ضبط التدهور لتحقيق استنفاد البروتين محددة وفعالة

Immunology and Infection
 

Summary

هنا، نقدم بروتوكول لاستنفاد بشكل فعال وعلى وجه التحديد بروتين من الفائدة في الخميرة Saccharomyces سيريفيسياي باستخدام نظام بيتا-است AID.

Cite this Article

Copy Citation | Download Citations

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ومستقبلات ربط الأوكسين النبات، TIR1، تعترف البروتينات التي تحتوي على عزر degron الأوكسين-inducible محددة (AID) في وجود أوكسين، واستهدافها للتحلل. يتم استغلال هذا النظام في العديد من eukaryotes غير النباتية، بحيث يتم تحلل البروتين المستهدف، الموسومة عزر AID، عند إضافة أوكسين. ويعتبر مستوى تعبير TIR1 حاسماً؛ التعبير المفرط يؤدي إلى تدهور البروتين الموسومة AID حتى في غياب أوكسين، في حين أن انخفاض التعبير يؤدي إلى استنفاد بطيء. وقد أُنشئ نظام للمعونة القابلة للبث الذاتي، مع التعبير عن TIR1 تحت سيطرة مروج للاحتسradioات بيتا. مستوى TIR1 قابل للضبط عن طريق تغيير وقت الحضانة مع β-استراديول قبل إضافة أوكسين. يصف هذا البروتوكول كيفية استنفاد بروتين مستهدف بسرعة باستخدام نظام AID. يعتمد وقت الحضانة المناسب بيتا استراديول على وفرة البروتين المستهدف. ولذلك، فإن الاستنفاد الفعال يعتمد على التوقيت الأمثل الذي يقلل أيضا من استنفاد الأوكسين المستقلة.

Introduction

الطفرات المشروطة، مثل المتحولين الحساسة لدرجة الحرارة، هي أداة قوية لدراسة البروتينات الأساسية، مما يسمح بنمو الخلايا في ظل حالة متساهلة ولكن هافة فقدان الوظيفة في ظل ظروف غير متساهلة. ومع ذلك, استقلاب الخلايا يمكن أن تكون منزعجة بشكل خطير من قبل التغيير في ظروف النمو المطلوبة للحث على العيب، ويمكن أيضا خلق آثار خارج الهدف. وقد وضعت عدة طرق، حيث يتم عزل البروتين من الفائدة بشكل مشروط1 أو يتم التحكم في التعبير عنها2،3 عن طريق إضافة جزيء صغير. يستخدم هذا البروتوكول auxin ونظام degron auxin-inducible (AID) لاستنفاد البروتين المستهدف بكفاءة.

نظام AID له أصله في النباتات، حيث يستخدم أوكسين (في هذا البروتوكول حمض الخليك indole-3-acetic (IAA)، ويحفز التفاعل من البروتين Aux /IAA مع TIR1، وهو عضو في مجمع SCF U3 ubiquitin ligase4. SCF التفاعل المعقد يسبب تعدد الحوالي من البروتينات العائلية Aux / IAA ، مما يؤدي إلى تدهورها من قبل بروتياسوم5،6.

تم تكييف هذا النظام سابقا للاستخدام في الخميرة Saccharomyces سيريفيسياي7،8 عن طريق التعبير عن البروتين TIR1 من Oriza ساتيفا (osTIR) في خلايا الخميرة ، حيث أنها قادرة على التفاعل مع الخميرة الذاتية مجمع SCF. تم وضع علامة على البروتين من الاهتمام مع عزر من البروتين Aux/IAA IAA17 لاستهدافه للتدهور. تم تطوير الاقتطاع الوظيفي لـ IAA17 في وقت لاحق، مثل AID*8و9و10،الذي يحتوي على 43 زخرفة حساسة للحمض الأميني من Arabidopsis thaliana IAA17، جنبا إلى جنب مع علامة epitope لتمكين الكشف عن.

النظام تكييفها في البداية للاستخدام في الخميرة الناشئة7,8 أعرب عن البروتين osTIR1 من الخميرة GAL المروج. يتطلب التعبير التحول إلى متوسط النمو مع الجالاكتوز كمصدر الكربون الوحيد، والذي، للأسف، يؤدي إلى تحول ثنائي مع تغييرات واسعة النطاق لعملية التمثيل الغذائي للخلايا11. ومن ناحية أخرى، أُفيد بأن التعبير التأسيسي عن النقل الدولي الثالث عشر يمكن أن يؤدي إلى تدهور البروتين المستهدف في غياب الأوكسين/IAA12 إذا كان مستوى التعبير مرتفعاً، في حين أن انخفاض التعبير عن النقل بالتيراد عشر يسبب استنفاداً غير كفء. وقد تم تطوير نظام مساعدة محسن يسمى β-est AID الذي يخضع لـ osTIR لسيطرة مروج غير قابل للاستعمال يمكن ضبطه ليلائم البروتين المستهدف، مع الحد الأدنى من التأثير على استقلاب الخلايا. ولتحقيق ذلك، تم بناء عامل النسخ الاصطناعي (ATF) الذي يتم فيه دمج منشط النسخ الفيروسي VP16 لمستقبلات هرمون الاستروجين وأربعة أصابع زن DNA ربط المجال (DBD). عندما بيتا استراديول (الإستروجين) موجودة، يمكن للATF دخول النواة والحث على النسخ osTIR عن طريق ربط لمروجها (Z4EVpr)13،12.

التعبير osTIR عادة ما تكون قابلة للكشف عن حوالي 20 دقيقة بعد إضافة β-استراديول12. ومع ذلك، فإن المدة المثلى للتعبير osTIR لتحقيق استنفاد فعال للبروتين الموسومة مع أوكسين، مع تجنب استنفاد قبل auxin إضافة، يحتاج إلى تحديد تجريبي لكل بروتين المستهدفة. ويمكن تقدير الوقت التقريبي لهذا الحضانة قبل من قيم الوفرة في قاعدة بيانات الجينوم Saccharomyces (SGD https://www.yeastgenome.org/). كما هو الحال في الشكل 1، فإن البروتين الوفير، Dcp1 (2880 إلى 4189 جزيئات / خلية)، يتطلب 40 دقيقة من الحضانة قبل مع β-estradiol، مع عدم وجود استنفاد أوكسين مستقلة لوحظ. البروتين أقل وفرة بكثير، Prp2 (172 إلى 211 جزيئات / خلية)، ينضب بقوة بعد 20 دقيقة فقط من الحضانة قبل. من المستحسن اختبار وقتين إضافيين قبل الحضانة، 10 إلى 20 دقيقة قبل أو بعد هذا الوقت المقدر الأولي (20 دقيقة هو الحد الأدنى من الوقت الموصى به). الوقت الأمثل قبل الحضانة هو الوقت الذي البروتين المستهدف لم يستنفد قبل إضافة أوكسين وبمجرد إضافة أوكسين يتم قبول استنفاد أو مستويات البروتين تقترب من الحد الأدنى الممكن. لذلك، من الشكل 1b، لPrp22 مع 30 دقيقة من ما قبل الحضانة، ومستويات لم تنخفض كثيرا 10 دقيقة بعد auxin إضافة. مقارنة هذا مع 40 دقيقة من الحضانة و 15 دقيقة مع IAA، حيث لا يوجد استنفاد إضافي يذكر، لا فائدة في احتضان مع أوكسين أطول من 10 دقيقة أو قبل الحضانة لفترة أطول من 30 دقيقة، لا سيما أن هناك أدلة على عدم أوكسين استنفاد التابعة في 40 دقيقة. لDcp1 مع 40 دقيقة من ما قبل الحضانة (النقطة الأخيرة التي مستوى البروتين هو ما يقرب من 100٪ قبل auxin إضافة)، 15 إلى 20 دقيقة من استنفاد مع أوكسين هو مقبول. من المستحسن الحفاظ على وقت استنفاد قصيرة قدر الإمكان للحد من الآثار الثانوية على استقلاب الخلايا14.

توضح هذه المقالة كيفية استخدام نظام بيتا-است AID عن طريق تحسين توقيت حضانة بيتا استراديول للتعبير osTIR لتحقيق استنفاد البروتين المستهدف السريع على إضافة IAA دون استنفاد قبل إضافة أوكسين.

Protocol

ملاحظة: انظر الشكل 2 للحصول على ملخص رسومي.

1. إعداد سلالة

  1. وباستخدام سلالة ura3،أدخل نظام المساعدات الصحية بيتا (أي الجينات التي ترمز إلى عامل النسخ المستجيب بيتا استراديول (ATF) وOSTIR) وAID* وضع علامة على البروتين المستهدف (انظر الشكل 3 والجدول 1 للاطلاع على ملخص للإجراء).
    1. تحويل15 إما pZTRK (G418 علامة المقاومة) أو pZTRL(LEU2 علامة) بلازميد (متاح من مركز الخميرة للموارد الوراثية) في سلالة الخميرة ura3 أو استخدام plasmid كقالب لإنتاج المنتج PCR للجينوين التكامل.
    2. PCR تضخيم ATF (ملحوظ Z4EVATF على خريطة بلازميد) وosTIR باستخدام بوليميراز عالية الدقة من أي من بلازميدس pZTRK أو pZTRL. استخدام التمهيديات مع 50 إلى 60 قاعدة 3 'ملحقات مع الهومولوجيا إلى المنطقة الجينية، لتحقيق التكامل المباشر عن طريق إعادة تركيب متجانسة16. وللاطلاع على التكامل الجيني للعنصرين إما بشكل منفصل أو معاً، انظر الجدول 1 للاطلاع على المواد التمهيدية والشروط.
      ملاحظة: السلالة pZ4EV-NTR1 لديها مكونات متكاملة بالفعل في الجينوم (المتاحة من مركز الخميرة للموارد الوراثية، اليابان).
    3. تأكد من أن البروتين المستهدف هو AID* الموسومة باستخدام إجراء Longtine17 (انظر الشكل 3ب والجدول 1).
    4. إجراء تحليل النمو على سلالة دون β-استراديول وIAA الحاضر لتحديد ما إذا كانت علامة AID * يؤثر على النمو والتنبؤ بمعدل النمو للاستخدام في الخطوة 1.5.

2- الإجراءات العامة للاستنفاد

  1. حساب مقدار الثقافة المطلوبة لكافة العينات التي سيتم جمعها؛ على سبيل المثال، 10 مل من الثقافة في OD600 من 0.8 يكفي للبروتين، الحمض النووي الريبي واستخراج الحمض النووي لعينة واحدة، لذلك لمدة 6 عينات، هناك حاجة على الأقل 60 مل من الثقافة.
  2. من ثقافة بين عشية وضحاها، وإعداد ثقافة جديدة كافية في OD600 0.1 إلى 0.2 وترك لتنمو في 30 درجة مئوية. يوصى بوسيط غني مثل YPDA، على الرغم من أنه يمكن استخدام ظروف نمو أخرى:
    الخميرة استخراج 10 غ
    بيبتون 20 غ
    الجلوكوز 20 غ
    كبريتات الأينين 40 ملغ
    H2O إلى 1 لام

    ملاحظة: تعقيم الأوتوكلاف أو فلتر؛ ويفضل تعقيم مرشح كما الببتيد / مجمعات السكر التي تنتجها الأوتوكلاف يعجل في الميثانول المستخدمة في جمع العينات.
  3. استعد واتسلم العينات
    1. وضع 30 إلى 50٪ من حجم العينة المقصود من الميثانول في أنبوب. على سبيل المثال، إذا كان لا بد من أخذ عينة 10 مل، وضع 5 مل من الميثانول في أنبوب الصقر 15 مل وإغلاق الأنبوب بإحكام. مرة واحدة مغلقة، وتسمية الأنبوب ووضعها على الجليد الجاف أو في -80 درجة مئوية للبرد.
      تحذير: الاستغناء عن الميثانول في غطاء الدخان.
    2. تسمية أنابيب 1.5 مل لتخزين على المدى الطويل من العينات ووضعها في الجليد لتبرد.
    3. بارد بما فيه الكفاية H2O (على الأقل 1 مل لكل عينة) على الجليد.
  4. توقع نمو الثقافة. الهدف OD لجمع العينات هو ما يقرب من 0.7 إلى 0.8، ولكن خطوة ما قبل الحضانة (الحضانة مع β-estradiol للحث على osTIR)، يحتاج إلى أن تبدأ في وقت سابق بحيث الثقافة سوف تصل إلى OD الحق تقريبا بحلول الوقت العينات جمع.
    ملاحظة: من المستحسن إجراء منحنى نمو في الظروف التي سيتم استخدامها في التجربة بحيث يمكن تقدير هذا OD بدء.
  5. مرة واحدة تم التوصل إلى OD الهدف لبدء الحضانة قبل، واتخاذ عينة (عادة 10 مل)، في أنبوب أعدت مسبقا تحتوي على الميثانول الباردة. عكس لفترة وجيزة لخلط ووضعها مرة أخرى في الجليد الجاف.
    ملاحظة: يمكن نقل العينة إلى الجليد المياه بعد حوالي 5 دقائق، إذا كانت مريحة للقيام بذلك.
  6. على الفور إضافة β-استراديول، 1 ميكرولتر / مل من الثقافة (التركيز النهائي من 10 درجة مئوية)؛ يكون بيتا-استراديول قبل قياسها في ماصة جاهزة للاستخدام من أجل تقليل الوقت الذي يستغرقه بين جمع العينة وإضافة β-estradiol. مزيج بسرعة من خلال دوامة بقوة.
  7. الاستمرار في تنمية الثقافة كما كان من قبل (الخطوة 2.2)، والحضانة (وهذا هو "مرحلة ما قبل الحضانة" خطوة) مع β-استراديول للوقت الأمثل (لتحديد الوقت الأمثل قبل الحضانة انظر الشكل 1).
  8. الاستعداد لإضافة IAA (أوكسين). تناول حجم IAA اللازمة للخطوة 2.10 (أي 0.5 ميكرولتر من IAA لكل مل من الثقافة). وهذا يجعل الخطوة 2.20 أسرع.
  9. جمع عينة كخطوة 2.5.
  10. إضافة IAA 0.5 درجة مئوية/مل من الثقافة على الفور إلى تركيز نهائي قدره 750 درجة مئوية على النحو المعد في الخطوة 2.8. مزيج بسرعة من خلال دوامة بقوة.
  11. جمع العينات، والخطوة 2.5، وفقا للتصميم التجريبي الخاص بك. إما عينة واحدة، في الوقت الذي من المتوقع أن البروتين سوف تستنفد بشكل موثوق، أو عينات متعددة في مسار زمني من استنفاد. على سبيل المثال، فترات 5 دقائق مريحة للتوقيت وتوفر مجموعة من مستويات البروتين. استراتيجية التحسين، كما هو مبين في الشكل1، سوف تعطي مؤشرا على الأوقات المناسبة.
  12. معالجة العينات.
    1. ضع العينات على الجليد، إذا لم يتم ذلك بالفعل. التأكد من أن أيا من العينات قد جمدت؛ إذا كان لديهم، دافئة بلطف في اليد، عكس باستمرار حتى درجة الحرارة لا ترتفع محليا.
      ملاحظة: ويتم ذلك على أفضل وجه في اليد كما يمكن تقييم درجة حرارة العينة، فإنه ينبغي أن يشعر دائما الباردة. ضعها على الجليد. هذه ليست نقطة توقف مؤقت - مرة واحدة كل العينات هي السوائل، والمضي قدما إلى الخطوة التالية.
    2. وبمجرد جمع جميع العينات ولم تعد مجمدة، تدور في 3500 × ز لمدة 2 دقيقة (في 4 درجة مئوية إذا كان ذلك ممكنا).
    3. صب قبالة الميثانول / مزيج المتوسطة ووضعها مرة أخرى على الجليد. لا تقلق إذا لم تتم إزالة كل السائل.
    4. إعادة تعليق بيليه الخلية في 1 مل من الجليد البارد H2O (من الخطوة 2.3.3) ونقل إلى أنبوب وصفت 1.5 مل (أعدت في الخطوة 2.3.2) على الجليد.
    5. تدور لفترة وجيزة (على سبيل المثال، 10 ق الوقت الإجمالي) في > 15،000 × ز لإعادة بيليه الخلايا، ووضع مرة أخرى على الجليد وإزالة السائل.
    6. إزالة H2O عن طريق الطموح. يمكن تخزين الكريات الخلية في -20 درجة مئوية، أو -80 درجة مئوية للتخزين على المدى الطويل.
  13. تحقق من المستوى الذي تم استنفاد البروتين من قبل تحليل وصمة عار الغربية18.
    ملاحظة: يمكن استخراج البروتين الكافي19 و /أو حمض نووي من بيليه خلية واحدة لمعظم الأغراض، على الرغم من أن الأنواع النادرة RNA قد تتطلب المزيد من حجم العينة.

Representative Results

وترد أمثلة تمثيلية للاستنفاد في الشكل 1. وكانت التجارب الثلاث المعروضة في هذا الرقم تجارب التحسين لاستنفاد البروتينات Prp2، Prp22 وDcp1. وفرة منخفضة، Spliceosomal Prp2 وPrp22 البروتينات على حد سواء استنفدت إلى أقل من 20٪ بعد 40 دقيقة قبل الحضانة مع β-استراديول تليها 15 دقيقة مع أوكسين. أطول أوقات ما قبل الحضانة يؤدي إلى استنفاد أسرع ولكن أيضا تظهر استنفاد البروتين غير مرغوب فيه قبل auxin إضافة. في المقابل، تم استنفاد Dcp1 أكثر وفرة فقط إلى ما يقرب من 30٪ مع نفس المعاملة، ولكن 60 دقيقة من الحضانة قبل أدى إلى استنفاد إلى 13٪ مع نفس العلاج أوكسين، على حساب استنفاد قبل إضافة أوكسين. فمن الممكن أن 50 دقيقة من الحضانة قبل مع β-استراديول و 15 دقيقة مع أوكسين قد حققت نتائج مماثلة في نقطة زمنية أقصر، وهكذا كان يمكن أن يكون أكثر الأمثل.

Figure 1
الشكل 1: يمكن ضبط معدل الاستنفاد عن طريق تعديل مدة الحضانة السابقة للحضانة. وصمة عار الغربية18 من البروتينات المستهدفة: (أ وب) Prp22-AID *-6FLAG، (ج و د)Prp2-AID * -6FLAG، و (ه و) Dcp1-AID * -6HA، من الثقافات التي سبق احتضانها مع β-estradiol (β-est) لمدة 20، 30، 40، أو 60 دقيقة قبل auxin إضافة12. تم تحميل كميات متساوية من البروتين الكلي في كل حارة. يتم الكشف عن Pgk1 كتحكم تحميل مرئي، باستثناء اللوحة e، حيث يتم ترحيل Pgk1 وDcp1. يظهر القياس الكمي لنطاقات البروتين في الألواح aوc وe في الألواح بود و و على التوالي. وكإجراء لمعدل الاستنفاد، تم حساب المنحدر (m) للقسم الخطي (من 100% إلى 30% من القيم الأولية) لكل منحنى. الوقت الأمثل قبل الحضانة هو الوقت الذي لا تزال فيه مستويات البروتين قريبة من المستويات غير المستحثة (100٪) ومعدل الاستنفاد اللاحق سريع. لDcp1(و)، 60 دقيقة من الحضانة قبل طويلة جدا، كما بدأ البروتين في التحلل في غياب أوكسين، في حين أن 20 دقيقة قصيرة جدا، كما البروتين لا تستنفد بشكل ملحوظ في هذا بالطبع الوقت. بعد 40 دقيقة قبل الحضانة، يمكن استخدام 15 دقيقة مع أوكسين كما البروتين هو ما يقرب من 70٪ استنفدت، وعلى الرغم من أن 20 دقيقة من شأنه أن يؤدي إلى مزيد من الاستنفاد، فإنه يمكن أن يؤدي أيضا إلى آثار ثانوية. تمثل أشرطة الخطأ الانحراف المعياري لاثنين من النسخ المتماثل البيولوجية. لكل تجربة، يتم عرض وصمة عار ممثل واحد. وهذا الرقم مستمد من المنشور السابق9. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: ملخص رسومي. إضافة β-استراديول إلى ثقافة كافية تنمو في وسط غني وفي درجة الحرارة المطلوبة من أجل البدء في الحضانة قبل. مواصلة النمو لوقت ما قبل الحضانة المطلوبة قبل إضافة IAA (أوكسين) لبدء استنفاد. تعتمد أوقات ما قبل الحضانة والاستنفاد على البروتين الذي سيتم استنفاده، ولكن ما قبل الحضانة غالباً ما تكون في حدود 20-60 دقيقة، وعادة ما يكون وقت الاستنفاد في حدود 10 إلى 20 دقيقة. ز استنفاد. يتم إصلاح هذه العينات بسرعة في الميثانول الباردة قبل التكوير والتخزين. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: توليد السلالة لنظام B-est. (أ) لتوليد سلالة الخميرة مع نظام AID * ، إما pZTRL (LEU2) أو المقاومة pZTRK (كانامايسين (G418) ، يجب إدخال بلازميد في سلالة أو ، بدلا من ذلك ، يمكن إدراج ATF وosTIR في الجينوم عن طريق إعادة تركيب متجانسة لجزء تم إنشاؤه بواسطة PCR من مواد أولية ثلاثية (انظر الشكل 3ب والجدول 1). (ب) يتم وضع العلامات C-الطرفية للبروتين المستهدف عن طريق تضخيم PCR من المنطقة المناسبة من pURA3-AID *-6FLAG (pURA3_AID *-6HA يختلف فقط في العلامة ويمكن التعامل معها بنفس الطريقة بالضبط)، وذلك باستخدام المواد التمهيدية لونغتين S3-F و S2-R مع ملحقات 3 'متجانسة إلى نهاية 3 ' من البروتين المستهدف. يجب أن يتضمن التمديد التمهيدي الأمامي آخر codon الأحماض الأمينية في الإطار مع بداية علامة AID * ويجب أن لا تشمل codon وقف. وينبغي أن يكون التمديد التمهيدي العكسي إلى منطقة في اتجاه المصب من منطقة الترميز. بمجرد إدراجها في الجينوم، يمكن اختيار الخلايا التي فقدت علامة URA3 (عن طريق إعادة التركيب المتجانس بين المناطق المتطابقة الموجودة في كلا طرفي العلامة) عن طريق النمو مع 5-FOA، التي تختار خلايا URA3 المضادة. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

أ. التسلسلات التمهيدية
الهدف موقع التمهيدي اسم تسلسل Tm (درجة مئوية)
pZTRL 516 و محمد الدوسري <-منطقة الهومولوجيا->GCGACAGCATCACCGACTTCG 61.23
7897 R محمد الدوسري CGCCGCCTCTACCTTGCAGA<-منطقة الهومولوجيا (RC)-> 61.30
في هذا الـ4. 9154 و محمد الدوسري <-منطقة الهومولوجيا->ACGTTGAGCCATATATATGTGTCC 59.40
5897 R محمد الدوسري CGCCGCCTCTACCTTGCAGA<-منطقة الهومولوجيا (RC)-> 61.30
pURA3-AID * -6FLAG أو pURA3_AID * -6HA و S3-F <-منطقة الهومولوجيا->CGTACGCTGCAGGTCGAC 59.21
R S2-R ATCGATGAATTCCTCG<-منطقة الهومولوجيا (RC)-> 52.76 دولار أمريكي
pZRTL/K هو لتضخيم بيتا-est نظام AID
pURA3-AID*-6FLAG/6HA لتضخيم بطاقة AID* وepitope لوضع علامة على البروتين المستهدف (إجراء لونتين)
<-منطقة الهومولوجيا-> المنطقة متجانسة إلى المناطق المحيطة حيث سيتم إدخال النظام. وكلما طالأمد نجاح هذه المنطقة؛ ينصح 50 - 100 قواعد.
<-منطقة الهومولوجيا (RC)-> المنطقة متجانسة إلى المناطق المحيطة حيث سيتم إدخال النظام، وتذكر أن تستخدم تكملة عكسية. وكما هو الحال أعلاه، كلما طالت هذه المنطقة كلما كان ذلك أفضل.
Tm (درجة مئوية) Tm باستخدام الأسلوب %GC مع 50 مل NaCl
ب. PCR ميكس
مكون حجم (ميكرولتر)
قالب <10
[نب] [فوسيون] [هف] مخزن (5x)* 100
التمهيدي إلى الأمام 100 درجة مئوية 2.5
عكس التمهيدي 100 درجة مئوية 2.5
10 مليون متر مربع لكل منها 10 سنوات
H2O إلى 500
* يمكن أيضا أن تستخدم NEB Phusion GC العازلة (5X) ولكن لا يفضل
جعل هذا المزيج، وتقسيمها إلى 10 أنابيب من 50 ميكرولتر مزيج كل وأداء PCR كما الجدول 1 ج.
تحقق من PCR عملت عن طريق تشغيل على هلام أغاروز
الجمع بين جميع ردود الفعل الناجحة في أنبوب واحد والإيثانول يعجل
تحويل الخميرة مع جميع المواد التي تنتجها PCR
ج. شروط PCR
خطوه درجة الحرارة (درجة مئوية) الوقت
التناطور الأولي 98 30 s
25-35 دورات التشوه 98 10 s
آنال ٤٥-٦٠ 20 s
ملحق 72 30 ثانية/كيلو بايت
التمديد النهائي 72 10 دقائق
عقد 8
الصلب في 45 درجة مئوية لمجموعة التمهيدي لونتين (S3-F و S2-R) و 60 درجة مئوية للالتمهيديات pZTRL / K
تمديد لمدة 3 دقائق لPCR لونتين و 3 دقائق لpZTRL / K

الجدول 1: التسلسلات التمهيدية، ومزيج PCR، وظروف PCR.

Discussion

ويمكن أن يؤدي البروتوكول الأمثل إلى استنفاد سريع وفعال للبروتين المستهدف. ومن المهم تحديد الوقت التقريبي قبل الحضانة مع بيتا-استراديول، لأن هذا يزيد من قابلية الاستنفاد للاستنفاد، ولكن يمكن التسامح مع الاختلافات الصغيرة في وقت ما قبل الحضانة. من ناحية أخرى، يجب توخي الحذر مع توقيت بعد auxin إضافة، كما ينخفض مستوى البروتين بسرعة كبيرة.

ومن مزايا هذا النهج أن الاستنفاد المضبوط يمكن تحقيقه عن طريق مجموعات مختلفة من وقت ما قبل الحضانة مع وقت الحضانة بيتا-استراديول وIAA. على سبيل المثال، إذا رغبت في ذلك، يمكن استنفاد البروتين المستهدف ببطء أكبر عن طريق تقليل وقت ما قبل الحضانة.

ويوفر نظام المعونة المتكاملة مزايا معينة على النظم التي يتم فيها التعبير عن نظام "أوستير". على سبيل المثال، إذا كان البروتين المستهدف ضروريًا للبقاء، فإن التعبير المنظم لـ osTIR يمكن أن يتجنب الاستنفاد المبكر للبروتين المستهدف. وعلاوة على ذلك، يمكن ضبط التعبير عن هذا التعبير ليتناسب مع وفرة البروتين المستهدف وقابليته للتحلل، ويمكن أن يكون الاستنفاد إما سريعاً أو بطيئاً. تأثيري جزيء صغير اثنين، β-استراديول وأوكسين، لا تعكر قكانة التمثيل الغذائي في ظل الظروف المستخدمة هنا، على عكس رابامايسين، وتستخدم في نظام مرساة بعيدا1.

وتجدر الإشارة إلى أن وضع علامات على بعض البروتينات يعطل وظيفتها، وهي مشكلة مع أي نظام استنفاد مستهدف. في هذه الحالة، قد تعمل علامة N-terminal عندما لا تعمل علامة المحطة الطرفية C. أيضا، لن يتم استنفاد جميع البروتينات بكفاءة. على سبيل المثال، قد يكون لا يمكن الوصول إلى البروتين OSTIR علامة AID على البروتين المستهدف. لذلك، بعد وضع العلامات AID، يجب اختبار كل بروتين الهدف لأي تأثير للعلامة على النمو، وتحديد ما إذا كان استنفاد فعالة، قبل أن يتم تحسين توقيت بيتا استراديول قبل الحضانة والعلاج أوكسين.

نظام AID* هذا بسيط جداً ومتوافق مع أي إجراء تجريبي لاحق لا ينطوي على مزيد من النمو، مثل تحليل البروتين أو الحمض النووي أو الحمض النووي الريبي أو الفحص المجهري. وبالإضافة إلى ذلك، يعمل النظام بشكل جيد عندما جنبا إلى جنب مع thiolabelling لتنقية RNA20الوليدة .

يوفر هذا النظام وسيلة سريعة ومحددة وقابلة للاستنساخ لاستنفاد البروتين دون التأثير على عملية التمثيل الغذائي لخلية الخميرة.

Disclosures

وليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

وبفضل جين ريد على بدء هذا البرنامج، باربرا تيرلو من أجل التنمية، وحيد أصلانزاده لـ "أورا لوبير" وسوزانا دي لوكاس للعديد من المناقشات المفيدة. وقد تم دعم هذا العمل بمنحة دراسية إلى المنظمة العالمية للشغل من المجلس الوطني للعلوم والتكنولوجيا، المكسيك (CONACYT) وكلية العلوم البيولوجية بجامعة إدنبرة، وهي طالبة دكتوراه في ويلكوم إلى المعهد [105256] وبتمويل من ويلكوم [104648] إلى التسول JD . ويدعم العمل في مركز ويلكوم لبيولوجيا الخلايا من قبل ويلكوم التمويل الأساسي [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics