Inducing og karakteriserer flytande steatosis i differensiert HepaRG celler

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

I denne studien, beskriver vi en detaljert protokoll for inducing leveren flytande steatosis i differensiert HepaRG celler med fettsyrer salt natrium oleat og ansette metoder for påvisning og kvantifisering av lipid akkumulering, inkludert sammenhengende anti-Stokes Raman spredning (CARS) mikroskopi, cytofluorimetric analyse, olje rød O farging, og qPCR.

Cite this Article

Copy Citation | Download Citations

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hepatic steatosis representerer en metabolsk dysfunksjon som resulterer fra en opphopning av triglyserider-inneholdende lipid dråper i hepatocytter. Overdreven fett opphopning fører til alkoholfrie fatty leversykdom (NAFLD), som er potensielt reversibel og kan utvikle seg til alkoholfrie steatohepatitis (NASH) og til slutt skrumplever og leverkreft (HCC). Den molekylære mekanismer knytte lipid akkumulering i hepatocytter med progresjon til NASH, irreversible leverskader, fibrose, skrumplever, og selv HCC fortsatt uklart. For dette formål har flere in vitro-og in vivo-modeller blitt utviklet for å belyse de patologiske prosessene som forårsaker NAFLD. I denne studien, beskriver vi en cellulær modell for induksjon av leveren flytande steatosis som består av DMSO-differensiert menneskelig hepatic HepaRG celler behandlet med fettsyrer salt natrium oleat. Faktisk, natrium oleat-behandlet HepaRG celler akkumuleres lipid dråper i cytoplasma og viser typiske trekk ved steatosis. Den menneskelige modellen in vitro representerer et verdifullt alternativ til in vivo mus modeller, så vel som til den primære menneskelige hepatocytter. Vi presenterer også en sammenligning av flere metoder for kvantifisering og evaluering av fett opphopning i HepaRG celler, inkludert olje rød O farging, cytofluorimetric Bodipy måling, metabolsk genuttrykk analyse av qPCR, og sammenhengende anti-Stokes Raman spredning (CARS) mikroskopi. CARS Imaging kombinerer kjemiske spesifisitet av Raman spektroskopi, en kjemisk analyse teknikk velkjent i materialer vitenskap applikasjoner, med fordelene av høy hastighet, høy oppløsning ikke-lineære optiske microscopies å tillate presis kvantifisering av lipid akkumulering og lipid dråpe dynamikk. Etableringen av en effektiv in vitro modell for induksjon av flytande steatosis, sammen med en nøyaktig metode for kvantifisering og karakterisering av lipid akkumulering, kan føre til utvikling av tidlig fase diagnostisering av NAFLD via identifisering av molekylære markører, og til generering av nye behandlings strategier.

Introduction

Hepatic steatosis er definert som intrahepatic fett akkumulering, innen triglyserider inneholder lipid dråper, av minst 5% av leveren vekt. Langvarig hepatic lipid lagring er en potensielt reversibel prosess, men, det kan føre til leveren metabolske dysfunksjon, betennelser og avanserte former for alkoholfrie fatty leversykdom (NAFLD), den dominerende årsaken til kronisk leversykdom i mange deler av i verden1,2. NAFLD er en multifaktoriell sykdom som kan utvikle seg til de mer aggressive alkoholfrie steatohepatitis (Nash), som igjen kan utvikle seg til skrumplever og, i en liten prosentandel av pasientene, til leverkreft (HCC)1,3. Ingen godkjent terapi er for tiden tilgjengelig som en spesifikk behandling for NAFLD og kombinasjonen av kosthold og livsstil modifikasjoner forblir søyle av NAFLD og Nash Management4,5,6.

De molekylære mekanismene som førte til utviklingen av hepatic steatosis i patogenesen av NAFLD fortsatt å være belyst7. I denne sammenhengen har musemodeller blitt utviklet for å studere menneskelig steatosis sykdomsprogresjon. En myriade av ulike modeller finnes, og hver og en har sine fordeler og ulemper, inkludert genetiske, ernæringsmessige og kjemisk indusert modeller kombinere ulike tilnærminger. Genmodifiserte (transgene eller knockout) mus spontant utvikle leversykdom. Imidlertid bør det bemerkes at disse mutasjoner er svært sjeldne hos mennesker og sletting eller over-uttrykk for et enkelt gen (f. eks OB/OB mus) kan ikke etterligne etiologi av multifaktoriell menneskelige sykdom på molekylær nivå8,9. Likeledes kan sykdommen ervervet av mus etter kosttilskudd eller farmakologisk manipulasjon ikke etterligne virkningene av menneskelige dietter knyttet til utvikling av NAFLD i mann8. Animal modeller har imidlertid tilrettelagt utviklingen i forståelsen av NAFLD og denne tilnærmingen er i dag den mest brukte strategien i laboratoriet forskning. Likevel har replikering i mennesker av resultater som oppnås i dyremodeller gjentatte ganger mislyktes, forårsaker dårlig oversettelse til klinikken10.

Derfor, in vitro modeller av NAFLD kan spille en fundamental rolle i elucidating den molekylære mekanismer av NAFLD progresjon, og de representerer et verdifullt verktøy for å skjermen et stort antall forbindelser. Primær cellekulturer, udødeliggjort cellelinjer og lever biopsier har blitt mye brukt til forskningsformål11. Primær menneskelig hepatocytter ligner nøye menneskelige kliniske forhold, men det er et begrenset antall givere, og primær cellekulturer viser dårlig reproduserbarhet på grunn av variasjon i cellene. Disse observasjonene, sammen med etiske og logistiske spørsmål, har resultert i bruk av menneskets primære hepatocytter er begrenset12. Dermed representerer hepatic cellelinjer et praktisk alternativ, har flere viktige fordeler fremfor primær kultur, som hepatic cellelinjer vokse jevnt, har en nesten ubegrenset levetid, og har en stabil fenotype. Videre er cellelinjer lett tilgjengelige og kultur betingelsene for hepatic cellelinjer er enklere enn de primære hepatocytter og er standardisert blant ulike laboratorier.

Her beskriver vi i detalj en in vitro celle-basert modell av leveren flytande steatosis, representert ved hepatic differensiert HepaRG celler behandlet med fettsyrer natrium oleat. Den HepaRG cellelinjen ble etablert fra en kvinnelig pasient rammet av hepatitt C-smitte og en Edmondson karakter jeg godt differensiert leveren svulst14. Den HepaRG cellelinjen er en menneskelig bipotent Stamcelle linje i stand til å skille ved eksponering til 2% dimethyl sulfoxide (DMSO) mot to forskjellige celle fenotyper: galle-lignende og hepatocytter-lignende celler. Differensiert HepaRG celler (dHepaRG) dele noen funksjoner og egenskaper med voksen hepatocytter og har evnen til å stabilt uttrykke lever-spesifikke gener som albumin, AldolaseB, Cytokrom P450 2E1 (CYP2E1), og Cytokrom P450 3A4 (CYP3A4)13 (trinn 3). Behandling av dHepaRG celler med fettsyrer salt natrium oleat (250 μM) i 5 dager føre til generering av cytoplasmatiske lipid dråper, etterligne effekten av fettlever14,15,17,18 ( Trinn 4). Opphopning av lipid dråper kan lett oppdages av Oil Red O farging (trinn 5), en lysochrome fettløselige fargestoff som flekker nøytrale triglyserider og lipider rød-oransje. For effektivt å kvantifisere lipider i fatty dHepaRG, her illustrerer vi cytofluorimetric analyse etter farging med 4, 4-difluoro-1, 3, 5, 7-tetramethyl-4-Bora-3a, 4a-diaza-s-indacene (Bodipy 505/515) (trinn 6), en lipofile fluorescerende sonde som lokaliseres å intracellulære lipid kropper og har blitt brukt til å merke lipid dråper19. Videre viser vi hvordan man evaluerer steatosis ved kvantitativ polymerase kjedere reaksjon (qPCR) (trinn 7) genuttrykk dereguleringen av flere metabolske gener i dHepaRG celler. For ytterligere å karakterisere og kvantifisere akkumulering av lipid dråper etter natrium oleat behandling, utførte vi sammenhengende anti-Stokes Raman spredning (CARS) mikroskopi (trinn 8), en innovativ teknikk som gjør det mulig visualisering og kvantifisering av lipid dråper uten merking20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. utarbeidelse av kultur Media og reagenser

  1. Voksende medium: supplement William ' s E medium med GlutaMAX, 10% fosterets storfe serum (FBS), 1% penicillin/Streptomycin, 5 μg/mL insulin og 0,5 μM Hydrocortisone hemisuccinate.
  2. Differensiering medium: supplement William ' s E medium med GlutaMAX, 10% FBS, 1% penicillin/Streptomycin, 5 μg/mL insulin, 50 μM Hydrocortisone hemisuccinate og 2% DMSO.
  3. Frysing medium: supplement voksende medium med 10% DMSO.
  4. Natrium oleat: oppløses i 99% metanol ved en 100 mM konsentrasjon, rør O/N, og oppbevar ved-20 ° c.
  5. Olje rød O: utarbeide en lagerløsning. Veie 0,35 g olje rød O og oppløses i 100 mL isopropanol. Rør O/N, filter (0,2 μm) og oppbevares på RT. Forbered en fungerende løsning: Bland 6 mL olje rød O Stock-løsning med 4 mL ddH2O. La sitte ved romtemperatur (RT) i 20 min, og deretter filtrere med et 0,2 μm filter. Riktig filtrering er sterkt anbefalt for vellykket farging for å unngå bakgrunnen.
  6. Bodipy (505/515): oppløse Bodipy (505/515) fargestoff i DMSO ved en 100 μM lager konsentrasjon, lagre ved-20 ° c i mørket, og bruk ved en endelig 100 nM konsentrasjon.
  7. Tilegne seg gjennomsiktige glassbunn retter for CARS eksperimenter.

2. tine, forsterkning, og kryonisk bevaring av HepaRG celler

  1. Tin nitrogen embryo HepaRG celler ved å fordype en batch i en 37 ° c bad til tint. Velg en satsvis jobb med lav passasje (< 20). HepaRG-celler er kommersielt tilgjengelige.
  2. Overfør raskt cellene til et 15 mL rør som inneholder 10 mL voksende medium og sentrifuge i 5 minutter (200 x g, 4 ° c).
  3. Kast supernatanten og resuspend cellene med 5 mL voksende medium.
  4. Telle cellene og fortynne for å plate 2,5 x 104 celler/cm2.
  5. Forny mediet hver 2 eller 3 dager. Celler sprer seg med en dobling tid på rundt 24 h.
  6. Løsne HepaRG celler når på 80% confluency med 3-5 min inkubasjons med Trypsin løsning 0,05%. Samle cellene i voksende medium og sentrifuge i 5 min (200 x g, 4 ° c).
  7. Kast supernatanten og resuspend cellene med 5 mL voksende medium.
  8. Telle cellene og fortynne for å plate 2,5 x 104 celler/cm2.
  9. På dette stadiet, forsterke cellene ved å gjenta trinn 2.5-2.8 for å nå et passende antall celler for å starte eksperimenter, eller lagre nedfryste som i trinn 2,10.
  10. For å lagre nedfryste HepaRG celler, løsne cellene 24 h etter plating av 3-5 min inkubasjons med Trypsin løsning 0,05%. Samle cellene i voksende medium og sentrifuge i 5 min (200 x g, 4 ° c). Kast supernatanten, resuspend cellene i 1 mL/batch av frysing medium, 1,5 x 106 celler/batch og lagre nedfryste partiene i flytende nitrogen.

3. differensiering av HepaRG celler (dag 0 – 21) (figur 1A)

  1. Dag 0. Seed HepaRG celler ved lav tetthet (2,5 x 104 celler/cm2) i kultur behandlet retter med passende volum av spredning medium (figur 1B). To retter må være belagt for hver analyse (Oil Red O farging, FACS analyse, qPCR): en for kontroll celler og en for oleat-behandlede celler. Hvis du utfører biler målinger (trinn 8), frø cellene parallelt i gjennomsiktig glassbunn retter. Som en kontroll, høste en ubehandlet parabolen (voksende celler dag 0) til å utføre genuttrykk analyse av differensiering markør gener (se trinn 3,6).
  2. Dag 2 og dag 4. Endre medium med passende volum av spredning medium og la cellene vokse til samløpet.
  3. Dag 7. Cellene må være 100% confluent (figur 1C). Vask cellene én gang med 1x fosfat-bufret saltvann (PBS). Fjern 1x PBS og legge til et passende volum av differensiering medium.
  4. Dag 8, 9, 12, 15, 18.  Vask cellene én gang med 1x PBS. Fjern 1x PBS og legge til et passende volum av differensiering medium.
  5. Dag 21. Observer HepaRG celler under et mikroskop og sikre at cellene er confluent differensiert kulturer (figur 1D).
  6. Som en kontroll, høste en kontroll parabolen (differensiert celler dag 21) for å utføre genuttrykk analyse (trinn 7) av differensiering markør gener (figur 1E).
  7. På dag 21, kan differensiert HepaRG celler bli embryo i flytende nitrogen.

4. induksjon av flytande steatosis (dag 21 – 26)

  1. Dag 21. Fortynne natrium oleat (100 mM) med et passende volum av fullstendig differensiering medium til en endelig konsentrasjon av 250 μM (1:400). Legg 99% metanol 1:400 (samme volum som for natrium oleat) til en annen alikvot av differensiering medium for å gjøre kjøretøyet-kontroll behandling. (For eksempel: tilsett 25 μL av natrium oleat til 10 mL medium og parallelt tilsett 25 μL av 99% metanol til 10 mL medium). Vask cellene én gang med 1x PBS og Legg til kjøretøy eller natrium oleat medium.
  2. Dag 23 og dag 25. Endre mediet med riktig volum av ferskt forberedt medium som i trinn 4,1.
  3. Dag 26. Observer ved optisk mikroskop som lipid dråper akkumuleres i natrium oleat-behandlede celler og er lett synlige som gjennomskinnelig dråper i cytoplasma som i figur 2A.

5. evaluering ofLipid overbelastning og steatosis induksjon: olje rød O farging

  1. Vask han celler en gang med 1x PBS og fjerne 1x PBS helt.
  2. Tilsett 4% paraformaldehyde (fortynnet i 1x PBS) og ruge i 15 minutter ved RT.
    Forsiktig: Paraformaldehyde er giftig, så dette trinnet må utføres i en avtrekks hette, med verneutstyr, inkludert hansker, en Laboratoriefrakk og en maske.
  3. Fjern paraformaldehyde og vask cellene to ganger med 1x PBS. Celler kan oppbevares i 1x PBS ved 4 ° c for et par dager før farging. Pakk med parafilm og dekk med aluminiumsfolie for å hindre at cellene tørker.
  4. Fjern 1x PBS. Ruge cellene med 60% isopropanol i 5 minutter ved RT.
  5. Fjern isopropanol og la cellene tørke helt ved RT.
  6. Tilsett olje rød O arbeids løsning og ruge ved RT i 30 min. Volumet av fungerende løsning kreves for hver prøve tilsvarer volumet av medier som brukes for dyrking cellene.
  7. Fjern olje rød O løsning og umiddelbart legge ddH2o. vask cellene 4 ganger med ddH2o.
  8. Skaff bilder under mikroskopet for analyse (figur 2B).
  9. Å eluere olje rød O fargestoff: fjerne alt vannet og la tørke; Tilsett 1 mL 100% isopropanol og ruge i 10 minutter med skånsom risting ved RT.
  10. Pipet isopropanol med eluert olje rød O fargestoff opp og ned flere ganger, slik at alle Oil Red O er i løsningen. Overfør løsningen til en Cuvette. Mål OD500 NM ved Spektrofotometri og bruk 100% isopropanol som blank (figur 2C).

6. evaluering av lipid overbelastning og steatosis induksjon: Bodipy farging og Cytofluorimetric analyse

  1. Vask cellene én gang med 1x PBS. Ruge med 100 nM i Bodipy fortynnet i 1x PBS i mørket i 40 min ved 37 ° c. En unstained kontroll bør tas med i strømnings flowcytometri målinger. Fra dette punktet, beskytte prøvene fra lys så mye som mulig.
    Merk: Volumet av farge løsning som kreves for hver prøve, tilsvarer volumet av medier som brukes for dyrking celler.
  2. Fjern farge løsningen og vask cellene én gang med 1x PBS. Fortsett til trinn 6.3-6.6. for FACS (fluorescens-aktivert celle sortering) analyse eller til trinn 6,7 for mikroskop Imaging.
  3. Skrape cellene forsiktig med 1x PBS og overføre den til en 15 mL tube. Sentrifuger for 10 min (200 x g, 4 ° c).
  4. Fjern forsiktig supernatanter uten å forstyrre pellets og vask med 3 mL 1x PBS. Sentrifuge i 5 minutter (200 x g, 4 ° c).
  5. Fjern supernatanter og resuspend i 300 μL av 1x PBS, og Overfør deretter til et FACS-rør.
  6. Umiddelbart måle Bodipy fluorescens intensitet ved cytofluorimetric analyse med eksitasjon/utslipps bølgelengder på 505/515 NM (Figur 3A, B).
  7. Vask cellene én gang med 1x PBS og fjern PBS helt.
  8. Tilsett 4% paraformaldehyde (fortynnet i 1x PBS) og ruge i 15 minutter ved RT.
    Forsiktig: Paraformaldehyde er giftig, så dette trinnet må utføres i en avtrekks hette, med verneutstyr, inkludert hansker, en Laboratoriefrakk og en maske.
  9. Fjern paraformaldehyde og vask prøvene 3x for 5 min i PBS. Celler kan oppbevares i 1x PBS ved 4 ° c eller avbildet umiddelbart (Figur 3C). For lagring, Pakk med parafilm og dekk med aluminiumsfolie for å hindre at cellene tørker.

7. evaluering av lipid overbelastning og steatosis induksjon: qPCR

  1. Vask cellene én gang med 1x PBS. Skrap cellene med 1x PBS, sentrifuger på 200 x g, og kast supernatanten. På dette trinnet, kan celler høstes ved-80 ° c eller behandles som i trinn 7,2.
  2. Utfør total RNA-isolasjon ved hjelp av standard metoder ved bruk av kommersielle reagenser som følger produsentens anvisninger.
  3. Vurder RNA-konsentrasjonen ved UV-Spektrofotometriske måling, slik at RNA-renheten er høy (nær 2,0) basert på A260/A280-målingen.
  4. Syntetisere cDNA fra 1 μg av total RNA med et standard cDNA-syntese.
  5. Fortynne cDNA til et endelig 50 μL volum med H2O.
  6. Analyser hver cDNA prøve i tre eksemplarer av qPCR: Forbered en qPCR Master mix (tabell 1) som er tilstrekkelig for de nødvendige reaksjonene for hver primer, inkludert primere spesifikke for de tre housekeeping gener som kontroller: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB og ribosomal 18S (se tabell over materialer for primer sekvenser):
  7. Dispensere 18 μL av Master Mix per brønn i en PCR-multiwall plate.
  8. Tilsett 2 μL av cDNA-prøve i hver brønn. Forsegle platen.
  9. Kjør prøvene i henhold til termisk cycler instruksjon.

8. evaluering av lipid overbelastning og steatosis induksjon: CARS

  1. Fix cellene tidligere utarbeidet på glassbunn retter, som beskrevet i trinn 5.1-5.3.
  2. Slå på en kommersiell tunable picosecond pulserende lasersystem, tuning det å få to utganger av ulike bølgelengder. Frekvens forskjellen mellom utgangene må være 2 840 cm-1 for å generere den intense Cars lys signal som tilsvarer metylen symmetrisk stretching; for en fast bølgelengde på 1 064 NM ("Stokes" Light), bør den andre bølgelengden være innstilt til 817 NM ("pumpe" lys).
  3. Sørg for at 817 NM-utgangen er romlig og midlertidig overlappes med 1 064 NM-utgang: Bruk en passende dichroic speil (dvs. med et kutt mellom 817 og 1 064 NM) til romlig kombinere bjelkene og bruke en optisk forsinkelse linje for å oppnå timelig overlapping av laseren Pulser.
  4. Sørg for at de to copropagating bjelkene er både collimated og at deres diameter har lignende verdier som passer for det optiske systemet i mikroskopet som vil fokusere dem på prøven; om nødvendig, separat collimate bjelkene før dichroic speilet som kombinerer dem.
  5. Slå på en kommersiell invertert mikroskop system, som bør inneholde en infrarød laserskanning enhet og en dual-Channel rød/grønn Epi deteksjon enhet og justere copropagating laserstråler inn i skannerenheten.
  6. Åpne dual-Channel Epi deteksjon enhet, fjerne filteret kuben og erstatte den røde bølgelengde deteksjon filter med en båndpassfilter som kan velge 2 840 cm-1 biler signal som er sentrert på 663 NM for 817/1064 NM Pump/Stokes eksitasjon Ordningen. En smal båndbredde (20 NM) filter foretrekkes for å unngå innsamling av høye nivåer av fluorescerende bakgrunns signaler.
  7. Plasser en rett på scenen av invertert CARS mikroskop, og ved hjelp av en 100 ganger olje-nedsenking objektiv, flytte den vertikale posisjonen til målet å fokusere på cellene.
  8. Sett opp mikroskop programvaren for å samle høyoppløselige (1024 x 1024 piksler) bilder over et synsfelt som spenner over 127 μm x 127 μm.
  9. Still mikroskop programvaren til å kontinuerlig anskaffe og vise bilder av 127 μm x 127 μm synsfelt og Sjekk de viste bildene mens optimalisere bildet samlingen parametere. Kontroller at laser kreftene er balansert for rask bilde innsamling og minimal skade, innsetting av passende nøytrale tetthets filtre i stråle banene etter behov, og velg en piksel som gjør det mulig å samle bilder med god signal-til-støy- forhold under de valgte laser effekt forholdene.
  10. Tilegne seg og lagre bilder av flere ulike felt av visning i fatet under de optimaliserte forhold. Alternativt, multiphoton fluorescens bilder, generert av en grønn bølgelengde utslipp (for det meste fra to-Foton eksitasjon på 817 NM), kan samtidig samles inn via den andre Epi detektor. Gjenta trinn 8.7-8.10 for hver tallerken.
  11. For CARS bildeanalyse, Prosessbilder ved hjelp av FIJI gjennomføringen av ImageJ. Bruk Støvfjernar-funksjonen (eller et lignende denoising verktøy) på hvert bilde før videre analyse for å forbedre signal-til-støy-forhold uten tap av detaljer.
  12. Bruk FIJI til å velge celler manuelt og deretter automatisk telle lipid dråper innenfor segmentert individuelle celler til å produsere statistikk på lipid dråpe områder og tall for hver celle og for hele bildet datasett for hver tallerken.

9. MTT Cell levedyktighet analysen

  1. Plate differensiert HepaRG celler i en 96-brønn plate med en tetthet på 1 x 105 celler/brønn i en endelig 100 μL volum av differensiering kultur medium.
  2. 24 timer etter såing, behandle cellene med 99% metanol (kjøretøy) og med 100 μM, 250 μM og 500 μM natrium oleat og natrium askorbylpalmitat fortynnet i 100 μL av differensiering kultur medium/brønn i tre eksemplarer.
  3. Bytt medium med 99% metanol og med 100 μM, 250 μM og 500 μM natrium oleat og natrium askorbylpalmitat fortynnet i 100 μL av differensiering kultur medium/brønn hver 24 h.
  4. 96 h etter metanol/natrium oleat/natrium askorbylpalmitat behandling, behandle cellene med 2 μM doksorubicin fortynnet i 100 μL av differensiering kultur medium/brønn i tre eksemplarer som en kontroll.
  5. 18 timer etter doxorubucin behandling, endre medium med 100 μL av differensiering kultur medium.
  6. Pipet 20 μL av 3-(4, 5-dimethylthiazol-2-YL)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagens MTT (tabell av materialer) i hver brønn på 96-brønn analysen plate som inneholder cellene i 100 μL av differensiering kultur medium . Ta med en bakgrunns kontroll ved å pipettering 20 μL av reagens i en kontroll brønn uten celler i 100, μL av differensiering kultur medium i tre eksemplarer.
  7. Ruge platen ved 37 ° c i en fuktet, 5% CO2 atmosfære.
  8. Etter incubating for 30, 60 og 90 min med MTT tetrazolium reagens, ta opp absorbansen ved 490 NM ved hjelp av en 96-brønn plate leser. Trekk fra bakgrunns absorbansen til ingen cellekontroll brønner fra de absorbansen verdiene for de andre utvalgene.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Denne protokollen beskriver en effektiv metode for å indusere og karakterisere flytande steatosis i DMSO-differensiert HepaRG celler ved natrium oleat behandling (figur 1A).

Differensiering av HepaRG celler.
For å effektivt indusere differensiering, voksende celler må være sådd med lav tetthet (2,5 x 104 celler/cm2) i sprednings mediet. Når seeded ved lav tetthet, cellene aktivt dele og erverve en langstrakt udifferensierte morfologi (figur 1B). Cellene bør overlates til å vokse i spredningen medium i 7 dager, inntil 100% confluency er nådd (figur 1C). Etter eksponering til 2% DMSO, celler begynner å differensiere og å danne typiske hepatocytter kolonier omgitt av galle epitel-lignende celler (figur 1D). Differensiert HepaRG celler uttrykker sykdommer-spesifikke markører, slik som albumin, Cyp3A4 og Aldolase B. For å verifisere riktig differensiering, ble uttrykks nivåene til disse lever markør genene i de differensiert cellene (dag 21) og i de voksende cellene (dag 0) analysert av qPCR (figur 1E). Albumin, Cyp3A4 og Aldolase B gener bør være upregulated i differensiert HepaRG celler i forhold til voksende HepaRG celler, og vi observerte denne trenden, bekrefter effektiviteten av vår differensiering protokollen.

Induksjon av flytande steatosis i HepaRG celler ved natrium oleat behandling.
Natrium oleat behandling av dHepaRG celler induserer fett opphopning, synlig under et optisk mikroskop som lipid dråper i cytoplasms (figur 2A). Å verifisere effektiv induksjon av steatosis, oleat-behandlet og kontroll HepaRG celler ble farget med olje rød O fargestoff. Etter farging, lipid dråper er lett synlige som røde dråper (figur 2B) og kan være kvantifisert ved Spektrofotometriske måling av olje rød O fargestoff Eluert med isopropanol (figur 2C). Absorbansen av eluert Oil Red O fra cellene er direkte proporsjonal med cytoplasmatiske lipid dråpe akkumulering.

Natrium oleat konsentrasjon og eksponeringstid ble bestemt av MTT fargemetrisk celle levedyktighet analysen (trinn 9). Natrium oleat behandling ble sammenlignet med natrium askorbylpalmitat behandling og den apoptotisk medikament doxorubucin (2 μM) ble brukt som en kontroll (figur 2D). Cytoxicity av forbindelsene ble evaluert av MTT, utnytter en kommersiell sammensatte (tabell av materialer), som inneholder MTT tetrazolium. Den vannløselige gule MTT tetrazolium Compound er bioreduced av metabolically aktive celler til et lilla vann-uløselig formazan produkt. Den formazan produktet er kvantifisert av sin absorbansen på 490 NM og beløpet er direkte proporsjonal med antall levende celler i kultur (figur 2D).

Kvantifisering av flytande steatosis i natrium oleat-behandlede HepaRG celler
Å kvantifisere økningen av mobilnettet lipid innhold etter natrium oleat behandling, utførte vi farging med Bodipy fargestoff, en sonde som etiketter lipid dråper. Ved hjelp av cytofluorimetric analyse, er det mulig å kvantifisere triglyserider innhold av Bodipy bety fluorescerende intensitet, som er høyere i oleat celler sammenlignet med kontroll celler (Figur 3A, B), indikerer effektiv fett akkumulering etter oleat behandling. Faktisk, bilder av Bodipy-fargede celler viser lyse grønne fluorescerende lipid dråper i oleat celler som ikke er synlige i kontrollcellene (Figur 3C).

Natrium oleat behandling av dHepaRG celler deregulates lipid metabolisme og inflammatorisk genuttrykk. For å evaluere effektiv induksjon av flytande steatosis, analyserte vi med qPCR uttrykks nivåer av utvalgte gener i natrium oleat celler i forhold til de av kontroll celler (Figur 4). Acetyl-CoA carboxylase beta (ACACB), glyserol-3-fosfat acyltransferase mitokondrie (GPAM), perilipins (PLIN2, PLIN4), Apolipoprotein B (APOB), pyruvat dehydrogenase kinase izofermenta 4 (PDK4), carnitine palmitoyltransferase 1A (CPT1A) og interleukin 6 (IL6) ble upregulated i oleat dHepaRG celler, mens stoff carrier Family 2 medlem 1 (SLC2A1), Apolipoprotein C-III (APOC3), og stearoyl-CoA desaturase (SCD) var downregulated (Figur 4). For ytterligere å karakterisere og kvantifisere lipid lagring i dråper ved tilsetning av natrium oleat til differensiert HepaRG celler, benyttet vi en innovativ mikroskopi teknikk, sammenhengende anti-Stokes Raman spredning (CARS) mikroskopi, som gjør visualisering og kvantifisering av lipid dråper uten merking (figur 5A). Lipid dråper ble statistisk kvantifisert i form av tall, distribusjon og morfologi på enkelt cellenivå ved hjelp av CARS bilder. Behandling med natrium oleat (250 μM) indusert en betydelig økning i antall lipid dråper (figur 5B), noe som førte til en høyere total dråpe område per celle (figur 5C) og en høyere prosentandel dråpe område per celle ( Figur 5D), sammenlignet med kontroll celler, som indikerer at dHepaRG celler effektivt akkumulert fett etter natrium oleat behandling.

Figure 1
Figur 1 : Differensiering av HepaRG celler. (A) representativt diagram som viser HepaRG celle differensiering/behandlingsprotokoll som beskrevet i trinn 3 og 4. (B-D) Bilder som viser unstained voksende HepaRG celler på dag 0 etter seeding (B), ved samløpet dag 7 etter seeding (C), og differensiert HepaRG (dHepaRG) på dag 21 etter seeding (D). (E) total RNA ble Hentet fra voksende og dHepaRG celler, cDNA ble syntetisert og analysert av qPCR ved hjelp av primere spesifikke for de indikerte gener (tabell over materialer). Prøvene ble normalisert til gjennomsnittet av GAPDH, actinB og ribosomal 18S housekeeping gener. Histogrammer viser fold induksjon av voksende (dag 0) kontra differensiert celler (dag 21) (barer indikerer S.D.; p-verdier ble beregnet av student t-tester). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Natrium oleat behandling av dHepaRG celler indusert lipid dråpe akkumulering. (A) bilder av unstained differensiert HepaRG (dHepaRG) celler behandlet i 5 dager med kjøretøy (kontroll) (venstre bilde) eller med 250 μM natrium oleat (høyre bilde). (B) etter behandling, ble cellene farget med olje rød O fargestoff; lipid dråper er synlige i rødt. (C) olje rød O fargestoff ble ELUERT og OD ble målt ved 570 NM. Resultatene uttrykkes som middel for tre uavhengige eksperimenter (stolper indikerer S.D.; p-verdi av student t-test). (D) celle levedyktighet evaluering av dHepaRG celler kjøretøy (99% metanol) behandlet (Ctrl) eller behandlet i 5 dager med natrium oleat og natrium askorbylpalmitat (100 μM, 250 μM, eller 500 μM), eller behandlet 18 timer med doxorubucin (2 μM).  Vurdering av cytotoksisitet ble utført ved hjelp av en MTT analyse Kit (tabell av materialer), innspilling absorbansen ved 490 NM, i henhold til produsentens instruksjon. Resultatene uttrykkes som middel for tre uavhengige eksperimenter (stolper indikerer at S.D.; p-verdier ble bestemt ved hjelp av student t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Kvantifisering av fett opphopning etter natrium oleat behandling ved Bodipy farging. Differensiert HepaRG (dHepaRG) celler ble behandlet med kjøretøy (kontroll) eller med 250-μM natrium oleat i 5 dager. Etter behandling, dHepaRG celler ble farget med Bodipy fargestoff og analysert ved flyt flowcytometri. (A) representative overleggs profiler (% av maks: prosentandel av maksimal farge intensitet). (B) histogrammer viser gjennomsnittlig fluorescens INTENSITET (MFI) som en prosentandel av behandlede celler over kontroll fra tre uavhengige eksperimenter (stolper indikerer S.D.; p-verdier ble bestemt ved hjelp av student t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). (C) celler ble fikset med 4% paraformaldehyde. Bilder viser Bodipy-beiset lipid dråper i grønt. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Natrium oleat behandling av dHepaRG celler induserer dereguleringen av lipid metabolisme og inflammatorisk genuttrykk. Differensiert HepaRG (dHepaRG) celler ble behandlet med kjøretøy (kontroll) eller med 250-μM natrium oleat i 5 dager. cDNAs ble analysert av qPCR med primere spesifikke for indikerte gener og resultatene ble normalisert til gjennomsnittet av GAPDH, actinB og ribosomal 18S housekeeping gener; den primere er gitt i tabellen av materialer. Histogrammet viser uttrykks nivåer av indikerte gener som fold inductions av behandlede celler over kontroll (barer indikerer S.D.; p-verdier ble beregnet av student t-test). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 : Karakterisering av lipid dråpe akkumulering etter natrium oleat behandling av Cars mikroskopi. Differensiert HepaRG (dHepaRG) celler ble behandlet med kjøretøy (kontroll) eller med 250 μM natrium oleat i 5 dager og ble analysert av CARS mikroskopi. (A) representative bilder som viser LIPID dråpe Cars kontrast i rødt. (B) histogram som viser antall lipid dråper per celle. (C) histogrammer som viser totalt bildeområde dekket av dråper per celle. (D) histogram som viser% dråpe område dekket av dråper per celle. Alle resultater uttrykkes som middel for tre uavhengige eksperimenter (stolper indikerer S.E.; p-verdier ble bestemt av student t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Vennligst klikk her for å se en større versjon av dette tallet.

Reagenser Volum (μL) for en enkelt reaksjon
2x SYBR grønt fluorescerende fargestoff 10
PCR-klasse H2O 6
Fremover primer (μM) 1
Omvendt primer (μM) 1

Tabell 1: qPCR Master mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne protokollen beskriver hvordan å differensiere HepaRG celler og hvordan å indusere flytande steatosis ved natrium oleat behandling (figur 1A). Faktisk, sammenlignet med andre menneskelige leverkreft (HCC) cellelinjer, HepaRG cellelinjen utstillinger funksjoner av voksne menneskelige hepatocytter, som representerer et verdifullt alternativ til ex vivo dyrket primære menneskelige hepatocytter13,14 ,15. Det HepaRG cellen line er blitt vidt anvendt for lever cytotoksisitet studier, bedøve metabolisme, og Virology studier15,16,22.

I sammenligning med HepaRG celler, andre HCC cellelinjer som HepG2, HUH7, HUH6 og Hep3B vise lavere metabolske kapasiteter, mangler et betydelig sett av lever-spesifikke funksjoner23,24, og viser en høyere basal nivå av cytosolic fett akkumulering lagret i lipid dråper. Dermed er disse HCC cellelinjer mindre nyttige som modeller for induksjon av flytande steatosis etter lipid overbelastning enn HepaRG cellelinjen.

Kritiske trinn i protokollen
Når seeded ved lav tetthet (2,5 x 104 celler/cm2), HepaRG celler tilegne seg en langstrakt udifferensierte morfologi, aktivt dele; etter å ha nådd 100% confluency, de er i stand til å skille ved eksponering til 2% DMSO og de danner typiske hepatocytter kolonier omgitt av galle epitel-lignende celler (figur 1D). Dette blandet galle/hepatocytter cellekultur viser funksjoner i leveren vev, likner en fysiologisk tilstand, til tross for mangler andre lever celletyper (sinusformet eller Kupffer).

Et kritisk trinn i differensiering prosessen er confluency av celler. Cellene må være sådd ved lav tetthet (2,5 x 104 celler/cm2) (figur 1B) og lov til å aktivt vokse i spredningen medium i minst 1 uke (dag 0-7). På dag 7, før du legger til 2% DMSO å starte differensiering prosessen, må cellene være på 100% samløpet (figur 1C). Hvis på dag 7 (trinn 2,2) fullstendig confluency ikke er nådd, er det sterkt anbefalt at cellene får lov til å fortsette å vokse i spredningen medium for noen ekstra dager, til 100% samløpet er oppnådd.

Begrensninger for protokollen
Det har blitt observert at etter å ha lagt differensiering medium, noen celler lider, og vanligvis 10% av cellene dør i løpet av de påfølgende 2-3 dager. På dette stadiet, må daglig vask og medium endring (trinn 2,4) fortsette å forkaste flytende døde celler. Bruken av en bestemt FBS (tabell av materialer) for å supplere både differensiering og spredning Media, bør øke differensiering effektivitet og lavere celle død i løpet av dager 7-21 (trinn 2,4). Det anbefales sterkt å opprettholde celler opp til passasje 20, og å velge lavere passasjer (< 20) for å skille celler: mindre celler død oppstår for de yngste HepaRG cellene. Videre HepaRG differensiering synes å være mer effektiv i 35 mm og 60 mm retter, mens celler har en tendens til å lide mer når seeded i 100 mm og 150 mm retter.

Modifikasjoner og feilsøking
Eksponering for ulike forhold av både palmitinsyre og oljesyre fettsyrer har vist å resultere i dannelsen av intracytoplasmatic lipid dråper25,26. Men, observerte vi at natrium oleat behandling av differensiert HepaRG celler utstilt bedre resultater enn palmitinsyre syre eksponering, i form av effektiv induksjon av lipid akkumulering og celle levedyktighet (figur 2D). Faktisk viste palmitinsyre syre behandling å være giftig for differensiert HepaRG celler (figur 2D), i samråd med litteraturdata om hepatosarkom cellelinjer og på menneske-og rotte hepatocytter primære kulturer som beskriver palmitinsyre syre som en betydelig cytotoksisk agent25,26, 27,28,29. Videre er utnyttelse av askorbylpalmitat i celle-baserte analyser utfordrende på grunn av sin lave løselighet. Likevel, på grunn av den iboende variasjonen av cellelinjer, anbefales det å verifisere natrium oleat arbeids konsentrasjon og behandlingstid lengde, teste ulike konsentrasjoner i en tid-kurs eksperimentere med en celle levedyktighet analysen.

Betydning og sammenligning av lipid deteksjon teknikker
Nøyaktig bestemmelse av lipid beløp i cellene ble etablert via en rekke ulike tilnærminger i denne studien. Kvalitativ og også omtrent kvantitativ avtale ble observert mellom resultatene oppnådd via olje rød O farging, Bodipy farging, og CARS Imaging. For en rask estimering av lipid mengder i celle populasjoner, er bruken av Bodipy-Flow flowcytometri eller en flekk som Oil Red O ideelt. For en mer detaljert undersøkelse av lipid dråpe innhold av celler, er en tenkelig modalitet foretrukket. Videre har spesifisitet problemer blitt rapportert for lipid flekker som olje rød O20,30, og vi har observert at i noen tilfeller har Bodipy flekken en lavere kapasitet enn biler å utelukkende etiketten lipid dråper blant andre celle organeller (data ikke vist). Derfor, bruk av en etikett-fri mikroskopisk Imaging teknikk som CARS gir betydelige fordeler for steatosis kvantifisering og karakterisering. Unngåelse av bruk av et stort fluorescerende merke gjør CARS Imaging gunstig på grunn av den lille størrelsen av lipid molekyler i forhold til typiske fluorophores; Derfor, for påvisning av lipider, etikett-frie metoder er ønskelig, enda mer enn for å observere store protein molekyler. Den lipid CARS signalet er en optisk utslipp som genereres bare når en ikke-lineær interaksjon oppstår i utvalget. Denne samhandlingen kan bare oppdages når forskjellen mellom frekvensene av de to eksitasjon lasere fokusert på prøven samsvarer med metylen (CH2) strekker vibrasjonsmedisin frekvens. Overflod av metylen grupper i lipider resulterer i en svært intens signaler med høy signal-til-støy-forhold, og nonlinearity av den optiske samspillet betyr også at høy romlig oppløsning er mulig i CARS mikroskopi. Den utmerkede kvaliteten på CARS bilder generelt tillater innsamling av statistikk på størrelser og antall lipid dråper, som demonstrert i denne studien. I tillegg har andre studier vist bruken av CARS mikroskopi å relatere ulike subcellulære lokaliseringer og størrelser av lipid dråper med ulike behandlinger18, og ved hjelp av supplerende Cars målinger på ulike bølgelengder, eller en bredbånd biler eller lignende stimulert Raman tilnærming, har forskere vist at det er mulig å karakterisere ulike typer fettsyrer innen lipid dråper31,32. Videre har hurtighet av CARS bilde samlingen aktivert in-situ Imaging av levende celler for å undersøke den timelige utviklingen av lipid dråpe vekst og aggregering33.

Fremtidige applikasjoner
I de siste ti årene, synspunkter på roller og funksjoner av lipid dråper i cellebiologi har utviklet seg. Tidligere antatt å være i utgangspunktet inert lagring blemmer, er de nå forstått å være svært dynamisk mobilnettet organeller, og deres rolle i sykdommen er i økende grad blir anerkjent34,35,36. Selv i tilfelle av leversykdom, lipid akkumulering (steatosis) har lenge vært kjent for å være et kritisk aspekt, den presise mekanismen for involvering av lipid dråper i sykdomsprogresjon er ikke helt klart. Derfor metoder som biler som kan karakterisere den dynamiske atferden til lipid dråper er av avgjørende betydning for utviklingen av en molekylær forståelse av sykdommer, inkludert NAFLD. Metabolsk genuttrykk analyse av qPCR er svært utfyllende til molekylær avbildning av lipider via Cars, som demonstrert i tidligere studier17,18, slik at dypere innsikt i sykdoms mekanismer. I denne studien, observerer vi fatty acid akkumulering med dereguleringen av lipid metabolisme og inflammatorisk genuttrykk, som kan bidra til bygging av et panel av bio-markører for tidlig sykdom diagnose.

Den natrium oleat-behandlede dHepaRG celle-baserte modellen kan øke kunnskapen om de molekylære mekanismene som er involvert ikke bare i utbruddet, men også i utviklingen av NAFLD, noe som gir grunnlag for utvikling av bedre terapeutiske tilnærminger til sykdommen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer at de ikke har noen konkurrerende finansielle interesser.

Acknowledgments

Vi takker Prof. Christian trepo (INSERM U871, Lyon, Frankrike), som ber forutsatt HepaRG celler. Vi er takknemlige til Rita Appodia for administrativ hjelp. Dette arbeidet ble støttet av MIUR-Ministero dell'istruzione, dell'università e della ricerca (FIRB 2011 – 2016 RBAP10XKNC) og Sapienza-Universitetet i Roma (beskytte. C26A13T8PS; Beskytte. C26A142MCH; Beskytte. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics