Dégradation de l'adage pour atteindre un appauvrissement spécifique et efficace des protéines

Immunology and Infection
 

Summary

Ici, nous présentons un protocole pour épuiser efficacement et spécifiquement une protéine d'intérêt dans la levure Saccharomyces cerevisiae en utilisant le système aid est.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le récepteur de liaison des élines de la plante, TIR1, reconnaît les protéines contenant un motif spécifique de degron auxin-inductible (AID) en présence d'auxine, les ciblant pour la dégradation. Ce système est exploité dans de nombreux eucaryotes non-végétaux, de sorte qu'une protéine cible, marquée avec le motif AID, est dégradée à l'addition auxin. Le niveau d'expression TIR1 est critique; l'expression excessive conduit à la dégradation de la protéine AID-étiquetée même en l'absence d'auxin, tandis que la basse expression conduit à l'épuisement lent. Un système d'AID inducible d'estradiol a été créé, avec l'expression de TIR1 sous le contrôle d'un promoteur inductible de l'estradiol. Le niveau de TIR1 est réglable en modifiant l'heure d'incubation avec l'estradiol avant l'ajout d'auxin. Ce protocole décrit comment épuiser rapidement une protéine cible à l'aide du système AID. Le temps d'incubation approprié de l'estradiol dépend de l'abondance de la protéine cible. Par conséquent, l'épuisement efficace dépend du moment optimal qui minimise également l'épuisement auxin-indépendant.

Introduction

Les mutations conditionnelles, telles que les mutants sensibles à la température, sont un outil puissant pour l'étude des protéines essentielles, permettant la croissance cellulaire dans l'état permissif, mais causant une perte de fonction dans des conditions non permissives. Cependant, le métabolisme cellulaire peut être sérieusement perturbé par le changement des conditions de croissance nécessaires pour induire le défaut et peut également créer des effets hors cible. Plusieurs méthodes ont été développées, dans lesquelles la protéine d'intérêt est conditionnellement séquestrée1 ou son expression est contrôlée2,3 par l'ajout d'une petite molécule. Ce protocole utilise l'auxine et le système de dégron auxin-inductible (AID) pour épuiser efficacement une protéine cible.

Le système AID a son origine dans les plantes, où une auxine (dans ce protocole indole-3-acetic acid (IAA) est utilisé), stimule l'interaction de la protéine Aux/IAA avec TIR1, un membre du complexe de ligase u3 SCF U34. L'interaction complexe de SCF cause la polyubiquitination des protéines de famille D'Aux/IAA, qui a comme conséquence leur dégradation par le protéasome5,6.

Ce système a été précédemment adapté pour une utilisation dans la levure Saccharomyces cerevisiae7,8 en exprimant la protéine TIR1 d'Oriza sativa (osTIR) dans les cellules de levure, où il est capable d'interagir avec la levure endogène Complexe SCF. La protéine d'intérêt a été étiquetée avec un motif de la protéine Aux/IAA IAA17 pour la cibler pour la dégradation. Des troncations fonctionnelles de l'IAA17 ont été développées plus tard, telles que AID8,9,10, contenant le 43 acide aminé auxin-sensible motif de Arabidopsis thaliana IAA17, avec une étiquette d'épitope pour permettre découverte.

Le système initialement adapté pour une utilisation dans la levure en herbe7,8 exprimé la protéine osTIR1 d'un promoteur de levure GAL. L'expression nécessite de passer au milieu de croissance avec le galactose comme seule source de carbone, ce qui, malheureusement, se traduit par un changement diauxic avec des changements de grande envergure au métabolisme cellulaire11. D'autre part, il a été rapporté que l'expression constitutive de TIR1 peut conduire à la dégradation de la protéine cible en l'absence d'auxine / IAA12 si le niveau d'expression est élevé, tandis que faible expression TIR1 provoque un appauvrissement inefficace. Un système aid amélioré nommé 'est AID' a été développé dans lequel l'osTIR est sous le contrôle d'un promoteur inductible qui est réglable pour convenir à la protéine cible, avec un effet minimal sur le métabolisme cellulaire. Pour ce faire, un facteur de transcription artificielle (ATF) a été construit dans lequel l'activateur de transcription virale VP16 est fusionné à un récepteur d'œstrogènes et un domaine de liaison d'ADN de quatre doigts de Zn (DBD). Lorsqu'il y a de l'estradiol (œstrogène) est présent, l'ATF peut entrer dans le noyau et induire la transcription osTIR en se liant à son promoteur (Z4EVpr)13,12.

L'expression osTIR est généralement détectable environ 20 min après l'ajout de l'estradiol12. Cependant, la durée optimale de l'expression osTIR pour atteindre l'épuisement efficace de la protéine étiquetée avec des élines, tout en évitant l'épuisement avant l'addition d'auxin, doit être empiriquement déterminée pour chaque protéine cible. Un temps approximatif pour cette pré-incubation peut être estimé à partir des valeurs d'abondance dans la base de données du génome de Saccharomyces (SGD https://www.yeastgenome.org/). Comme on peut le voir à la figure 1, la protéine abondante, Dcp1 (2880 à 4189 molécules/cellules), nécessite 40 min de pré-incubation avec de l'estradiol, sans épuisement indépendant des élins observés. La protéine beaucoup moins abondante, Prp2 (172 à 211 molécules/cellules), est fortement appauvrie après seulement 20 min de pré-incubation. Il est conseillé de tester deux temps de pré-incubation supplémentaires, de 10 à 20 minutes avant ou après ce temps estimé initial (20 min est le temps minimum recommandé). Le temps optimal de pré-incubation est le moment où la protéine cible n'a pas épuisé avant d'ajouter des élines et une fois que l'éplétion est ajoutée l'épuisement est acceptable ou les niveaux de protéines approchent le minimum possible. Ainsi, à partir de la figure 1b, pour Prp22 avec 30 min de pré-incubation, les niveaux n'ont pas diminué beaucoup 10 min après l'ajout d'auxin. En comparant cela avec 40 min de pré-incubation et 15 min avec l'AAI, où il y a peu d'épuisement supplémentaire, il n'y a aucun avantage à couver avec des auxins de plus de 10 min ou à pré-incubation pendant plus de 30 min, d'autant plus qu'il y a des preuves de non-auxine épuisement dépendant à 40 min. Pour Dcp1 avec 40 min de pré-incubation (le dernier point où le niveau de protéine est d'environ 100% avant l'ajout d'auxin), 15 à 20 min d'épuisement avec des élins est acceptable. Il est recommandé de garder le temps d'épuisement aussi court que possible pour réduire les effets secondaires sur le métabolisme cellulaire14.

Cet article montre comment utiliser le système aid de l'EST en optimisant le moment de l'incubation de l'estradiol pour l'expression osTIR afin d'atteindre l'épuisement rapide des protéines cibles lors de l'ajout de l'IAA sans épuisement avant d'ajouter des élines.

Protocol

REMARQUE: Voir Figure 2 pour un résumé graphique.

1. Préparation des souches

  1. À l'aide d'une souche ura3,introduire le système AID est-est (c.-à-d. les gènes codant le facteur de transcription sensible à l'estradiol (ATF) et l'osTIR) et l'AIDMD identifient la protéine cible (voir la figure 3 et le tableau 1 pour un résumé de la procédure).
    1. Transformez15 pZTRK (marqueur de résistance G418) ou pZTRL (marqueurLEU2) plasmide (disponible à partir du Centre de ressources génétiques de levure) dans la souche de levure ura3 ou utilisez le plasmide comme modèle pour produire le produit PCR pour la génomique intégration.
    2. PCR amplifie l'ATF (marqué Z4EVATF sur la carte plasmide) et osTIR à l'aide d'une polymérase haute fidélité de l'un ou l'autre des plasmides pZTRK ou pZTRL. Utilisez des amorces avec 50 à 60 extensions de base 3' avec homologie à la région génomique, pour diriger l'intégration par recombinaison homologue16. Pour l'intégration génomique des deux composantes séparément ou ensemble, voir tableau 1 pour les amorces et les conditions.
      REMARQUE: La souche pZ4EV-NTR1 a les composants déjà intégrés dans le génome (disponible auprès du Yeast Genetic Resource Centre, Japon).
    3. Assurez-vous que la protéine cible est étiquetée AIDMD à l'aide de la procédure Longtine17 (voir la figure 3b et le tableau 1).
    4. Effectuer une analyse de croissance de la souche sans présent d'estradiol et d'IAA pour déterminer si l'étiquette AIDMD affecte la croissance et pour prédire le taux de croissance à l'étape 1.5.

2. Procédure générale d'épuisement

  1. Calculer la quantité de culture requise pour que tous les échantillons soient prélevés; par exemple, 10 ml de culture à OD600 de 0,8 est suffisant pour l'extraction de protéines, d'ARN et d'ADN pour un seul échantillon, donc pour 6 échantillons, au moins 60 ml de culture est nécessaire.
  2. D'une culture du jour au lendemain, mettre en place une culture suffisamment nouvelle à OD600 0,1 à 0,2 et laisser croître à 30 oC. Un milieu riche tel que yPDA est recommandé, bien que d'autres conditions de croissance puissent être utilisées :
    extrait 10 g
    Peptone 20 g
    glucose 20 g
    Sulfate d'Adénine 40 mg
    H2O à 1 L

    REMARQUE: Autoclave ou filtre stériliser; la stérilisation des filtres est préférable comme complexes peptidiques/sucres produits par le précipité autoclavement dans le méthanol utilisé dans la collecte d'échantillons.
  3. Préparez-vous à recevoir les échantillons.
    1. Mettre 30 à 50 % du volume d'échantillon prévu de méthanol dans un tube. Par exemple, si un échantillon de 10 ml doit être prélevé, placez 5 ml de méthanol dans un tube de faucon de 15 ml et fermez le tube hermétiquement. Une fois fermé, étiqueter le tube et mettre sur la glace sèche ou à -80 oC pour refroidir.
      MISE EN GARDE: Distribuer le méthanol dans un capuchon à fumée.
    2. Étiqueter les tubes de 1,5 ml pour le stockage à long terme des échantillons et les placer dans la glace pour refroidir.
    3. Assez frais H2O (au moins 1 ml par échantillon) sur la glace.
  4. Anticiper la croissance de la culture. L'OD cible pour la collecte des échantillons est d'environ 0,7 à 0,8, mais l'étape de pré-incubation (l'incubation avec l'estradiol pour induire l'osTIR), doit être commencée plus tôt afin que la culture atteigne environ la bonne OD au moment où les échantillons sont calme.
    REMARQUE: Il est conseillé d'effectuer une courbe de croissance dans les conditions à utiliser dans l'expérience afin que cette OD de départ peut être estimée.
  5. Une fois que l'OD cible pour le début de la pré-incubation a été atteinte, prélever un échantillon (habituellement 10 ml), dans le tube pré-préparé contenant du méthanol froid. Inverser brièvement pour mélanger et remettre dans la glace sèche.
    REMARQUE: L'échantillon peut être déplacé vers la glace d'eau après environ 5 min, si pratique de le faire.
  6. Ajouter immédiatement l'estradiol de l'estradiol, 1 l/mL de culture (concentration finale de 10 m); faire pré-mesurer le 'estradiol'dans une pipette prête à l'emploi afin de réduire le temps nécessaire entre la collecte de l'échantillon et l'ajout de l'estradiol. Mélanger rapidement en tourbillonnant vigoureusement.
  7. Continuer à cultiver la culture comme avant (étape 2.2), incuber (c'est l'étape de « pré-incubation ») avec l'estradiol pour le temps optimal (pour déterminer le temps optimal de pré-incubation voir Figure 1).
  8. Préparez-vous à ajouter IAA (auxine). Prenez le volume d'IAA nécessaire pour l'étape 2.10 (c.-à-d., 0,5 L d'IAA par mL de culture). Cela rend l'étape 2.20 plus rapide.
  9. Recueillir un échantillon à l'étape 2.5.
  10. Ajouter immédiatement 0,5 IAA/mL de culture à une concentration finale de 750 M comme préparé à l'étape 2.8. Mélanger rapidement en tourbillonnant vigoureusement.
  11. Recueillir des échantillons, comme étape 2.5, selon votre conception expérimentale. Soit un seul échantillon, à un moment où l'on s'attend à ce que la protéine sera durablement appauvrie, soit plusieurs échantillons dans un cours d'épuisement. Par exemple, les intervalles de 5 minutes sont pratiques pour le moment et fournissent une gamme de niveaux de protéines. La stratégie d'optimisation, comme le montre la figure1, donnera une indication des moments appropriés.
  12. Traiter les échantillons.
    1. Placer les échantillons sur la glace, si ce n'est déjà fait. Veiller à ce qu'aucun des échantillons n'ait été congelé; s'ils l'ont fait, doucement chaud dans la main, en inversant constamment de sorte que la température n'augmente pas localement.
      REMARQUE: C'est mieux fait dans la main que la température de l'échantillon peut être évaluée, il devrait toujours se sentir froid. Placer sur la glace. Ce n'est pas un point de pause - une fois que tous les échantillons sont fluides, passez à l'étape suivante.
    2. Une fois que tous les échantillons ont été prélevés et ne sont plus congelés, tourner à 3 500 x g pendant 2 min (à 4 oC si possible).
    3. Verser le mélange méthanol/mélange moyen et le remettre sur la glace; ne vous inquiétez pas si tout le liquide n'a pas été enlevé.
    4. Resuspendre la pastille cellulaire dans 1 ml de glace h2O (à partir de l'étape 2.3.3) et transférer dans un tube étiqueté de 1,5 ml (préparé à l'étape 2.3.2) sur la glace.
    5. Tourner brièvement (p. ex., 10 s temps total) à 15 000 x g pour re-pelleter les cellules, remettre sur la glace et enlever le liquide.
    6. Retirez le H2O par aspiration. Les granulés de cellules peuvent être stockés à -20 oC, ou -80 oC pour un stockage à long terme.
  13. Vérifiez le niveau auquel la protéine a été épuisée par l'analyse western blot18.
    REMARQUE: Une protéinesuffisante 19 et/ou de l'acide nucléique peut être extraite d'une seule pastille cellulaire pour la plupart des fins, bien que les espèces rares d'ARN puissent nécessiter plus de volume d'échantillon.

Representative Results

Des exemples représentatifs d'épuisement sont affichés à la figure 1. Les trois expériences présentées dans ce chiffre étaient des expériences d'optimisation pour l'épuisement des protéines Prp2, Prp22 et Dcp1. Les faibles protéines Prp2 et Prp2, faibles abondances, spliceosomal Prp2 et Prp22, ont toutes deux diminué à moins de 20 % après 40 min de pré-incubation avec de l'estradiol, suivie s'il y a 15 min d'auxine. Des temps de pré-incubation plus longs conduisent à un épuisement plus rapide, mais aussi montrer l'épuisement indésirable des protéines avant l'ajout auxéin. En comparaison, le Dcp1 le plus abondant n'a été épuisé qu'à environ 30 % avec le même traitement, mais 60 min de pré-incubation ont entraîné un appauvrissement à 13 % avec le même traitement auxauxin, au prix de l'épuisement avant l'ajout de l'auxine. Il est possible que 50 min de pré-incubation avec de l'estradiol et 15 min avec de l'auxine auraient obtenu des résultats similaires à un moment plus court et auraient donc été plus optimaux.

Figure 1
Figure 1 : Le taux d'épuisement peut être réglé en modulant la durée de la pré-incubation de l'estradiol. Western blot18 of target proteins: (a and b) Prp22-AIDMD-6FLAG, (c et d) Prp2-AIDMD-6FLAG, and (e and f) Dcp1-AIDMD-6HA, from cultures pre-incubated with '-estradiol (est) for 20, 30, 40, or 60 min avant l'ajout auxin12. Des quantités égales de protéines totales ont été chargées dans chaque voie. Pgk1 est détecté comme un contrôle de chargement visuel, à l'exception du panneau e, où Pgk1 et Dcp1 co-migrent. Quantification des bandes protéiques en panneaux a, c et e sont indiqués dans les panneaux b, d, et f, respectivement. Pour mesurer le taux d'épuisement, la pente (m) a été calculée pour la section linéaire (de 100 % à 30 % des valeurs initiales) de chaque courbe. Le temps optimal de pré-incubation est le moment où les niveaux de protéines sont encore proches des niveaux non induits (100%) et le taux d'épuisement subséquent est rapide. Pour Dcp1 (f), 60 min de pré-incubation est trop long, car la protéine a commencé à se dégrader en l'absence d'auxine, alors que 20 min est trop court, car la protéine ne s'épuise pas sensiblement dans ce cours de temps. Après 40 min de pré-incubation, 15 min avec des auxines peuvent être utilisés car la protéine est épuisée à environ 70% et, bien que 20 min entraînerait un appauvrissement supplémentaire, il pourrait également entraîner des effets secondaires. Les barres d'erreur représentent l'écart standard de deux répliques biologiques. Pour chaque expérience, une tache représentative est montrée. Ce chiffre est dérivé de la publication précédente9. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Résumé graphique. Ajouter l'estradiol à une culture suffisante qui pousse dans un milieu riche et à la température requise pour commencer la pré-incubation. Poursuivre la croissance pendant le temps de pré-incubation requis avant d'ajouter l'AAI (auxine) pour commencer l'épuisement. Les temps de pré-incubation et d'épuisement dépendent de l'épuisement de la protéine, mais la pré-incubation est souvent de l'ordre de 20-60 min et le temps d'épuisement est généralement de l'ordre de 10 à 20 min. 10 ml d'échantillons doivent être prélevés au début et à la fin de la pré-incubation et de la durine g l'épuisement. Ces échantillons sont rapidement fixés dans du méthanol froid avant le granulé et le stockage. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Génération de souches pour le système B-est. (a) Pour générer une souche de levure avec le système AIDMD, soit la résistance pZTRL (LEU2) ou la résistance au pZTRK (kanamycine (G418), le plasmide doit être introduit dans la souche ou, alternativement, l'ATF et l'osTIR peuvent être insérés dans le génome par recombinaison homologue d'un fragment généré par PCR à partir d'amorces 3'end (voir Figure 3b et tableau 1). ( b) Le marquage C-terminal de la protéine cible est réalisé par l'amplification PCR de la région appropriée du plasmide pURA3-AID-6FLAG (pURA3-AID-6HA ne diffère que dans l'étiquette et peut être traitée exactement de la même manière), en utilisant les amorces Longtine S3-F et S2-R avec 3' extensions homologues à la fin 3' de la protéine cible. L'extension d'amorce avant doit inclure le dernier codon d'acide aminé dans le cadre avec le début de l'étiquette AIDMD et ne doit pas inclure le codon d'arrêt. L'extension d'amorce inversée devrait être à une région en aval de la région de codage. Une fois insérées dans le génome, les cellules qui ont perdu le marqueur URA3 (par recombinaison homologue entre les régions identiques trouvées aux deux extrémités du marqueur) peuvent être sélectionnées par croissance avec 5-FOA, qui contre-sélectionne les cellules URA3. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

a. Séquences d'apprêt
cible position apprêt nom ordre Tm (C)
pZTRL (en) 516 Annonces F pZTRL -lt;-région de l'homologie-gt;GCGACAGCATCACCGACTTCG 61,23
7897 Annonces R pZTR-R CGCCGCCTTACCTTGCAGA-lt;-région de l'homologie (RC) - 61h30
pZTRK (en) le 9154, au monde, F pZTRK -lt;-région de l'homologie--gt;ACGTTGAGCCATCATTATCAATTTGCTTACC 59,40 Annonces
5897 Annonces R pZTR-R CGCCGCCTTACCTTGCAGA-lt;-région de l'homologie (RC) - 61h30
pURA3-AIDMD-6FLAG ou pURA3-AID-6HA F S3-F (S3-F) -lt;-région de l'homologie-gt;CGTACGCTGCAGGTCGAC 59,21
R S2-R (S2-R) ATCGATGAATTCGAGCTCG-lt;-région de l'homologie (RC) - 52,76 Annonces
pZRTL/K est d'amplifier le système aid est
pURA3-AID-6FLAG/6HA pour amplifier l'étiquette AIDMD et epitope pour étiqueter la protéine cible (procédure Lontine)
la région de l'homologie-gt; Région homologue aux régions flanquées où le système doit être inséré. Plus cette région est longue, plus la modification est susceptible d'être couronnée de succès; 50 à 100 bases est recommandée.
lt;-région de l'homologie (RC)--gt; Région homologue aux régions de flanc où le système doit être inséré, n'oubliez pas d'utiliser le complément inverse. Comme ci-dessus, plus cette région est longue, mieux c'est.
Tm (C) Tm en utilisant la méthode %GC avec 50 mM NaCl
b. Mix PCR
composant Volume (L)
modèle lt;10
NEB Phusion HF Buffer (5x) 100 ans
Primer avant 100 M 2,5 Annonces
Primeur inverse 100 M 2,5 Annonces
dNTPs 10 mM chacun 10 Ans et plus
H2O à 500
Le tampon GC DE l'ONÉ Phusion (5x) peut également être utilisé, mais n'est pas préféré
Faire ce mélange, divisé en 10 tubes de 50 'l mélanger chacun et effectuer le PCR comme tableau 1 c.
Vérifiez que le PCR a fonctionné en courant sur un gel agarose
Combinez toutes les réactions réussies dans un tube et l'éthanol se précipitent
Transformez la levure avec tout le matériel produit par le PCR
c. Conditions PCR
pas Température (C) temps
Dénaturation initiale 98 Annonces 30 s
25-35 Cycles Dénaturer 98 Annonces 10 s
Anneal 45 à 60 ans 20 s
prolongation 72 Annonces 30 s/kb
Prolongation finale 72 Annonces 10 min
tenir 8 Annonces
Anneal à 45 oC pour l'ensemble d'amorces Lontine (S3-F et S2-R) et 60 oC pour les amorces pZTRL/K
Prolonger de 3 minutes pour le Lontine PCR et de 3 minutes pour pZTRL/K

Tableau 1 : Séquences d'apprêt, mix PCR et conditions PCR.

Discussion

Un protocole bien optimisé peut produire un appauvrissement rapide et efficace de la protéine cible. Il est important de déterminer le temps de pré-incubation approximatif avec l'estradiol, car cela augmente la reproductibilité de l'épuisement, mais de petites variations dans le temps de pré-incubation peuvent être tolérées. D'autre part, le soin doit être pris avec le calendrier après l'addition d'auxin, car le niveau de protéine diminue très rapidement.

Un avantage de cette approche est que l'épuisement accordé peut être atteint par des combinaisons variables de temps de pré-incubation avec le temps d'incubation de l'estradiol et de l'IAA. Par exemple, si désiré, la protéine cible peut être plus lentement épuisée en réduisant le temps de pré-incubation.

Le système aid est offre certains avantages par rapport aux systèmes où OsTIR est exprimé de façon constitutive. Par exemple, si la protéine cible est essentielle à la viabilité, l'expression réglementée de l'osTIR peut éviter l'épuisement prématuré de la protéine cible. En outre, l'expression de l'osTIR peut être accordée en fonction de l'abondance de la protéine cible et de sa susceptibilité à la dégradation, et l'épuisement peut être rapide ou lent. Les deux petits effecteurs de molécules, l'estradiol et l'auxine, ne perturbent pas le métabolisme de la levure dans les conditions utilisées ici, contrairement à la rapamycine, utilisée dans le système d'ancrage1.

Il convient de noter que le marquage de certaines protéines perturbe leur fonction, ce qui est un problème avec tout système d'épuisement ciblé. Dans ce cas, une balise N-terminal peut fonctionner lorsqu'une balise C-terminal ne fonctionne pas. De plus, toutes les protéines ne seront pas épuisées efficacement; par exemple, l'étiquette AID sur la protéine cible peut être inaccessible à la protéine osTIR. Par conséquent, après le marquage de l'AID, chaque protéine cible doit être testée pour tout effet de l'étiquette sur la croissance, et pour déterminer si l'épuisement est efficace, avant que les dates de pré-incubation et de traitement auxéinoïdes de l'estradiol ne soient optimisées.

Ce système AID Est très simple et compatible avec toute procédure expérimentale ultérieure qui n'implique pas de croissance ultérieure, comme l'analyse des protéines, de l'ADN ou de l'ARN ou la microscopie. En outre, le système fonctionne bien lorsqu'il est combiné avec le thiolant pour purifier l'ARN naissant20.

Ce système fournit un moyen rapide, spécifique et reproductible d'épuiser une protéine sans affecter autrement le métabolisme de la cellule de levure.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Merci à Jane Reid pour le lancement de ce programme, Barbara Terlouw pour le développement, Vahid Aslanzadeh pour le "ura looper" construit sais et Susana de Lucas pour de nombreuses discussions utiles. Ce travail a été soutenu par une bourse d'études à GIMO du Consejo Nacional de Ciencia y Tecnologa, Mexique (CONACYT) et l'Université d'Édimbourg School of Biological Sciences, un doctorat Wellcome à l'IEM [105256] et par Wellcome funding [104648] à JD Beggs . Les travaux du Wellcome Centre for Cell Biology sont appuyés par le financement de base de Wellcome [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics