Тюнинг деградации для достижения конкретных и эффективных истощения белка

Immunology and Infection
 

Summary

Здесь мы представляем протокол для эффективного и конкретного истощения белка, интересующегося дрожжами Saccharomyces cerevisiae с использованием системы q-est AID.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Рецептор связывания auxin завода, TIR1, узнает протеины содержа специфически auxin-индуцируемого дегрюня (AID) motif в присутствии auxin, пристреливая их для деградации. Эта система используется во многих не-растение эукариоты, так что целевой белок, помечены с мотивом AID, деградирует на auxin того. Уровень выражения TIR1 имеет решающее значение; чрезмерное выражение приводит к деградации AID помечены белка даже в отсутствие auxin, в то время как низкое выражение приводит к медленному истощению. Была создана система AID, индуируемая с помощью AID, с выражением TIR1 под контролем индуцируемого промоутера, вызываемого в результате s-estradiol. Уровень TIR1 настраивается, изменяя время инкубации с помощью q-эстрадиола до добавления auxin. Этот протокол описывает, как быстро истощать целевой белок с помощью системы AID. Соответствующее время инкубации на эстрадиоле зависит от обилия белка-мишени. Таким образом, эффективное истощение зависит от оптимального времени, которое также сводит к минимуму аксин-независимое истощение.

Introduction

Условные мутации, такие как чувствительные к температуре мутанты, являются мощным инструментом для изучения основных белков, позволяя рост клеток при вседозволенном состоянии, но вызывая потерю функции при неразрешительных условиях. Тем не менее, метаболизм клеток может быть серьезно возмущен изменением условий роста, необходимых для индуцирования дефекта, а также может создать вне цели эффекты. Было разработано несколько методов, при которых интересуемый белок условно секвестрируется1 или его экспрессия контролируется 2,3 путем добавления небольшой молекулы. Этот протокол использует auxin и auxin-индуцируемую систему degron (AID) для эффективного истощения целевого белка.

Система AID имеет свое начало в растениях, где auxin (в этом протоколе indole-3-ацетической кислоты (IAA) используется), стимулирует взаимодействие Aux / IAA белка с TIR1, член SCF U3 убиквитин лигазе комплекса4. Комплексное взаимодействие SCF вызывает полиубичицинацию белков семейства Aux/IAA,что приводит к их деградации протеасомом 5,6.

Эта система была ранее адаптирована для использования в дрожжах Saccharomyces cerevisiae7,8, выражая белок TIR1 от Oriza sativa (osTIR) в дрожжевых клетках, где он способен взаимодействовать с эндогенными дрожжами Комплекс СКФ. Белок интерес был помечен с мотивом из белка Aux/IAA IAA17, чтобы нацелить его на деградацию. Функциональные усечения IAA17 были разработаны позже, такие как AID8,9,10, содержащий 43 аминокислоты auxin чувствительных мотив от Arabidopsis thaliana IAA17, наряду с эпитопом тег, чтобы включить Обнаружения.

Система первоначально адаптированы для использования в подающих надежды дрожжей7,8 выразил osTIR1 белка из дрожжей GAL промоутер. Выражение требует перехода к среде роста с галактозой в качестве единственного источника углерода, что, к сожалению, приводит к диоксовский сдвиг с широкими изменениями клеточного метаболизма11. С другой стороны, было сообщено, что составное выражение TIR1 может привести к деградации целевого белка при отсутствии вспомогательного/IAA12, если уровень экспрессии высок, в то время как низкое выражение TIR1 вызывает неэффективное истощение. Улучшенная система AID под названием «з-est AID» была разработана, в которой osTIR находится под контролем индуцируемого промотора, который настраивается на целевой белок, с минимальным влиянием на клеточный метаболизм. Для достижения этой цели был построен искусственный транскрипционный фактор (ATF), в котором активатор вирусной транскрипции VP16 сливается с рецептором эстрогена и четырех пальцев днк связывающей области (DBD). При поступлении в систему (эстроген) АТФ может войти в ядро и вызвать транскрипцию osTIR, связавшись с его промотором (No4EVpr)13,12.

osTIR выражение, как правило, обнаруживается около 20 мин после добавления з-эстрадиол12. Тем не менее, оптимальная продолжительность экспрессии osTIR для достижения эффективного истощения помеченного белка с помощью auxin, избегая при этом истощения до того, что необходимо эмпирически определить для каждого целевого белка. Приблизительное время для этой предварительной инкубации можно оценить по значениям изобилия в базе данных генома Сахаромицеса (SGD https://www.yeastgenome.org/). Как видно на рисунке 1, обильный белок, Dcp1 (2880 до 4189 молекул / клеток), требует 40 минут предварительной инкубации с й-эстрадиол, без каких-либо auxin-независимого истощения наблюдается. Гораздо менее обильный белок, Prp2 (172 до 211 молекул/ клеток), сильно истощен после всего лишь 20 минут предварительного инкубации. Рекомендуется проверить два дополнительных времени до инкубации, от 10 до 20 минут до или после этого первоначального расчетного времени (20 мин является минимальным временем, которое рекомендуется). Оптимальным временем предварительной инкубации является время, в которое целевой белок не истощается перед добавлением auxin и как только auxin добавляется истощение приемлемо или уровни белка приближаются к минимально возможному. Таким образом, с рисунка 1b, для Prp22 с 30 мин до инкубации, уровни не снизились много 10 минут после auxin дополнение. Сравнивая это с 40 мин до инкубации и 15 мин с IAA, где мало дополнительного истощения, нет никакой пользы в инкубации с auxin дольше, чем 10 мин или предварительного инкубации дольше, чем 30 мин, тем более, что есть доказательства не-оксин зависимое истощение на 40 мин. Для Dcp1 с 40 минутами pre-инкубации (последняя точка на которой уровень протеина приблизительно 100% перед добавлением auxin), 15 до 20 min истощения с auxin приемлемо. Рекомендуется держать время истощения как можно короче, чтобы уменьшить вторичное воздействие на метаболизм клеток14.

В этой статье показано, как использовать систему AID, оптимизируя время инкубации з-эстрадиола для экспрессии osTIR для достижения быстрого истощения целевого белка при добавлении IAA без истощения перед добавлением auxin.

Protocol

ПРИМЕЧАНИЕ: См Рисунок 2 для графического резюме.

1. Подготовка штамма

  1. Используя ura3-strain, введите систему q-est AID (т.е. гены, кодирующие фактор транскрипции (ATF) и osTIR, и АИДЗ пометят целевой белок (см. рисунок 3 и таблицу 1 для резюме процедуры).
    1. Преобразование15 либо p'TRK (G418 маркер сопротивления) или p'TRL (LEU2 маркер) плазмид (доступен из Дрожжи генетический ресурсный центр) в ura3- дрожжи штамма или использовать плазмида в качестве шаблона для производства пЦР продукт для геномных Интеграции.
    2. ПЦР усиливают АТФ (отмеченный на плазмидной карте 4EVATF) и osTIR с помощью полимеразы высокой точности от любой из плазмидов p'TRK или p'TRL. Используйте праймеры с 50 до 60 базовых 3'с гомологией в геномный регион, чтобы направить интеграцию гомологичным рекомбинацией16. Для геномной интеграции двух компонентов отдельно или вместе см. таблицу 1 для грунтовок и условий.
      ПРИМЕЧАНИЕ: Штамм p'4EV-NTR1 имеет компоненты, уже интегрированные в геном (доступен в Дрожжевом генетическом ресурсном центре, Япония).
    3. Убедитесь, что целевой белок является AID, помеченным с помощью процедуры Longtine17 (см. Рисунок 3b и таблицу1).
    4. Провести анализ роста штамма без й-эстрадиола и IAA настоящее время, чтобы определить, если тег AID' влияет на рост и предсказать темпы роста для использования на шаг 1.5.

2. Общая процедура истощения

  1. Рассчитайте, сколько культуры требуется для сбора всех образцов; например, 10 мл культуры при OD600 из 0,8 достаточно для извлечения белка, РНК и ДНК для одного образца, поэтому для 6 образцов необходимо не менее 60 мл культуры.
  2. Из ночной культуры, создать достаточно новой культуры на OD600 до 0,2 и оставить расти на 30 градусов по Цельсию. Богатая среда, такая как YPDA, рекомендуется, хотя другие условия роста могут быть использованы:
    Дрожжевой экстракт 10 г
    Пептон 20 г
    Глюкозы 20 г
    Сульфат аденина 40 мг
    H2O к 1 л

    ПРИМЕЧАНИЕ: Автоклав или фильтр стерилизовать; Предпочтительной является пептидно-сахарная комплексы, производимые с помощью ускорителя метанола в метаноле, используемом в сборе проб.
  3. Приготовьтесь к получению образцов.
    1. Положите от 30 до 50% от предполагаемого объема образца метанола в трубку. Например, если образец 10 мл должен быть взят, положить 5 мл метанола в 15 мл сокол трубки и закрыть трубку плотно. После закрытия, этикетку трубки и положить на сухой лед или при -80 градусов по Цельсию, чтобы охладить.
      ПРЕДЕКТО: Распределите метанол в дымовом капюшоне.
    2. Этикетка 1,5 мл труб для длительного хранения образцов и место во льду для охлаждения.
    3. Достаточно охладить H2O (не менее 1 мл на образец) на льду.
  4. Предвидеть рост культуры. Целевой ОД для сбора образцов составляет примерно 0,7 -0,8, но прединкубационный этап (инкубация с помощью з-эстрадиола для индуцирования osTIR) должен быть начат раньше, чтобы культура достигла примерно нужного OD к тому времени, когда образцы Собранные.
    ПРИМЕЧАНИЕ: Целесообразно выполнить кривую роста в условиях, которые будут использоваться в эксперименте, так что это начиная ОД может быть оценена.
  5. После того, как целевой ОД для начала предварительной инкубации был достигнут, возьмите образец (обычно 10 мл) в заранее подготовленную трубку, содержащую холодный метанол. Переверните кратко смешать и поместить обратно в сухой лед.
    ПРИМЕЧАНИЕ: Образец может быть перемещен в водяной лед примерно через 5 минут, если это удобно.
  6. Немедленно добавляйте к-эстрадиол, 1 л/мл культуры (окончательная концентрация 10 мкм); предварительно измеренный в пипетке, готовой к использованию, чтобы сократить время, задейма которого приходится на сбор образца и добавление эстрадиола. Быстро смешивать, закрученного энергично.
  7. Продолжайте расти культуры, как и раньше (шаг 2.2), инкубировать (это "прединкубационный" шаг) с - эстрадиол для оптимального времени (для определения оптимального времени до инкубации см. Рисунок 1).
  8. Приготовьтесь добавить IAA (авксин). Возьмите объем IAA, необходимый для шага 2.10 (т.е. 0,5 л IAA на мл культуры). Это делает шаг 2.20 быстрее.
  9. Соберите образец в виде шага 2.5.
  10. Немедленно добавьте IAA 0,5 л/мл культуры к окончательной концентрации 750 мкм, как подготовлено в шаге 2.8. Быстро смешивать, закрученного энергично.
  11. Собирайте образцы, как шаг 2.5, в соответствии с вашей экспериментальной конструкции. Либо один образец, в то время, когда ожидается, что белок будет надежно истощены, или несколько образцов в течение времени истощения. Например, 5 мин интервалы удобны для синхронизации и обеспечивают диапазон уровней белка. Стратегия оптимизации, как показано на рисунке 1, даст указание на подходящее время.
  12. Обработайте образцы.
    1. Поместите образцы на лед, если не сделали уже. Убедитесь, что ни один из образцов не был заморожен; если они имеют, нежно теплый в руке, инвертируя постоянн поэтому температура не поднимает местно.
      ПРИМЕЧАНИЕ: Это лучше всего сделать в руке, так как температура образца может быть оценена, он всегда должен чувствовать себя холодно. Место на льду. Это не точка паузы - как только все образцы будут жидкости, перейти к следующему шагу.
    2. После того, как все образцы были собраны и больше не заморожены, спина на 3500 х г в течение 2 мин (при 4 градусах по Цельсию, если это возможно).
    3. Слейте метанол/среднюю смесь и поместите обратно на лед; не волнуйтесь, если не все жидкости были удалены.
    4. Приостановите действие клеточной гранулы в 1 мл ледяного холода H2O (от шага 2.3.3) и перенесите на маркированную трубку 1,5 мл (подготовленную в шаге 2.3.2) на льду.
    5. Спин кратко (например, 10 с общей время) на йgt;15,000 х г, чтобы повторно гранулы клетки, место обратно на лед и удалить жидкость.
    6. Удалите H2O по аспирации. Пеллеты клетки можно хранить на -20 c, или -80 C для долгосрочного хранения.
  13. Проверьте уровень, до которого белок был истощен западным анализом побелки18.
    ПРИМЕЧАНИЕ: Достаточное количество белка19 и/или нуклеиновой кислоты может быть извлечено из одноклеточных гранул для большинства целей, хотя редкие виды РНК могут потребовать большего объема образцов.

Representative Results

Репрезентативные примеры истощения отображаются на рисунке 1. Три эксперимента, представленные на этом рисунке, были экспериментами по оптимизации для истощения белков Prp2, Prp22 и Dcp1. Низкое изобилие, spliceosomal Prp2 и Prp22 белки оба истощены до менее чем 20% после 40 мин прединкубации с к-эстрадиол следуют 15 мин с ауцином. Более длительные сроки предварительной инкубации приводят к более быстрому истощению, но также показывают нежелательное истощение белка до добавления auxin. Для сравнения, более обильные Dcp1 был только истощены примерно до 30% с тем же лечением, но 60 мин до инкубации привело к истощению до 13% с той же лечения auxin, по цене истощения до auxin добавляется. Вполне возможно, что 50 мин предварительной инкубации с к-эстрадиол и 15 мин с авцином бы достигли аналогичных результатов в более короткий момент времени и поэтому были бы более оптимальными.

Figure 1
Рисунок 1: Скорость истощения может быть настроена путем модулирования продолжительности прединкубации. Западная поместье18 целевых белков:(a и b) Prp22-AID-6FLAG, (c и d)Prp2-AID-6FLAG, и (e и f)Dcp1-AID--6HA, от культур, предварительно инкубированных с помощью з-эстрадиола (з-эстрадиол) для 20, 30, 40, или 60 мин до auxin дополнение12. Равное количество всего белка было загружено в каждой полосе. Pgk1 обнаруживается как визуальный контроль загрузки, за исключением панели e, где Pgk1 и Dcp1 совместно мигрируют. Количественная оценка белковых полос в панелях a, c и e показана в панелях b, dи f, соответственно. В качестве показателя скорости истощения наклон (м) рассчитывался для линейной секции (от 100% до 30% от начальных значений) каждой кривой. Оптимальным временем предварительной инкубации является время, в течение которого уровень белка все еще близок к неиндуцированному уровню (100%) и последующая скорость истощения быстро. Для Dcp1(f), 60 мин предварительной инкубации слишком долго, так как белок начал деградировать в отсутствие auxin, в то время как 20 мин слишком короткий, так как белок не заметно истощается в этом времени курса. После 40 мин до инкубации, 15 мин с аксином может быть использован в качестве белка примерно на 70% истощены и, хотя 20 мин приведет к дальнейшему истощению, это также может привести к вторичным эффектам. Ошибки баров представляют собой стандартное отклонение двух биологических репликаций. Для каждого эксперимента отображается одна представительная подательная. Эта цифра вытекает из предыдущей публикации9. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Графическое резюме. Добавьте к достаточной культуре, растущей в богатой среде и при необходимой температуре, чтобы начать прединкубацию. Продолжить рост в течение необходимого времени до инкубации, прежде чем добавить IAA (авкс), чтобы начать истощение. Время предварительного инкубации и истощения зависит от белка, который будет истощаться, но предварительное инкубацию часто находится в диапазоне 20-60 мин, а время истощения, как правило, в порядке от 10 до 20 мин. Образцы 10 мл должны быть взяты в начале и конце предварительной инкубации и durin г истощения. Эти образцы быстро фиксируются в холодном метаноле перед гранулированием и хранением. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Процедить генерацию для системы B-est. () Для генерации штамма дрожжей с системой АМДЗ, либо p'TRL (LEU2) или рЗТРК (канамицин (G418) сопротивление), плазмида должна быть введена в штамм или, в качестве альтернативы, АТФ и osTIR могут быть введены в геном гомологичная рекомбинация фрагмента, генерируемого ПЦР из 3'end праймеров (см. Рисунок 3b и таблица 1). (b) C-терминал пометки целевого белка достигается путем pcR усиления соответствующего региона плазмид ыва3-АИД-6FLAG (pURA3-AID-6HA отличается только в теги и может рассматриваться точно так же), с помощью Longtine грунтовки S3-F и S2-R с 3'расширениями гомологичными до 3' конца целевого белка. Передний грунтовка расширение должно включать в себя последний аминокислотный кодон в кадре с началом тега AID и не должен включать стоп-кодон. Обратный удлинение грунта должно быть в регионе ниже по течению области кодирования. После вставки в геном, клетки, которые потеряли URA3 маркер (гомологичной рекомбинации между идентичными регионами, найденными на обоих концах маркера) могут быть выбраны роста с 5-FOA, что контр-выбирает URA3 клеток. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

a. Праймер Последовательности
Целевой Расположение Грунтовка Имя Последовательности ТМ (КК)
рЗТРЛ 516 г. F стр. Ф. Злт;-регион гомологии-зgt;GCGACAGCATCACCGACTTCGCGTCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCG 61,23
7897 год R РЗТР-Р CGCCGCCTACCTGCAGA;-регион гомологии (RC)--gt; 61.30 61.30
рЗТРК 9154 год F стрРК-Ф Злт;-регион гомологии -зgt;ACGTTGAGCCATTAGTCAATTTGCTTACC 59.40 Для того, чтобы
5897 г. R РЗТР-Р CGCCGCCTACCTGCAGA;-регион гомологии (RC)--gt; 61.30 61.30
pURA3-АИД-6FLAG или pURA3-AID-6HA F S3-F Злт;-регион гомологии-зgt;CGTACGCGCAGGTCGAC 59.21
R S2-R ATCGATGAATTCGAGCTCG-lt;-регион гомологии (RC)---gt; 52,76
рЗРТЛ/К является усиление системы AID
pURA3-АИД-6FLAG/6HA для усиления тега AID и эпитопа для пометки целевого белка (Лонтинская процедура)
Злт;-регион гомологии-яgt; Область гомологичная для фланговых областей, где система должна быть вставлена. Чем длиннее этот регион, тем больше вероятность того, что модификация будет успешной; Рекомендуется 50 - 100 баз.
Злт;-регион гомологии (RC)---gt; Регион гомологичным для фланговых областей, где система должна быть вставлена, не забудьте использовать обратный дополнение. Как указано выше, чем дольше этот регион, тем лучше.
ТМ (КК) Tm с использованием метода %GC с 50 mM NaCl
b. PCR Mix
Компонент Объем (КЛ)
Шаблон Злт;10
NEB Фузион HF буфер (5x) 100
Форвард Праймер 100 мкм 2,5
Обратный праймер 100 мкм 2,5
dNTPs 10 mM каждый 10 Лет
H2O до 500
Буфер NEB Phusion GC (5x) также может быть использован, но не является предпочтительным
Сделать эту смесь, разделить на 10 труб по 50 л перемешать каждый и выполнять ПЦР, как таблица 1 c.
Проверьте ПЦР работал, работает на гель агарозы
Объедините все успешные реакции в одну трубку и этанол осадок
Преобразуйте дрожжи со всем материалом, производимым ПЦР
c. Условия ПЦР
Шаг Температура (КК) Время
Первоначальная денатурация 98 лет 30 с
25-35 Циклов Денатурная 98 лет 10 с
Аннеал 45–60 20 с
Расширение 72 год 30 с/кб
Окончательное расширение 72 год 10 мин.
Держать 8
Аннеал при 45-c для набора грунтовки Lontine (S3-F и S2-R) и 60 градусов по Цельсию для праймеров p'TRL/K
Продлить на 3 минуты для Lontine PCR и 3 минуты для p'TRL/K

Таблица 1: Промюнсы, pcR-микс и условия ПЦР.

Discussion

Хорошо оптимизированный протокол может привести к быстрому и эффективному истощению целевого белка. Определение приблизительного времени до инкубации с помощью з-эстрадиола имеет важное значение, так как это увеличивает воспроизводимость истощения, но небольшие изменения в прединкубации времени можно мириться. С другой стороны, необходимо проявлять осторожность со сроками после того, как auxin addition, так как уровень белка снижается очень быстро.

Преимуществом такого подхода является то, что тюнингованое истощение может быть достигнуто путем различных комбинаций времени до инкубации с инкубированным временем К-эстрадиола и IAA. Например, при желании, целевой белок может быть более медленно истощены за счет сокращения времени до инкубации.

Система aid предлагает определенные преимущества по сравнению с системами, в которых osTIR является составно выраженной. Например, если целевой белок необходим для жизнеспособности, регулируемое выражение osTIR может избежать преждевременного истощения целевого белка. Кроме того, выражение osTIR может быть настроено в соответствии с обилием целевого белка и его восприимчивостью к деградации, и истощение может быть быстрым или медленным. Два небольших молекулных эффектора, з-эстрадиол и auxin, не возмущают метаболизм дрожжей в условиях, используемых здесь, в отличие от рапамицина, используемого в системе якоря-вне.

Следует отметить, что пометка некоторых белков нарушает их функцию, что является проблемой с любой целевой системы истощения. В этом случае тег N-терминала может работать, когда тег C-терминала не работает. Кроме того, не все белки будут истощаться эффективно; например, AID-тег на целевой белок может быть недоступен для белка osTIR. Таким образом, после AID-tagging, каждый целевой белок должен быть проверен на любое влияние метки на рост, и определить, является ли истощение эффективным, до времени до инкубации и лечения auxin.

Эта система АИДЗ очень проста и совместима с любой последующей экспериментальной процедурой, которая не предполагает дальнейшего роста, таких как белок, анализ ДНК или РНК или микроскопия. Кроме того, система хорошо работает в сочетании с тиомаркировкой для очищения зарождающейся РНК20.

Эта система обеспечивает быстрое, специфическое и воспроизводимое средство истощения белка, не влияя иначе на метаболизм дрожжевой клетки.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Благодаря Джейн Рид для начала этой программы, Барбара Terlouw для развития, Вахид Асланзаде для "ура петлер" конструкций и Сусана де Лукас для многих полезных дискуссий. Эта работа была поддержана стипендией для МГИМО от Consejo Nacional de Ciencia y Tecnologa, Мексика (CONACYT) и Эдинбургского университета школы биологических наук, Wellcome PhD студентства в IEM (105256) и Wellcome финансирования (104648) в JD Beggs . Работа в Wellcome Центр клеточной биологии поддерживается Wellcome основного финансирования (092076).

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics