Afstemmings degradatie om een specifieke en efficiënte eiwit depletie te bereiken

Immunology and Infection
 

Summary

Hier presenteren we een protocol voor het effectief en specifiek afbreken van een eiwit van belangstelling voor de gist Saccharomyces cerevisiae met behulp van het β-est hulpsysteem.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De plant auxine binding receptor, TIR1, herkent eiwitten die een specifiek auxineontbrandbaar degron (hulp) motief in aanwezigheid van auxine bevatten, gericht op afbraak. Dit systeem wordt geëxploiteerd in veel niet-plantaardige eukaryoten, zodat een doelwit eiwit, getagd met het hulp motief, wordt afgebroken op auxin Surgery-aanvulling. Het niveau van TIR1 expressie is essentieel; overmatige expressie leidt tot afbraak van het met hulp gelabelde eiwit, zelfs bij afwezigheid van auxine, terwijl lage expressie leidt tot langzame uitputting. Een β-Estradiol-indugbaar hulpsysteem werd gecreëerd, met een expressie van TIR1 onder de controle van een β-Estradiol-induceerbaar promotor. Het niveau van TIR1 is instelbaar door het tijdstip van incubatie met β-Estradiol voor auxin Surgery te veranderen. Dit protocol beschrijft hoe snel een doel proteïne uit te putten met behulp van het hulpsysteem. De juiste incubatietijd van β-Estradiol is afhankelijk van de overvloed van het doeleiwit. Daarom is een efficiënte uitputting afhankelijk van een optimale timing die ook auxin-onafhankelijke depletie minimaliseert.

Introduction

Voorwaardelijke mutaties, zoals temperatuurgevoelige mutanten, zijn een krachtig hulpmiddel voor de studie van essentiële eiwitten, waardoor celgroei onder de permissieve toestand mogelijk is, maar het verlies van functie onder niet-permissieve omstandigheden veroorzaakt. Echter, celmetabolisme kan ernstig worden verstoord door de verandering in de groeiomstandigheden die nodig zijn om het defect te induceren en kan ook het creëren van off-target effecten. Verschillende methoden zijn ontwikkeld, waarin het eiwit van belang is voorwaardelijk afgezonderd1 of de uitdrukking wordt gecontroleerd2,3 door toevoeging van een kleine molecule. Dit protocol gebruikt auxine en het auxin Surgery-inducible degron (hulp) systeem om een doeleiwit efficiënt af te putten.

Het steunstelsel heeft zijn oorsprong in planten, waar een auxine (in dit Protocol van indool-3-azijnzuur (IAA) wordt gebruikt), stimuleert de interactie van het aux/IAA-eiwit met TIR1, een lid van het SCF U3 ubiquitine ligase complex4. SCF complex interactie veroorzaakt polyubiquitination van aux/IAA familie eiwitten, wat resulteert in hun afbraak door het proteasoom5,6.

Dit systeem werd eerder aangepast voor gebruik in de gist Saccharomyces cerevisiae7,8 door het uitdrukken van het TIR1 eiwit van oriza Sativa (ostir) in gistcellen, waar het in staat is om te communiceren met de endogene gist SCF complex. Het eiwit van belang werd getagd met een motief uit de aux/IAA proteïne IAA17 om het te richten op afbraak. Functionele truncaties van IAA17 werden later ontwikkeld, zoals hulp *8,9,10, met het 43 aminozuur auxinegevoelig motief uit Arabidopsis thaliana IAA17, samen met een epitoop tag om in staat te stellen Detectie.

Het systeem dat in eerste instantie is aangepast voor gebruik bij ontluikende gist7, heeft het osTIR1 eiwit van een promotor van gist gal uitgedrukt. Expressie vereist verschuiving naar groeimedium met galactose als de enige koolstofbron, die, helaas, resulteert in een diauxische verschuiving met brede veranderingen in celmetabolisme11. Aan de andere kant is gemeld dat constitutieve uitdrukking van TIR1 kan leiden tot afbraak van het doeleiwit bij afwezigheid van auxine/IAA12 als het uitdrukkings niveau hoog is, terwijl een lage TIR1 expressie inefficiënte uitputting veroorzaakt. Een verbeterd hulpsysteem met de naam β-est AID werd ontwikkeld waarbij de osTIR onder de controle staat van een niet-induceerbaar promotor die geschikt is voor het doeleiwit, met een minimaal effect op het celmetabolisme. Om dit te bereiken, werd een kunstmatige transcriptiefactor (ATF) geconstrueerd waarin de VP16 virale transcriptie Activator wordt samengesmolten tot een oestrogeen receptor en een vier Zn vingers DNA binding Domain (DBD). Wanneer β-Estradiol (een oestrogeen) aanwezig is, kan de ATF de Nucleus binnengaan en ostir-transcriptie induceren door binding aan de promotor (Z4EVpr)13,12.

osTIR expressie is meestal detecteerbaar ongeveer 20 min na toevoeging van β-Estradiol12. Echter, de optimale duur van osTIR expressie om een efficiënte uitputting van het gelabelde eiwit met auxine te bereiken, terwijl het vermijden van uitputting vóór auxine bovendien, moet voor elk doeleiwit empirisch worden bepaald. Een geschatte tijd voor deze pre-incubatie kan worden geschat op basis van overvloed waarden in de database Saccharomyces Genoome (SGD https://www.yeastgenome.org/). Zoals te zien is in Figuur 1, vereist het overvloedige eiwit, Dcp1 (2880 tot 4189 moleculen/cel), 40 min pre-incubatie met β-estradiol, waarbij geen auxine-onafhankelijke depletie is waargenomen. De veel minder overvloedige eiwitten, Prp2 (172 tot 211 moleculen/cel), is sterk uitgeput na slechts 20 min van pre-incubatie. Het is raadzaam om twee extra pre-incubatie tijden te testen, 10 tot 20 minuten voor of na deze initiële geschatte tijd (20 min is de minimumtijd die wordt aanbevolen). De optimale pre-incubatietijd is het tijdstip waarop het doeleiwit niet is uitgeput voordat u auxine toevoegt en wanneer auxine wordt toegevoegd de uitputting is aanvaardbaar of de eiwit niveaus benaderen het mogelijke minimum. Dus, uit Figuur 1b, voor Prp22 met 30 min van pre-incubatie, de niveaus zijn niet veel gedaald 10 min na auxin Surgery aanvulling. Vergeleken met 40 min preincubatie en 15 minuten met IAA, waar er weinig extra uitputting is, is er geen voordeel bij het inbroeren van auxin Surgery langer dan 10 min of pre-incuberen langer dan 30 minuten, met name omdat er aanwijzingen zijn van niet-auxin Surgery afhankelijke uitputting bij 40 min. Voor Dcp1 met 40 min voor incubatie (het laatste punt waarop het eiwitgehalte ongeveer 100% voor auxine is), is 15 tot 20 minuten depletie met auxine aanvaardbaar. Het wordt aanbevolen om de depletie tijd zo kort mogelijk te houden om secundaire effecten op het celmetabolisme te verminderen14.

Dit artikel demonstreert het gebruik van het β-est hulpsysteem door het optimaliseren van de timing van β-Estradiol incubatie voor osTIR expressie om snelle eiwit depletie te bereiken op IAA toevoeging zonder uitputting alvorens auxine toe te voegen.

Protocol

Opmerking: Zie afbeelding 2 voor een grafische samenvatting.

1. voorbereiding van de stam

  1. Gebruik een ura3-stam en Introduceer het β-ste hulpsysteem (d.w.z. genen die de β-Estradiol responsieve transcriptiefactor (ATF) en de ostir coderen) en steun * het doeleiwit (Zie Figuur 3 en tabel 1 voor een samenvatting van de procedure).
    1. Transformeer15 ofwel pZTRK (G418 Resistance marker) of Pztrl (LEU2 marker) plasmide (verkrijgbaar bij het gist genetische bron centrum) in de ura3- gist stam of gebruik het plasmide als template om het PCR-product te produceren voor genomische Integratie.
    2. PCR versterken de ATF (gemarkeerd Z4EVATF op de plasmide kaart) en osTIR met behulp van een high-fidelity polymerase van een van de plasmiden pZTRK of pZTRL. Gebruik primers met 50 tot 60 base 3 ' Extensions met homologie aan de genomische regio, om directe integratie door homologe recombinatie16. Voor genomische integratie van beide componenten afzonderlijk of samen, Zie tabel 1 voor primers en condities.
      Opmerking: De strain pZ4EV-NTR1 heeft de componenten al geïntegreerd in het genoom (verkrijgbaar bij het gist genetische bron centrum, Japan).
    3. Zorg ervoor dat het doeleiwit steun * gelabeld is met behulp van de Longtine procedure17 (Zie Figuur 3b en tabel 1).
    4. Voer een groeianalyse uit op de stam zonder β-estradiol en IAA aanwezig om te bepalen of de AID * tag de groei beïnvloedt en om de groeisnelheid te voorspellen voor gebruik bij stap 1,5.

2. algemene procedure voor uitputting

  1. Bereken hoeveel cultuur nodig is voor alle monsters die moeten worden verzameld; bijvoorbeeld, 10 mL van de cultuur op OD600 van 0,8 is voldoende voor eiwit, RNA en DNA-extractie voor een enkel monster, dus voor 6 monsters, is ten minste 60 ml cultuur nodig.
  2. Van een nachtelijke cultuur, zet voldoende nieuwe cultuur op OD600 0,1 tot 0,2 en laat groeien op 30 ° c. Een rijk medium zoals YPDA wordt aanbevolen, hoewel andere groeiomstandigheden kunnen worden gebruikt:
    Gist extract 10 g
    Pepton 20 g
    Glucose 20 g
    Adenine sulfaat 40 mg
    H2O tot 1 L

    Opmerking: Autoclaaf of filter steriliseren; filter sterilisatie heeft de voorkeur als peptide/suiker complexen geproduceerd door autoclaven precipitaat in de methanol gebruikt in monsterverzameling.
  3. Voorbereidingen voor het ontvangen van de monsters.
    1. Breng 30 tot 50% van het beoogde monstervolume van methanol in een buisje. Bijvoorbeeld, als een monster van 10 mL moet worden genomen, zet 5 mL methanol in een 15 mL Falcon buis en sluit de buis strak. Eenmaal gesloten, label de buis en zet op droogijs of bij-80 °C te relaxen.
      Let op: Verdeel de methanol in een rook afzuigkap.
    2. Label 1,5 mL buizen voor lange termijn opslag van de monsters en plaats in ijs te koelen.
    3. Koel voldoende H2O (ten minste 1 ml per monster) op ijs.
  4. Anticiperen op de groei van de cultuur. De doel-OD voor het verzamelen van de monsters is ongeveer 0,7 tot 0,8, maar de pre-incubatie stap (de incubatie met β-Estradiol voor het opwekken van de osTIR) moet eerder worden gestart, zodat de cultuur ongeveer de juiste OD bereikt tegen de tijd dat de monsters Verzameld.
    Opmerking: Het is raadzaam om een groeicurve uit te voeren in de omstandigheden die in het experiment moeten worden gebruikt, zodat deze start OD kan worden geschat.
  5. Zodra de doel-OD voor het begin van de pre-incubatie is bereikt, neemt u een monster (meestal 10 mL) in de voorbereide buis die koude methanol bevat. Kort omkeren om te mengen en terug te plaatsen in droogijs.
    Opmerking: Het monster kan worden verplaatst naar water ijs na ongeveer 5 min, indien handig om dit te doen.
  6. Voeg onmiddellijk de β-estradiol, 1 μL/mL cultuur (eindconcentratie van 10 μM) toe; Laat de β-Estradiol vooraf gemeten in een pipet die klaar is voor gebruik om de tijd tussen het verzamelen van het monster en het toevoegen van de β-Estradiol te verkorten. Snel mengen door krachtig zwenkende.
  7. Doorgaan met het kweken van de cultuur zoals voorheen (stap 2,2), incuberen (dit is de "pre-incubatie" stap) met β-Estradiol voor de optimale tijd (voor bepaling van de optimale pre-incubatietijd Zie Figuur 1).
  8. Bereid u voor om IAA (auxin) toe te voegen. Neem het volume IAA op dat nodig is voor stap 2,10 (d.w.z. 0,5 μL IAA per mL cultuur). Dit maakt stap 2,20 sneller.
  9. Verzamel een voorbeeld als stap 2,5.
  10. Voeg onmiddellijk IAA 0,5 μL/mL cultuur toe aan een eindconcentratie van 750 μM zoals voorbereid in stap 2,8. Snel mengen door krachtig zwenkende.
  11. Verzamelmonsters, zoals stap 2,5, volgens uw experimentele ontwerp. Ofwel een enkel monster, in een tijd waarin wordt verwacht dat het eiwit betrouwbaar uitgeput zal zijn, of meerdere monsters in een tijdsverloop van uitputting. Bijvoorbeeld, 5 min intervallen zijn handig voor de timing en bieden een scala aan eiwit niveaus. De optimalisatiestrategie, zoals weergegeven in Figuur 1, geeft een indicatie van geschikte tijden.
  12. De monsters te verwerken.
    1. Plaats de monsters op ijs, zo niet al gedaan. Ervoor te zorgen dat geen van de monsters is bevroren; Als ze, zachtjes warm in de hand, constant inverteren zodat de temperatuur niet lokaal stijgt.
      Opmerking: Dit is het best gedaan in de hand als de temperatuur van het monster kan worden beoordeeld, het moet altijd koud voelen. Plaats op ijs. Dit is geen pauze punt-zodra alle monsters vloeiend zijn, gaat u verder met de volgende stap.
    2. Zodra alle monsters zijn verzameld en niet meer bevroren zijn, spin bij 3.500 x g gedurende 2 minuten (bij 4 °c indien mogelijk).
    3. Giet de methanol/medium mix en plaats terug op ijs; Maak je geen zorgen als niet alle vloeistof is verwijderd.
    4. Respendeer de celpellet in 1 mL ijskoude H2O (vanaf stap 2.3.3) en breng over naar een gelabelde buis van 1,5 ml (bereid in stap 2.3.2) op het ijs.
    5. Draai kort (bijv. 10 s totale tijd) bij > 15000 x g om de cellen opnieuw te pellet, plaats terug op ijs en verwijder de vloeistof.
    6. Verwijder de H2O door aspiratie. De celpellets kunnen bij-20 °C worden bewaard, of-80 °C voor lange termijn opslag.
  13. Controleer het niveau waarop het eiwit is uitgeput door Western Blot Analysis18.
    Opmerking: Voldoende proteïne19 en/of nucleïnezuur kunnen voor de meeste doeleinden worden geëxtraheerd uit één celpellet, hoewel zeldzame RNA-soorten mogelijk meer monstervolume vereisen.

Representative Results

Representatieve voorbeelden van uitputting worden weergegeven in Figuur 1. De drie experimenten gepresenteerd in deze figuur waren optimalisatie-experimenten voor uitputting van de eiwitten Prp2, Prp22 en Dcp1. De geringe abundantie, spliceosomale Prp2 en Prp22 eiwitten waren beiden uitgeput tot minder dan 20% na 40 min pre-incubatie met β-Estradiol gevolgd door 15 minuten met auxin. Langere pre-incubatie tijden leiden tot een snellere uitputting, maar vertonen ook ongewenste proteïne depletie voor auxin Surgery. Ter vergelijking, de meer overvloedige Dcp1 was slechts uitgeput tot ongeveer 30% met dezelfde behandeling, maar 60 min van pre-incubatie resulteerde in uitputting tot 13% met dezelfde auxin Surgery behandeling, tegen de kosten van uitputting voordat de auxin Surgery werd toegevoegd. Het is mogelijk dat 50 min van pre-incubatie met β-estradiol en 15 minuten met auxin Surgery op een korter tijdstip vergelijkbare resultaten zouden hebben bereikt en dus meer optimaal zou zijn geweest.

Figure 1
Figuur 1: het depletie percentage kan worden afgesteld door de duur van de β-Estradiol pre-incubatie te moduleren. Western Blot18 van doel proteïnen: (a en b) PRP22-Aid *-6vlag, (c en d) Prp2-Aid *-6vlag, en (e en f) Dcp1-Aid *-6ha, van culturen die zijn voorgeïnincubeerd met β-Estradiol (β-EST) voor 20, 30, 40 of 60 min vóór auxin Surgery bovendien12. In elke rijstrook werden gelijke hoeveelheden totaal eiwit geladen. Pgk1 wordt gedetecteerd als een visuele laad controle, met uitzondering van panel e, waarbij Pgk1 en Dcp1 co-migreren. De kwantificering van de eiwit banden in de deelvensters a, c en e wordt respectievelijk weergegeven in de deelvensters b, den f . Als maatstaf voor het depletie percentage werd de helling (m) berekend voor de lineaire sectie (van 100% tot 30% van de initiële waarden) van elke curve. De optimale pre-incubatietijd is het moment waarop het eiwitgehalte nog steeds dicht bij de door de VN geïnduceerde niveaus (100%) en de daaropvolgende snelheid van uitputting is snel. Voor Dcp1 (f) is 60 min voor incubatie te lang, omdat het eiwit is begonnen te degraderen bij afwezigheid van auxine, terwijl 20 min te kort is, omdat het eiwit in deze tijd cursus niet merkbaar uitgeput is. Na 40 minuten pre-incubatie kan 15 minuten met auxine worden gebruikt omdat het eiwit ongeveer 70% uitgeput is en, hoewel 20 min zou resulteren in verdere uitputting, het kan ook leiden tot secundaire effecten. Foutbalken vertegenwoordigen de standaarddeviatie van twee biologische replicaten. Voor elk experiment wordt één representatieve vlek weergegeven. Dit cijfer is afgeleid van de vorige publicatie9. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Afbeelding 2: grafische samenvatting. Voeg β-Estradiol toe aan voldoende cultuur die groeit in een rijk medium en op de gewenste temperatuur om de pre-incubatie te starten. Blijf groeien voor de vereiste pre-incubatietijd voordat u IAA (auxin) toevoegt om uitputting te starten. De pre-incubatie-en depletie tijden zijn afhankelijk van het eiwit dat moet worden uitgeput, maar pre-incubatie is vaak in het bereik van 20-60 min en de depletie tijd is meestal in de orde van 10 tot 20 min. 10 mL monsters moeten worden genomen aan het begin en einde van pre-incubatie en Durin g de uitputting. Deze monsters worden snel in koude methanol gefixeerd voor het pelleteren en bewaren. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: stam generatie voor het B-est systeem. a) om een gist stam te genereren met het steun * systeem, ofwel de Pztrl (LEU2) of de pztrk (kanamycine (G418) resistentie), moet plasmide worden ingebracht in de stam of, als alternatief, kunnen de ATF en ostir in het genoom worden ingebracht door homologe recombinatie van een fragment gegenereerd door PCR uit 3 ' eind primers (Zie Figuur 3b en tabel 1). b) C-terminale tagging van het doeleiwit wordt bereikt door PCR-versterking van de juiste regio van de plasmide PURA3-Aid *-6vlag (pURA3_AID *-6ha verschilt alleen in de tag en kan op exact dezelfde manier worden behandeld), met behulp van Longtine primers S3-F en S2-R met 3 ' Extensions homologe aan het 3 ' uiteinde van het doeleiwit. De voorwaartse primer uitbreiding moet de laatste aminozuur codon in frame met het begin van de tag AID * bevatten en mag niet de halte codon bevatten. De omgekeerde primer uitbreiding moet naar een regio stroomafwaarts van de coderende regio. Eenmaal ingebracht in het genoom, cellen die de URA3 marker hebben verloren (door homologeuze recombinatie tussen de identieke gebieden gevonden aan beide uiteinden van de marker) kan worden geselecteerd door groei met 5-FOA, die Counter-selecteert URA3 cellen. Klik hier om een grotere versie van dit cijfer te bekijken.

a. primer sequenties
Doel Locatie Primer Naam Volgorde TM (°C)
pZTRL 516 F pZTRL_F <-regio van homologie-> GCGACAGCATCACCGACTTCG 61,23
7897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-regio van homologie (RC)-> 61,30
pZTRK 9154 F pZTRK_F <-regio van homologie-> ACGTTGAGCCATTAGTATCAATTTGCTTACC 59,40
5897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-regio van homologie (RC)-> 61,30
pURA3-AID *-6VLAG of pURA3_AID *-6HA F S3-F <-regio van homologie-> CGTACGCTGCAGGTCGAC 59,21
R S2-R ATCGATGAATTCGAGCTCG <-regio van homologie (RC)-> 52,76
pZRTL/K is om het β-ste steunsysteem te versterken
pURA3-Aid *-6vlag/6ha om de steun * en de epitoop tag te versterken om het doelwit eiwit te taggen (lontine-procedure)
<-regio van homologie-> Regio die homologe is voor de flankerende gebieden waar het systeem moet worden ingebracht. Hoe langer deze regio, hoe waarschijnlijker het is dat de wijziging succesvol is; 50-100 basissen wordt aanbevolen.
<-regio van homologie (RC)-> Regio homologe voor de flankerende gebieden waar het systeem moet worden ingebracht, vergeet niet om het omgekeerde complement te gebruiken. Zoals hierboven, hoe langer deze regio is hoe beter.
TM (°C) TM met de methode% GC met 50 mM NaCl
b. PCR-mix
Component Volume (μL)
Sjabloon < 10
NEB phusion HF buffer (5x) * 100
Voorwaartse primer 100 μM 2,5
Omgekeerde primer 100 μM 2,5
dNTPs 10 mM per stuk 10
H2O tot en met 500
* De NEB phusion GC buffer (5x) kan ook gebruikt worden, maar heeft geen voorkeur
Maak deze mix, opgesplitst in 10 tubes van 50 μl meng en voer de PCR uit als tabel 1 c.
Controleer of de PCR heeft gewerkt door op een agarose-gel te draaien
Combineer alle succesvolle reacties in één buis en ethanol precipitaat
Transformeer de gist met al het materiaal geproduceerd door de PCR-
c. PCR-voorwaarden
Stap Temperatuur (°C) Tijd
Initiële denaturatie 98 30 s
25-35 cycli Denatureren 98 10 s
Anneal 45 – 60 20 s
Extensie 72 30 s/KB
Final extensie 72 10 min.
Houden 8
Anneal bij 45 °C voor de Lontine primer set (S3-F en S2-R) en 60 °C voor de pZTRL/K primers
3 minuten verlengen voor de Lontine PCR en 3 minuten voor pZTRL/K

Tabel 1: primer sequenties, PCR mix en PCR condities.

Discussion

Een goed geoptimaliseerd protocol kan een snelle en efficiënte uitputting van het doeleiwit opleveren. Het bepalen van de geschatte pre-incubatietijd met β-Estradiol is belangrijk, omdat dit de reproduceerbaarheid van de uitputting verhoogt, maar kleine variaties in de pre-incubatietijd kunnen worden getolereerd. Aan de andere kant, moet voorzichtigheid worden ingenomen met timing na auxine bovendien, als het eiwit niveau daalt zeer snel.

Een voordeel van deze aanpak is dat afgestemde depletie kan worden bereikt door wisselende combinaties van pre-incubatietijd met β-estradiol en IAA incubatietijd. Indien gewenst kan het doeleiwit bijvoorbeeld langzamer worden uitgeput door de pre-incubatietijd te verminderen.

Het β-est hulpsysteem biedt bepaalde voordelen ten opzichte van systemen waar OsTIR constitutioneel wordt uitgedrukt. Als het doeleiwit bijvoorbeeld essentieel is voor de levensvatbaarheid, kan gereguleerde expressie van osTIR voorkomen dat het doeleiwit vroegtijdig wordt uitgeput. Bovendien kan de expressie van osTIR worden afgestemd op de overvloed van het doeleiwit en de gevoeligheid voor afbraak, en de uitputting kan snel of traag zijn. De twee kleine molecuul Effectors, β-estradiol en auxine, niet perturb het gist metabolisme onder de hier gebruikte omstandigheden, in tegenstelling tot rapamycine, gebruikt in het anker-away systeem1.

Opgemerkt moet worden dat het taggen van sommige eiwitten hun functie verstoort, wat een probleem is met een gericht depletie systeem. In dit geval kan een N-Terminal-tag werken wanneer een C-Terminal-tag niet werkt. Ook zullen niet alle eiwitten efficiënt uitgeput raken; de AID-tag op het doeleiwit kan bijvoorbeeld ontoegankelijk zijn voor het osTIR-eiwit. Daarom moet, na het taggen van de hulp, elk doeleiwit worden getest op elk effect van de tag op de groei en om te bepalen of de depletie effectief is, voordat de tijden van de β-Estradiol pre-incubatie en de auxin Surgery-behandeling worden geoptimaliseerd.

Dit hulp * systeem is zeer eenvoudig en is compatibel met elke daaropvolgende experimentele procedure die geen verdere groei met zich meebrengt, zoals eiwit, DNA of RNA-analyse of microscopie. Daarnaast werkt het systeem goed in combinatie met thiolabelling om ontluikende RNA20te zuiveren.

Dit systeem biedt een snelle, specifieke en reproduceerbare manier om een eiwit uit te putten zonder anderszins het metabolisme van de gist cel te beïnvloeden.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Met dank aan Jane Reid voor het initiëren van dit programma, Barbara Terlouw for Development, Vahid Aslanzadeh voor de "Ura Looper" constructies en Susana de Lucas voor veel nuttige discussies. Dit werk werd gesteund door een beurs voor GIMO van de Consejo Nacional de Ciencia y Tecnología, Mexico (CONACYT) en de Universiteit van Edinburgh school of Biological Sciences, een Wellcome PhD studentship aan IEM [105256] en door Wellcome funding [104648] naar JD Beggs . Het werk in het Wellcome Center for Cell Biology wordt ondersteund door Wellcome kernfinanciering [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics