Author Produced

الكشف عن نشاط الرجعية من الخط الساخن-1S من قبل لمسافات طويلة معكوس PCR

Cancer Research
 

Summary

توضح هذه المقالة اختبارًا بسيطًا يستند إلى PCR لمراقبة نشاط الرجعية LINE-1 النشطة ولرسم خريطة للتبديل الرجعي في جينوم معين. باستخدام خط الخلية MCF7، نبين هنا كيف يمكن تطبيق هذا الأسلوب للكشف عن نشاط LINE-1 الموجود في 22q12.1.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

العناصر النووية الطويلة المتداخلة 1 (LINE-1s) هي الأسرة الوحيدة من العناصر الوراثية المتنقلة في الجينوم البشري التي يمكن أن تتحرك بشكل مستقل. هم يتمّون أنّ بعملية يدعى [رتروترنبووووووت] حيث هم [تصّو] أن يشكّل [مرنا] متوسّطة أيّ يكون بعد ذلك أدخلت داخل الجينوم بنسخ عكسيّة. على الرغم من الصمت في الخلايا الطبيعية، LINE-1s نشطة للغاية في الأورام الظهارية المختلفة. دي نوفو يمكن أن تؤدي عمليات الإدراج في LINE-1 إلى حدوث تكوين الورم، وبالتالي من المهم دراسة خط-1 بصورة منهجية في السرطان. من بين حوالي 150 خط-1 من الالرجعية المختصة الموجودة في الجينوم البشري، فقط حفنة من LINE-1 loci، ويشار إليها أيضا باسم "الساخنة" LINE-1s، تمثل غالبية دي نوفو LINE-1 الإدراج في أنواع السرطان المختلفة. لقد قمنا بتطوير تفاعل متسلسل بوليميراز بسيط (PCR) القائم على طريقة لرصد نشاط الرجعية من هذه الخط الساخن-1s. هذه الطريقة، التي تستند إلى معكوس لمسافات طويلة (LDI)-PCR، تستفيد من 3 نقل، وهي آلية يقوم من خلالها خط-1 بتعبئة المنطقة غير المتكررة المحيطة بها، والتي يمكن استخدامها فيما بعد لتحديد أحداث الانتراب من خط -1-3 تنبع من خط ساخن معين-1.

Introduction

العناصر النووية المتداخلة طويلة (LINE-1s) هي عائلة من العناصر الوراثية المتنقلة تسمى retrotransposons التي يمكن أن تتحرك بشكل مستقل من مكان إلى آخر عن طريق آلية النسخ ولصق تسمى الرجعية. على مدى الوقت التطوري، وقد تراكمت الجينوم البشري أكثر من 500،000 نسخة من LINE-1 يكرر1. ومع ذلك، فإن معظم النسخ LINE-1 الموجودة في الجينوم يتم تغييرها وبالتالي لا يمكن أن تتحرك عن طريق التحريك. فقط ~ 150 نسخة لديها نسخة سليمة من تسلسل الحمض النووي اللازمة بالنسبة لهم لنقل2. في الخلايا الجسدية العادية ، يتم تقييد حركة هذه الخط-1 من قبل عوامل المضيف المختلفة3. يتم تخفيف هذه القيود في الأورام الظهارية المختلفة، مما تسبب في إزالة الضغط على LINE-1s مما أدى إلى العديد من عمليات الإدراج دي نوفو في جينوم الورم4. وقد ثبت أن بعض هذه الإدراجات المرتبطة بالورم دي نوفو تسبب الطفرات الإدراجية في الجينات، وبالتالي قيادة تطور الورم5،6. لذلك، من المهم أن تكون قادرة على تعيين الإدراج اتلاف جديدة في جينوم الورم.

الأساليب القائمة للكشف عن عمليات الإدراج de novo LINE-1 استخدام (1) نهج تسلسل الجينوم الكامل4و7و8، حيث يتم استخدام خوارزميات حسابية مختلفة للعثور على عمليات الإدراج de novo LINE-1 من بيانات WGS، أو (2) تسلسل الجيل التالي الذي يستهدف نهاية 3 قمن الشباب، يحتمل أن تكون نشطة LINE-1s 9،10،11،12،13. ومع ذلك، فإن العثور على إدراجات جديدة بين عدة آلاف من النسخ شبه المتطابقة مع هذه الأساليب هو أبعد ما يكون عن تافهة، ويزداد التحدي تفاقما بسبب عدم تجانس الورم والتعديلات الجينية المرتبطة إدراج LINE-14.

وأظهرت الدراسات التي تستخدم هذه الأساليب القائمة أن عدد قليل فقط من LINE-1s تمثل غالبية عمليات الإدراج دي نوفو لاين-1 لوحظت في الأورام7،8. لذلك، للإجابة على ما إذا كانت عينة ورم معينة يعرض نشاط LINE-1، يكفي تعيين الأحداث الرجعية الناجمة عن هذه الحفنة من موضع LINE-1 النشط للغاية. في هذه المقالة، ونحن نصف تفاعل سلسلة بوليميراز بسيطة (PCR) القائم على طريقة14 التي يمكن استخدامها لرصد نشاط موقع خط-1 معين في الإنترون الأولى من الجين TTC28 في 22q12.1 التي تنشط بشكل كبير في سرطان القولون والمستقيم 7 , 8.سيتم الإشارة إلى هذا الموقع الخط-1 كما TTC28-LINE-1في جميع أنحاء المادة. هذا الاختبار يحدد على وجه التحديد دي نوفو LINE-1 الأحداث الرجعية التي تحشد تسلسل غير متكرر على المنطقة المحيطة 3 ق من مصدر LINE-1 من قبل آلية تسمى 3 € transduction15. 3 يحدث الانتراب بسبب ضعف إشارة تعدد الإنكار LINE-1 (PAS) التي تسبب الآلية النسخية لتخطيه وإنهاء النسخ بدلا ً من ذلك في المصب PAS أقوى، وبالتالي التقاط تسلسل غير متكرر المحيطة ( من الآن فصاعدا يشار إليها باسم "العلامة الفريدة") التي يتم إدراجها بعد ذلك في الموقع المستهدف جنبا إلى جنب مع تسلسل LINE-1. وقد أظهر فيليب وآخرون16 مؤخراً أن أنواع الخلايا المختلفة يمكن أن تعبر عن مواقع مختلفة من خط 1. في ضوء هذا الاستنتاج، يمكن تطبيق هذه الطريقة لرصد نشاط LINE-1 الأكثر وضوحا ً التي تحشد علامتها الفريدة في نوع السرطان من الاهتمام.

الخطوة الأولى في LDI-PCR هو هضم الحمض النووي الجينومي مع إنزيم تقييد الذي يولد جزء تقييد يحتوي على خط-1 يجري مقايسة (هنا، TTC28-LINE-1) وعلامته الفريدة (الشكل 1). ثم يتم تعميم الحمض النووي المهضوم عن طريق الربط الذاتي وPCR تضخيم باستخدام التمهيديات العكسية الموجودة داخل العلامة الفريدة. من خلال القيام بذلك، يتم تضخيم دائما مصدر كامل طول LINE-1 في موقعه "الأصلي" وجنبا إلى جنب مع ذلك، سيتم أيضا تضخيم النسل LINE-1 الإدراج في مكان هدف مختلف يحتوي على علامة فريدة من نوعها (الشكل1)، وبالتالي الإبلاغ نشاط الرجعية من LINE-1 في السؤال.

Protocol

تمت الموافقة على هذا البحث من قبل مجلس المراجعة المؤسسية ولجنة الأخلاقيات في مستشفى جامعة هلسنكي. تم الحصول على موافقة مستنيرة موقعة من الموضوع لعينة الدم المستخدمة لإثبات هذا البروتوكول.

1. تصميم التمهيديات العكسية واختيار الإنزيمات المقيدة (المعلوماتية الحيوية)

  1. تحديد علامة فريدة مقترنة بخط-1
    1. قم بتنزيل تسلسل TTC28-LINE-1بتنسيق FASTA من قاعدة بيانات LINE-1 مثل L1Base17. معرف L1base لـ TTC28-LINE-1هو 135.
    2. قم بتضمين تسلسل 5 كيلو بايت يحيط بكل من 5 و 3 نهايات من تسلسل LINE-1 والتعليق التوضيحي في معالج النصوص.
      ملاحظة: هنا يتم شرح تسلسل الجناح خط-1 بخط بني و تسلسل LINE-1 بخط رمادي (ملف تكميلي).
    3. أدخل 1 كيلو بايت تسلسل المصب من PAS cognate خط-1 المحدد في أداة التنبؤ PAS مثل polyadq18 أو التنين بوليا مراقب19 والتعليق على جميع إشارة polyadenylation في هذا الإطار 1 كيلو بايت.
      ملاحظة: إذا لم يكن هناك PAS في إطار 1 كيلو بايت البحث عن PAS في إطار 1 كيلو بايت التالي المتلقين للمعلومات. يتم تمييز TTC28-LINE-1الخاصة ضعيفة PAS باللون الوردي ويتم تمييز جميع PAS الأخرى في 1 كيلو بايت نافذة المصب باللون الأحمر ( ملفتكميلي).
    4. قم بشرح التسلسل بين نهاية PAS cognate LINE-1 وأقوى PAS المصب كـ "علامة فريدة".
      ملاحظة: يتم تمييز "علامة فريدة" من TTC28-LINE-1باللون الأصفر (ملفتكميلي).
  2. تصميم التمهيديات العكسية
    1. تصميم التمهيديات PCR عكسي عن طريق إدخال تسلسل "علامة فريدة من نوعها" في أداة تصميم التمهيدي على شبكة الإنترنت مثل التمهيدي 3 (http://bioinfo.ut.ee/primer3-0.4.0/) أو PRIMER-BLAST NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). منذ أزواج التمهيدي التي صممتها هذه الأدوات تواجه بعضها البعض تسهيل PCR التقليدية، واستخدام وظيفة عكس تكملة للزوج التمهيدي لأداء PCR العكسي.
      ملاحظة: كما يتم اقتطاع أنابيب LINE-1 بشكل كبير في نهايتها 5 × وحجم المنطقة المستحثة متغير للغاية، تهدف إلى الحفاظ على المسافة بين التمهيديين العكسيين الحد الأدنى، عن طريق وضع المعلمة "طول المنتج PCR" في NCBI التمهيدي-BLAST إلى الحد الادني. في حالة PAS متعددة داخل العلامة الفريدة، وتصميم العديد من أزواج التمهيدي التي تتوافق مع PASs مختلفة. تصميم التمهيديات قريبة من PAS، كما يبدأ الإدراج LINE-1 من 3 € نهاية من الحمض النووي الريبي المتوسطة و5 € نهاية يتم اقتطاعها بشكل مختلف. هنا تم تصميم ثلاثة أزواج التمهيدي، وأبرز في teal والأخضر، المقابلة لثلاث إشارات polyadenylationقوية في علامة فريدة من نوعها من TTC28 LINE-1 (ملف تكميلي).
  3. اختيار إنزيمات تقييدية
    1. هضم تسلسل LINE-1 جنبا إلى جنب مع الأجنحة المنبع والمصب 5 كيلو بايت في silico باستخدام أداة على شبكة الإنترنت مثل RestrictionMapper. وهذا سيعطي قائمة شاملة من الإنزيمات المقيدة التي تهضم هذه المنطقة، وتوليد أجزاء تقييد مختلفة.
    2. حدد الإنزيمات المقيدة التي تقطع المكان الأصلي للخط-1 على النحو التالي: في نهاية 5،، إما في أعلى المنبع من LINE-1 € s 5 ... end أو بعيدا 5 ... end من LINE-1 نفسها، وفي نهاية 3 €، المصب من العلامة الفريدة للخط-1.
      ملاحظة: يجب أن يكون إنزيم التقييد المحدد غير حساس لمثيلة الحمض النووي، وينبغي أن يكون غير قابل للتنشيط الحراري، وينبغي أن يولد نهايات متداخلة "لزجة" مكملة لبعضها البعض. من أجل إظهار LDI-PCR، يتم استخدام إنزيم تقييد SacI الذي يقطع الحمض النووي في مواقع GAGCTC، وتسليط الضوء هنا في الضوء الأخضر ، (ملف تكميلي).
    3. الإحاطة علما بحجم جزء تقييد التي أدلى بها إنزيمات تقييد محددة. يجب ألا يكون هذا أطول من 12 كيلو بايت لأنه قد لا يتم تضخيمه بكفاءة بواسطة PCR.

2. صنع قوالب الحمض النووي الدائري لمسافات طويلة معكوس PCR

  1. استخراج الحمض النووي وتقييم الجودة
    1. استخراج الحمض النووي الجيني من العينات (الورم أو الدم) باستخدام مجموعات استخراج الحمض النووي المتاحة تجاريا التي يمكن استخراج نوعية جيدة، وارتفاع الحمض النووي الجزيئي الوزن اللازمة لLDI-PCR وفقا لتعليمات الشركة المصنعة. بدلا من ذلك، يمكن أيضا استخراج الحمض النووي عالية الوزن الجزيئي عن طريق الفينول: الكلوروفورم20.
    2. قياس تركيز الحمض النووي باستخدام مقياس الفلورومتر وفقاً لتعليمات الشركة المصنعة، وتشغيل 100 نانوغرام من الحمض النووي على 1٪ (ث / الخامس) هلام أغاروز يحتوي على بروميد إيثيديوم (0.5 ميكروغرام / مل) في 1x تريس خلات إدتا (TAE) العازلة في 4.5 V / سم21 جنبا إلى جنب مع الهند علامات الوزن الجزيئي الحمض النووي للتحقق من نوعية الحمض النووي والكمية.
  2. هضم الحمض النووي الجينومي
    1. جعل مزيج رد فعل الهضم (المجلد النهائي من 50 درجة مئوية) عن طريق إضافة 20 وحدة SacI تقييد الإنزيم، 5 ميكرولتر من 10X رد الفعل العازلة (جدولالمواد)،100 نانوغرام من الحمض النووي (تصل إلى 44 ميكرولتر) في أنبوب PCR 0.2 مل على الجليد (1 ميكرولتر من إنزيم تقييد من معظم الشركات المصنعة ط s كافية لهضم تماما 100 نانوغرام من الحمض النووي الجينومي). خلط الحل عن طريق النقر على الأنبوب، والطرد المركزي لفترة وجيزة.
    2. استخدم دورة حرارية لاحتضان مزيج التفاعل عند درجة حرارة 37 درجة مئوية لمدة ساعة واحدة، يليها تعطيل الحرارة عند 65 درجة مئوية لمدة 5 دقائق.
  3. ربط الحمض النووي الجينومي المهضوم ذاتياً
    1. إلى مزيج الهضم 50 ميكرولتر (بعد الخطوة 2.2.2)، إضافة 8 ميكرولتر من 10X T4 الحمض النووي الرباط العازلة، 1 ميكرول (5 وحدات) من T4 DNA ligase و 21 ميكرولتر من الماء النقي جدا لجعل حجم رد الفعل النهائي من 80 درجة مئوية. ، والطرد المركزي لفترة وجيزة.
    2. حضانة في دورة الحرارية في 22 درجة مئوية لمدة 10 دقائق، وتنتهي مع خطوة تعطيل الحرارة في 65 درجة مئوية لمدة 10 دقائق.

3. لمسافات طويلة معكوس PCR

  1. تحديد درجة حرارة الصلب التمهيدي عن طريق التدرج PCR
    1. تعيين تدرج درجة حرارة صلب من (A-4) درجة مئوية، (A-2)°C، A، (A+2)°C، (A+4) درجة مئوية حيث A هي درجة حرارة الصلب النظرية للزوج التمهيدي محسوبة باستخدام أداة البائع التجاري المستندة إلى الويب.
      ملاحظة: قد لا تسمح الدراجات الحرارية من بعض الشركات المصنعة تعيين تدرج درجة الحرارة يدوياً. في هذه الحالة، يمكن استخدام إعداد التدرج التلقائي مع نطاق درجة حرارة (A-4) درجة مئوية إلى (A+4) °C.
    2. إعداد مزيج رئيسي لPCR عن طريق الجمع بين وخلط المكونات التالية في أنبوب الطرد المركزي الصغير 1.5 مل: 4 ميكرولتر من 5X احتياطي التفاعل، 0.4 ميكرولتر من 10 mM dNTP، 5 ميكرولتر من 2 μM PCR التمهيدي (إلى الأمام والخلف، مصممة في الخطوة 1.3.1) ، 0.2 ميكرولتر (0.1 U) من بوليميراز الحمض النووي لكل رد فعل. إعداد رد فعل واحد لكل درجة حرارة الصلب في التدرج.
    3. لكل رد فعل، aliquot 19 μL من المزيج الرئيسي في أنابيب PCR 0.2 مل وإضافة 1 ميكرولتر (1.25 نانوغرام) من قالب الحمض النووي الدائري المحرز في القسم 2.
      ملاحظة: استخدم الحمض النووي الدائري الذاتي المربط الناتج عن الحمض النووي العادي للدم كقالب لتجنب استهلاك الحمض النووي للورم الثمين المحتمل لهذه الخطوة التحسينية.
    4. تشغيل برنامج PCR التدرج على دورة حرارية كما هو موضح أدناه: '1' دورة واحدة من 3 دقائق عند 98 درجة مئوية (denaturation)؛ '2' 35 دورة (10 ق عند 98 درجة مئوية]، 20 ق عند تدرج درجة الحرارة من [A-4] إلى [A+4] °C [الصلب] و1−6 دقيقة [30 s لكل كيلوbase من المنتج المتوقع PCR] عند 72 درجة مئوية [ملحق])؛ '3' دورة واحدة من 10 دقائق عند درجة حرارة 72 درجة مئوية (التمديد النهائي).
    5. تشغيل 6 μL من المنتج PCR في 1٪ هلام agarose21 أعدت في 1X TAE العازلة في 4.5 V / سم وتحليل منتجات PCR تنتج في درجات حرارة الصلب مختلفة.
    6. حدد درجة حرارة الصلب التي تنتج منتج PCR الذي يتوافق مع الحجم المتوقع.
  2. الكشف عن نشاط de novo LINE-1 الرجعية في جينوم الورم
    1. إجراء LDI-PCR باستخدام الزوج التمهيدي PCR العكسي على قوالب الحمض النووي الدائرية التي تم إنشاؤها من عينات الورم (القسم 2). اتبع نفس الإرشادات الخاصة بـ PCR التدرجي (القسم 3.1)، ولكن هذه المرة استبدال تدرج درجة الحرارة بدرجة حرارة الصلب المثلى.
    2. تحليل منتجات PCR بواسطة الكهربائي هلام أغاروز كما هو الحال في الخطوة 3.1.5. وينبغي أن يكون منتج PCR ذو الحجم المعروف أو منتج PCR "الأصلي" المقابل للخط -1 في موضعه الأصلي مرئياً لكل رد فعل. دي نوفو خط-1 3 € transduction في عينة الورم -- يمكن الكشف عنها كمنتجات PCR من أحجام مختلفة ، جنبا إلى جنب مع المنتج PCR الأصلي في هلام أغاروز.

4- تسلسل منتجات أقل البلدان نمواً - PCR للكشف عن هوية المواقع المستهدفة لـ LINE-1 3- transduction

  1. إجراء تسلسل القراءة الطويلة أحادي الجزيء لجميع amplicons PCR التي تم إنشاؤها في كل رد فعل LDI-PCR لتحديد مواقع التكامل المستهدفة من هذه الأحداث خط-1 3 € transduction.
    ملاحظة: الاستنساخ وتسلسل سانجر لمنتجات أقل البلدان نمواً - PCR هو أيضاً نهج ممكن، وإن كان مرهقاً.
  2. محاذاة القراءات التي تنتجها منصات تسلسل القراءة الطويلة أحادية الجزيء مع الجينوم المرجعي باستخدام خطوط أنابيب محاذاة التسلسل القياسية. تحليل القراءة المحاذاة باستخدام برنامج LDI-PCR14 لتحديد عمليات الإدراج de novo LINE-1 والمواقع المستهدفة الخاصة به.

Representative Results

في حالة TTC28-LINE-1، هناك أكثر من PAS واحد داخل إطار 1 كيلو بايت المصب من PAS cognate، وبالتالي فإن المنطقة بين TTC28-LINE-1PAS وأقوى PAS في 811 نقطة أساس المصب اعتبرت علامة فريدة لTTC28-LINE-1. تم تصميم ثلاثة أزواج التمهيدي PCR العكسي في هذه العلامة الفريدة التي تتوافق مع PASS مختلفة الحالية14. اخترنا ثلاثة إنزيمات تقييدية: (1) NsiI التي تقطع 5... وتولد هذه الأجزاء التقييدية من 288 10 نقطة أساس و 699 5 نقطة أساس و305 6 نقطة أساس على التوالي.

من أجل إظهار هذه الطريقة، قمنا بإجراء LDI-PCR على الحمض النووي المستخرج من خط الخلية MCF7. وقد تم الإبلاغ عن هذا الخط خلية سرطان الثدي سابقا لعرض TTC28-LINE-1 النشاط16. للبساطة، قمنا بإجراء قالب الحمض النووي الدائري باستخدام إنزيم تقييد واحد، ساكالأول، من أصل ثلاثة، وقمنا بإجراء LDI-PCR باستخدام زوج التمهيدي واحد من أصل ثلاثة (الجدول 1) للكشف عن عمليات الإدراج من جديد LINE-1 النابعة من TTC28- الخط 1

تم ضمان نوعية جيدة من الحمض النووي المستخرج من خط الخلية MCF7 من قبل الأوجاروز جل الكهربائي (الشكل2). الحمض النووي عالي الوزن الجزيئي سليمة يظهر أن الحمض النووي الجينومي هو من الجودة المثلى لهذا التحليل. إذا كانت مسحة مرئية بدلا من ذلك، وهذا يشير إلى سوء نوعية الحمض النووي المستخرج، والتي بدورها سوف تعوق الإجراءات المصب.

ويبين الشكل 3 نتيجة تمثيلية لتجربة الـ PCR المتدرجة، التي تهدف إلى تحديد درجة حرارة الصلب المثلى للزوج التمهيدي العكسي TTC28-LINE-1. تم استخدام الحمض النووي الجينومي للدم المهضوم مع SacI، متبوعاً بالربط الذاتي لتشكيل قالب الحمض النووي الدائري، لهذا التفاعل. يظهر منتج PCR محدد للغاية من الحجم المتوقع (5,649 نقطة أساس) عند 62 و64 و66 درجة مئوية أن درجة الحرارة المثلى لهذا الزوج التمهيدي تقع ضمن نطاق 62-66 درجة مئوية.

لقد قمنا بتوليد قالب حمض نووي دائري من خلال هضم الحمض النووي الجينومي MCF7 مع إنزيم تقييد SacI متبوعاً بالربط الذاتي. ويبين الشكل 4 أن TTC28-LINE-13€ يحدث التحويل في خطوط الخلايا MCF7: يمكن الكشف عن عمليات الإدراج دي نوفو كمنتجات LDI-PCR من أحجام مختلفة جنبا إلى جنب مع منتج PCR الأصلي من الحجم المعروف (5,649 bp). ولتحديد الإحداثيات الجينية لمواقع الهدف de novo، يمكن تسلسل أمبوليكونات PCR (انظر قسم البروتوكول 4).

Figure 1
الشكل 1 نظرة عامة على LDI-PCR للكشف عن LINE-1 3 ... transduction. يتم إنشاء قالب الحمض النووي الدائري عن طريق الهضم الأول (I) مع إنزيم تقييد وذاتية الربط (II) عليه. ويلي هذه الخطوة PCR العكسي (III) مع التمهيديات PCR عكسية تستهدف العلامة الفريدة من الخط-1 من الفائدة (تسلسل بين PAS الأضعف الخط-1 الخاصة، باللون الوردي، وأقوى PAS المصب، باللون الأحمر). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2 تقييم جودة الحمض النووي المستخرج. 100 نانوغرام من الحمض النووي المستخرج من خط الخلية MCF7 والدم من فرد عادي، والتي سيتم استخدامها كعينة التحكم، تم تشغيلها جنبا إلى جنب مع 1 ميكرولتر و 2 ميكرولتر من الحمض النووي / HindIII علامة وصفت باسم M. يرجى انقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3 التدرج PCR لتحديد درجة حرارة الصلب الأمثل لالتمهيديات PCR عكسي (الجدول 1). يُظهر الطراز LDI-PCR باستخدام أزواج التمهيدي العكسي في درجة حرارة صلب تتراوح بين 56 و66 درجة مئوية منتجPCR متميز عند 62-66 درجة مئوية. يشير السهم الأخضر إلى درجة حرارة الصلب المحددة للتجارب المستقبلية. قالب الحمض النووي الدائري الذي تم إنشاؤه عن طريق هضم الحمض النووي الجينومي للدم من فرد عادي مع SacI متبوعاً بالربط الذاتي تم استخدامه لهذه الخطوة التحسينية. M، علامة (1 كيلو بايت بالإضافة إلى سلم الحمض النووي). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4 LDI-PCR لتحديد خط-1 3 € transduction الناجمة عن TTC28 -خط-1. قوالب الحمض النووي الدائرية التي تم إنشاؤها عن طريق هضم MCF7 والدم (من الفرد العادي) الحمض النووي الجينومي مع الكيسالأول تليها الربط الذاتي تم تضخيمها من قبل التمهيديات العكسية في درجة حرارة الصلب الأمثل. وقد تم الكشف عن منتج PCR "الأصلي"، الذي يحمل علامة نجمية، من الحجم المتوقع (5649 نقطة أساس) في كل من الحمض النووي MCF7 والحمض النووي العادي للدم، في حين أنتجت MCF7 أيضا منتجات PCR إضافية من أحجام مختلفة، مما يشير إلى de novo LINE-1 retrotransposition. M، علامة (1 كيلو بايت سلم الحمض النووي). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

اسم التمهيدي تسلسل (5 € → 3 € )
L1_001 (rev) TTCACTAAGGTGTGTGTAAAAC
L1_002 (fwd) في هذا الـ401

الجدول 1: معكوس PCR التمهيدي الزوج مصممة لعلامة فريدة من نوعها من TTC28 -الخط-1 14 سنة .

ملف تكميلي. الرجاء النقر هنا لتحميل هذا الملف.

Discussion

هنا نقوم بوصف طريقة التي يمكن استخدامها لتحديد دي نوفو LINE-1 الإدراج اتّبأ من أيّ [لين-1] نشطة فائدة. لقد قمنا بتحسين هذه الطريقة لLINE-1 نشطة للغاية، وتقع في 22q12.1، وأثبتت سابقا أن تكون حساسة للغاية في الكشف عن الإدراج تحت كلونال في سرطان القولون والمستقيم14.

يعتمد نجاح LDI-PCR على جودة الحمض النووي الجينومي. ولذلك، أدرجنا خطوة إضافية لمراقبة الجودة لضمان وجود الحمض النووي عالي الوزن الجزيئي في بداية البروتوكول (الخطوة 2-1-2). نوصي بتخزين الحمض النووي الجيني عند -20 درجة مئوية للتخزين على المدى الطويل، وإعداد aliquots من أجل تجنب دورات التجميد والذوبان. ينصح بشدة باستخدام الحمض النووي الجيني من الدم أو الأنسجة الطبيعية المتطابقة المريض للتمييز بين ما إذا كان خط-1 الرجعية الكشف عن هو جرثومة أو حدث جسدي. وبما أن مواقع القطع للأنزيمات المقيدة هي مؤشر الاستوكاستك في الجينوم، فمن الممكن أن موقع إدخال خاص من جديد من خط -1 قد لا يأوي أي مواقع قطع للإنزيم المقيد المستخدم في محيطه. وبالتالي لزيادة احتمال الكشف عن غالبية عمليات الإدراج دي نوفو LINE-1 في الحمض النووي الورم، ينبغي استخدام أكثر من إنزيم تقييد في ردود فعل منفصلة لتوليد مكتبات مختلفة من قالب الحمض النووي الدائري. وعلاوة على ذلك، إذا كانت العلامة الفريدة من الخط-1 ذات الأهمية لديها أكثر من PAS واحد، ثم استخدام أزواج التمهيدي المتاخمة لكل PAS يحسن فرص الكشف عن transductions اقتطاع هابا.

على الرغم من وجود طرق أنيقة للكشف على نطاق الجينوم من الإدراج دي نوفو LINE-1، فإنها يمكن أن تكون ساحقة إذا كان الهدف هو التحقيق في كفاءة رجعية من LINE-1 معين في سياق خلوي معين. ولهذا الغرض، يمكن أن يكون برنامج الـ LDI-PCR نهجاً غير مكلف وبسيط ولكنه قوي لتصور أحداث التحديث ية LINE-1. ويشبه نهج الاستهداف المستخدم في هذه الطريقة نهج TS-ATLAS22؛ ومع ذلك، LDI-PCR يتجنب استخدام oligonucleotides linker ويمكن تضخيم كل من 5 € و 3 € تقاطعات دي نوفو الخط-1 الإدراج في وقت واحد. يمكن الحصول على معلومات تتعلق بكل من تقاطعات 5 و 3 درجة من الإدراج LINE-1، الموقع المستهدف للتكامل، ذيل polyA والتعديلات في الموقع المستهدف، وكلها من السمات المميزة للتحديث LINE-1، عن طريق اقتران LDI-PCR مع جزيء واحد تقنيات التسلسل طويلة القراءة. تحتوي القراءات الطويلة التي تم إنشاؤها على تسلسل LINE-1 المدرج وعلامته الفريدة والتسلسلات المستهدفة في قراءة واحدة، والالتفاف على صعوبات تعيين القراءات القصيرة في المنطقة المتكررة.

هناك اثنين من القيود الرئيسية لاستخدام LDI-PCR للكشف عن نشاط LINE-1. الأول متأصل في PCR: فإنه يمكن فقط تضخيم أجزاء موثوق بها تصل إلى 10 كيلو بايت في الحجم. وينبغي مراعاة ذلك عند اختيار إنزيم (إنزيمات) تقييد، حيث يجب ألا يتجاوز الجزء الأصلي هذا الحد. ثانياً، يمكن لهذه الطريقة فقط الكشف عن أحداث التمركز الرجعية التي تحشد المنطقة المحيطة بالخط-1 من خلال 3 قنوات. وبالتالي، لن يتم الكشف عن نشاط تلك LINE-1s التي لا تعرض 3 ... بالإضافة إلى ذلك، على الرغم من أن يتم تضخيمها من قبل LDI-PCR، قد لا يتم الكشف عن بعض الأحداث الرجعية LINE-1 التي (أ) توليد هدف PCR من حجم مماثل للموقع "الأصلي" أو غيرها من الرجعية أو (ب) نادرة أو تحت النسيلة، قد لا يتم الكشف عنها بواسطة هلام أغاروز الكهربائي. ويمكن التقاط هذه الأحداث الرجعية LINE-1 عن طريق تسلسل المنتج LDI-PCR باستخدام جزيء واحد طويل القراءة تقنيات التسلسل14.

سير العمل الموضح هنا يمكن تعديلها بسهولة للكشف عن نشاط الأخرى "الساخنة" LINE-1s باستخدام إنزيم تقييد مناسبة وعن طريق تصميم التمهيديات العكسية التي تستهدف هذه LINE-1s. بالإضافة إلى الكشف عن LINE-1 بوساطة 3 - transduction، يمكن تكييف هذه الطريقة للكشف عن أقل تواترا LINE-1 بوساطة 5 € transductions23. وقد استخدمت طريقة مماثلة لتحديد موقع التكامل للصحفيين LINE-1 في الاختبارات القائمة على الخلايا24 ومواقع التكامل بروفيروسي في السرطان25. وإلى جانب عمليات الإدراج في الخط 1، يمكن أيضا استخدام هذه الطريقة للكشف عن الانحرافات الجينية الأخرى، مثل إعادة ترتيب الحمض النووي، حيث توجد المعلومات المتعلقة بالمنطقة المعرضة لإعادة الترتيب من قبل26.

Disclosures

وليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

نود أن نشكر جميع المؤلفين المشاركين لدينا في هذه المقالة حيث تم وصف هذه الطريقة لأول مرة14، وخاصة تاتيانا كاجوسو ، كيمو بالين ، أوتي Kilpivaara وإيسا Pitkänen لمناقشات قيمة في حين تطوير الأسلوب. وتمول أكاديمية فنلندا (أرقام المنح 25996 و 292789 و 306026 و 314394) ومؤسسة سيغريد جوسيليوس والجمعية الفنلندية للسرطان. حصل ب. ب. على درجة الدكتوراه من مؤسسة أبحاث جامعة هلسنكي، ومنحة أطروحة من جمعية السرطان الفنلندية، ومنحة بحثية للدكتوراه من إيدا مونتينين سانتيو. كما نشكر تيمو ماسالين (جامعة هلسنكي) وكول شريستا من مجموعة أبحاث إل كيه على مساعدتنا في إنتاج الفيديو.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics