الدهون إحصائياً من حيث الأرقام والتوزيع والمورفولوجيا على مستوى الخلية الواحدة باستخدام صور CARS. العلاج مع أوليت الصوديوم (250 درجة مئوية) تسبب في زيادة كبيرة في عدد قطرات الدهون (الشكل5B)،مما أدى إلى ارتفاع إجمالي مساحة قطرات لكل خلية (الشكل5C)ونسبة أعلى من مساحة قطرات لكل خلية ( الشكل 5D)،بالمقارنة مع خلايا التحكم، مما يشير إلى أن خلايا dHepaRG تراكمت بكفاءة الدهون بعد العلاج oleate الصوديوم.

Figure 1
الشكل 1 تمايز خلايا هيبارغ. (أ) رسم تخطيطي تمثيلي يبين بروتوكول تمايز/معالجة خلايا HepaRG كما هو موضح في الخطوتين 3 و4. (باء-دال) صور تظهر غير ملطخة تكاثر خلايا HepaRG في اليوم 0 بعد البذر (B) ، في التقاء اليوم 7 بعد البذر (C) ، وHepaRG المتمايزة (dHepaRG) في اليوم 21 بعد البذر (D). (E) تم استخراج مجموع الحمض النووي الريبي من تكاثر وخلايا dHepaRG، تم تصنيع هادنا وتحليلها من قبل qPCR باستخدام التمهيديات المحددة للجينات المشار إليها (جدولالمواد). تم تطبيع العينات إلى متوسط GAPDH، actinB وribosomal 18S الجينات التدبير المنزلي. تظهر الرسوم البيانية الحث أضعاف من التكاثر (اليوم 0) مقابل الخلايا المتمايزة (اليوم 21) (الأشرطة تشير إلى S.D.؛ تم حساب القيم p من قبل الطلاب t-الاختبارات). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2 علاج oleate الصوديوم من خلايا dHepaRG الناجمة عن تراكم قطرات الدهون. (أ) صور خلايا هيبارغ المتمايزة غير الملطخة (dHepaRG) المعالجة لمدة 5 أيام مع السيارة (التحكم) (الصورة اليسرى) أو مع 250 ميكرومتر أوليات الصوديوم (الصورة اليمنى). (B) بعد العلاج، كانت ملطخة الخلايا مع النفط الأحمر يا صبغ. قطرات الدهون مرئية باللون الأحمر. (C) تم إزالة صبغة النفط الأحمر O وتم قياس OD في 570 نانومتر. يتم التعبير عن النتائج كوسيلة لثلاث تجارب مستقلة (الأشرطة تشير إلى S.D.; p-value بواسطة اختبار t للطالب). (د) تقييم صلاحية الخلايا لمركبة خلايا dHepaRG (99٪ الميثانول) المعالجة (Ctrl) أو المعالجة لمدة 5 أيام مع أوليات الصوديوم وبالميتات الصوديوم (100 درجة مئوية، 250 درجة مئوية، أو 500 درجة مئوية)، أو علاج 18 ساعة مع دوكسوروبوكين (2 ميكرومتر).  تم إجراء تقييم السمية الخلوية باستخدام مجموعة اختبارMTT (جدول المواد)، وتسجيل امتصاص في 490 نانومتر، وفقا لتعليمات الشركة المصنعة. يتم التعبير عن النتائج كوسيلة لثلاث تجارب مستقلة (الأشرطة تشير إلى S.D.؛ تم تحديد قيم p باستخدام اختبار t للطالب: *0.01 ≤ p < 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3 القياس الكمي لتراكم الدهون بعد العلاج أوليه الصوديوم من قبل تلطيخ بوديبي. تم التعامل مع خلايا HepaRG (dHepaRG) المتمايزة مع السيارة (التحكم) أو مع 250-μM oleate الصوديوم لمدة 5 أيام. بعد العلاج، كانت خلايا dHepaRG ملطخة بصبغ ة بوديبي وتحليلها عن طريق قياس التدفق. (أ) ملامح تراكب ممثل (٪ من الحد الأقصى: نسبة مئوية من الحد الأقصى لشدة تلطيخ). (ب) تظهر الرسوم البيانية متوسط شدة الفلورة (MFI) كنسبة مئوية من الخلايا المعالجة التي تسيطر عليها من ثلاث تجارب مستقلة (القضبان تشير إلى S.D.؛ تم تحديد قيم p باستخدام اختبار t للطالب: *0.01 ≤ p < 0.05; **0.001 ≤ p < 0.01; ***p < 0.001). (C) تم إصلاح الخلايا مع 4٪ بارافورمالدهايد. تُظهر الصور قطرات الدهون الملطخة بـ Bodipy باللون الأخضر. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4 علاج oleate الصوديوم من خلايا dHepaRG يحفز على إلغاء تنظيم التمثيل الغذائي للدهون والتعبير الجيني الالتهابي. تم التعامل مع خلايا HepaRG (dHepaRG) المتمايزة مع السيارة (التحكم) أو مع 250-μM oleate الصوديوم لمدة 5 أيام. تم تحليل cDNAs من قبل qPCR مع التمهيديات المحددة للجينات المشار إليها والنتائج تم تطبيعها إلى متوسط GAPDH، actinB وribosomal 18S الجينات التدبير المنزلي؛ وترد المواد التمهيدية في جدولالمواد. يُظهر الرسم البياني مستويات التعبير للجينات المشار إليها كتحريضات أضعاف للخلايا المعالجة على التحكم (تشير الأشرطة إلى S.D.؛ وقد تم حساب قيم p بواسطة اختبار t للطالب). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 5
الشكل 5 توصيف تراكم قطرات الدهون بعد العلاج الأوليات الصوديوم عن طريق الفحص المجهري CAR. تم التعامل مع خلايا HepaRG (dHepaRG) المتمايزة مع السيارة (التحكم) أو مع 250 ميكرومتر أوليات الصوديوم لمدة 5 أيام وتم تحليلها من قبل مجهري ة CARS. (أ) صور تمثيلية تظهر الدهون قطرات السيارات التباين باللون الأحمر. (ب) الرسم البياني الذي يبين أعداد قطرات الدهون لكل خلية. (C) الرسوم البيانية التي تظهر إجمالي مساحة الصورة التي تغطيها قطرات لكل خلية. (D) الرسم البياني يظهر ٪ منطقة قطرات مغطاة قطرات لكل خلية. يتم التعبير عن جميع النتائج كوسيلة لثلاث تجارب مستقلة (الأشرطة تشير إلى S.E.; تم تحديد قيم p بواسطة اختبار t الطالب: *0.01 ≤ p < 0.05; **0.001 ≤ p < 0.01; ***p < 0.lt. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

الكواشف حجم (μL) لرد فعل واحد
2X SYBR صبغ الفلورسنت الأخضر 10 سنوات
PCR الصف H2O 6
التمهيدي إلى الأمام (μM) 1
التمهيدي العكسي (μM) 1

الجدول 1: المزيج الرئيسي لـ qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

يصف هذا البروتوكول كيفية التمييز بين خلايا HepaRG وكيفية الحث على steatosis الحويصلي عن طريق علاج oleate الصوديوم (الشكل1A). في الواقع، بالمقارنة مع غيرها من خطوط الخلايا سرطان الخلايا الكبدية البشرية (HCC)، يعرض خط الخلية HepaRG ملامح من خلايا الكبد البشرية البالغة، مما يمثل بديلا قيما لex vivo المزروعة خلايا الكبد البشرية الأولية13،14 ،15. وقد استخدم خط الخلية HepaRG على نطاق واسع لدراسات السمية الخلوية الكبد, استقلاب المخدرات, ودراسات علم الفيروسات15,16,22.

بالمقارنة مع خلايا HepaRG، وخطوط الخلايا HCC الأخرى مثل HepG2، HUH7، HUH6 وHep3B عرض قدرات التمثيل الغذائي أقل، وتفتقر إلى مجموعة كبيرة من وظائف الكبد محددة23،24،وتظهر مستوى أعلى من القاعدية تراكم الدهون الدورية المخزنة في قطرات الدهون. وهكذا، فإن هذه الخطوط الخلوية HCC هي أقل فائدة كنماذج للتحريض من steatosis الحويصلة بعد تحميل الدهون الزائدة من خط الخلية HepaRG.

الخطوات الحاسمة داخل البروتوكول
عندما بذر في كثافة منخفضة (2.5 × 104 خلايا / سم2),خلايا HepaRG اكتساب مورفولوجيا ممدود غير متمايزة, تقسيم بنشاط; بعد أن وصلت إلى 100٪ من الملاءمة، فهي قادرة على التمييز عند التعرض لDMSO 2٪ وأنها تشكل مستعمرات نموذجية تشبه الكبد تحيط بها الخلايا الصفرابية الشبيهة الظهارية (الشكل1D). هذه الثقافة الخلية الصفراوية / الكبد مختلطة يلخص ملامح أنسجة الكبد، تشبه حالة فسيولوجية، على الرغم من عدم وجود أنواع أخرى من خلايا الكبد (الجيوب الأنفية أو Kupffer).

خطوة حاسمة في عملية التمايز هو الملاءمة من الخلايا. يجب أن تكون الخلايا البذر في كثافة منخفضة (2.5 × 104 خلايا / سم2) (الشكل1ب)ويسمح لها بالنمو بنشاط في وسط الانتشار لمدة أسبوع واحد على الأقل (اليوم 0-7). في اليوم 7، قبل إضافة 2٪ DMSO لبدء عملية التمايز، يجب أن تكون الخلايا في التقاء 100٪ (الشكل1C). إذا لم يتم التوصل في اليوم 7 (الخطوة 2.2) إلى الملاءمة الكاملة، فمن المستحسن للغاية أن يسمح للخلايا لمواصلة النمو في وسط الانتشار لبعض الأيام الإضافية، حتى يتم تحقيق التقاء 100٪.

قيود البروتوكول
وقد لوحظ أنه بعد إضافة وسيط التمايز، تعاني بعض الخلايا، وعادة ما يموت 10٪ من الخلايا خلال الأيام 2-3 اللاحقة. في هذه المرحلة، يجب الاستمرار في الغسيل اليومي والتغير المتوسط (الخطوة 2.4) لتجاهل الخلايا الميتة العائمة. استخدام FBS محددة (جدول المواد) لتكملة كلمنالتمايز وانتشار وسائل الإعلام، ينبغي أن تزيد من كفاءة التمايز وانخفاض موت الخلايا خلال أيام 7-21 (الخطوة 2.4). ينصح بشدة للحفاظ على الخلايا حتى مرور 20، واختيار الممرات السفلى (<20) للخلايا المختلفة: يحدث موت خلايا أقل لأصغر خلايا HepaRG. وعلاوة على ذلك، يبدو أن تمايز HepaRG أكثر فعالية في أطباق 35 مم و 60 مم، في حين أن الخلايا تميل إلى المعاناة أكثر عند البذر في أطباق 100 مم و 150 مم.

التعديلات واستكشاف الأخطاء وإصلاحها
وقد ثبت التعرض لنسب مختلفة من كل من الأحماض الدهنية بالميتيك والأوليك أن يؤدي إلى تشكيل قطرات الدهون intracytoplasmatic25،26. ومع ذلك، لاحظنا أن معالجة oleate الصوديوم من خلايا HepaRG المتمايزة أظهرت نتائج أفضل من التعرض لحمض النخيل، من حيث الحث الفعال لتراكم الدهون وجدوى الخلية (الشكل2D). في الواقع، ثبت أن العلاج حمض البالميتيك سامة لخلايا HepaRG المتمايزة (الشكل2D)،بالاتفاق مع البيانات الأدبية على خطوط خلايا الكبد وعلى الثقافات الأولية الإنسان والفئران الكبدية التي تصف حمض البالميتيك باعتباره إلى حد كبير عامل السمية الخلوية25،26،27،28،29. وعلاوة على ذلك، فإن استخدام بالميتات في الاختبارات القائمة على الخلايا يشكل تحديا بسبب انخفاض قابليته احتوما. ومع ذلك، ونظرا ً للتباين الجوهري في خطوط الخلايا، يوصى بالتحقق من تركيز عمل أوليه الصوديوم وطول وقت المعالجة، واختبار تركيزات مختلفة في تجربة ذات دورة زمنية مع اختبار صلاحية الخلية.

أهمية ومقارنة تقنيات الكشف عن الدهون
تم تحديد دقيق لكميات الدهون في الخلايا من خلال عدد من النهج المختلفة في هذه الدراسة. وقد لوحظ اتفاق نوعي وكمي تقريبا بين النتائج التي تم الحصول عليها عن طريق النفط الأحمر O تلطيخ، وتلطيخ Bodipy، والتصوير CARS. لتقدير سريع لكميات الدهون في مجموعات الخلايا، واستخدام قياس السيتومتري ة تدفق بوديبي أو وصمة عار مثل النفط الأحمر O مثالية. لإجراء فحص أكثر تفصيلاً لمحتوى قطرات الدهون في الخلايا، يفضل طريقة التصوير. وعلاوة على ذلك، تم الإبلاغ عن مشاكل خصوصية لبقع الدهون مثل النفط الأحمر O20،30،ولاحظنا أنه في بعض الحالات، وصمة عار بوديبى لديه قدرة أقل من سيارات لتسمية حصرا قطرات الدهون بين الخلايا الأخرى العضيات (البيانات غير مبينة). ولذلك، فإن استخدام تقنية التصوير المجهري الخالية من الملصقات مثل CARS يوفر مزايا كبيرة للقياس الكمي والتوصيف. تجنب استخدام تسمية الفلورسنت كبيرة يجعل صور CARS مواتية بسبب صغر حجم جزيئات الدهون بالمقارنة مع الفلوروفورات النموذجية. وبالتالي، للكشف عن الدهون، وأساليب خالية من التسمية مرغوب فيها، حتى أكثر من ذلك لمراقبة جزيئات البروتين الكبيرة. إشارة CAR الدهون هي انبعاث بصري يتم إنشاؤه فقط عندما يحدث تفاعل غير خطي في العينة. لا يمكن الكشف عن هذا التفاعل إلا عندما يكون الفرق بين ترددات ليزر الإثارة اثنينتركز على العينة يطابق الميثيلين (CH 2) تمتد تردد الاهتزاز. وفرة مجموعات الميثيلين في الدهون يؤدي إلى إشارات مكثفة جدا مع نسب إشارة إلى الضوضاء عالية، وعدم الخطية للتفاعل البصري يعني أيضا أن دقة مكانية عالية ممكنة في التصوير المجهري CAR. نوعية ممتازة من صور CARS بشكل عام يسمح جمع الإحصاءات على أحجام وأعداد قطرات الدهون، كما هو مبين في هذه الدراسة. وبالإضافة إلى ذلك، أظهرت دراسات أخرى استخدام مجهرية CARS لربط مختلف التعريب تحت الخلوي ة وأحجام قطرات الدهون مع علاجات مختلفة18،وباستخدام قياسات السيارات التكميلية في أطوال موجية مختلفة، أو سيارات ذات نطاق عريض أو نهج رامان تحفيز مماثل، وقد أظهر الباحثون أنه من الممكن أن تميز أنواع مختلفة من الأحماض الدهنية داخل قطرات الدهون31،32. وعلاوة على ذلك، فإن سرعة جمع الصور CAR مكنت التصوير في الموقع من الخلايا الحية لدراسة التطور الزمني لنمو قطرات الدهون والتجميع33.

الطلبات المقبلة
في العقود الأخيرة، تطورت وجهات النظر حول أدوار ووظائف قطرات الدهون في بيولوجيا الخلايا. يعتقد سابقا أن تكون أساسا الحويصلات تخزين خاملة، ويفهم الآن أن تكون ديناميكية للغاية العضيات الخلوية، ويتم الاعتراف بدورها في المرض على نحو متزايد34،35،36. على الرغم من أنه في حالة أمراض الكبد، كان من المعروف منذ فترة طويلة أن تراكم الدهون (steatosis) هو جانب حاسم، فإن الآلية الدقيقة لمشاركة قطرات الدهون في تطور المرض ليست واضحة تماما. ولذلك، فإن أساليب مثل CARS التي يمكن أن تميز السلوك الديناميكي لقطرات الدهون ذات أهمية حاسمة لتطوير الفهم الجزيئي للأمراض بما في ذلك NAFLD. تحليل التعبير الجيني الأيضي من قبل qPCR هو مكمل للغاية للتصوير الجزيئي للدهون عن طريق CARS، كما هو مبين في الدراسات السابقة17،18، مما يسمح برؤى أعمق في آليات المرض. في هذه الدراسة، نلاحظ تراكم الأحماض الدهنية مع إلغاء تنظيم التمثيل الغذائي للدهون والتعبير الجيني الالتهابي، والتي قد تسهم في بناء لوحة من العلامات الحيوية لتشخيص المرض في وقت مبكر.

قد يؤدي النموذج القائم على الخلايا dHepaRG الذي يعالجه الصوديوم إلى زيادة المعرفة بالآليات الجزيئية التي لا تنطوي عليها في بداية المرض فحسب، بل أيضاً في تطور هذا النموذج، مما يوفر أساساً لتطوير نُهُج علاجية أفضل للمرض.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ويعلن صاحبا البلاغ أنهما ليس لديهما مصالح مالية متنافسة.

Acknowledgments

نشكر البروفيسور كريستيان تريبو (INSERM U871، ليون، فرنسا)، الذي تكرم بتوفير خلايا HepaRG. ونحن ممتنون لريتا أبيوديا على مساعدتها الإدارية. وقد تم دعم هذا العمل من قبل MIUR- Ministero dell'istruzione, dell'università e della ricerca (FIRB 2011-2016 RBAP10XKNC) وجامعة سابينزا في روما (prot. C26A13T8PS; بروت. C26A142MCH; بروت. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics