Author Produced

Detectie van de Retrotransponerings activiteit van Hot LINE-1S door de lange afstand inverse PCR

Cancer Research
 

Summary

Dit artikel schetst een eenvoudige PCR-gebaseerde assay om de activiteit van een actieve lijn-1 retrotransposon te monitoren en de Novo retrotransposities in een gegeven genoom in kaart te kunnen krijgen. Met behulp van de MCF7 cellijn tonen we hierin hoe deze methode kan worden toegepast om de activiteit van een lijn-1 te detecteren op 22q 12.1.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lang afgewisseld nucleaire elementen 1 (lijn-1s) zijn de enige familie van mobiele genetische elementen in het menselijk genoom die autonoom kunnen bewegen. Zij doen dit door een proces dat retrotransponering wordt genoemd, waarin zij transcriberen om een mRNA-tussenproduct te vormen, dat vervolgens door omgekeerde transcriptie in het genoom wordt ingebracht. Ondanks dat het stil is in normale cellen, zijn LINE-1S zeer actief in verschillende epitheliale tumoren. De Novo LINE-1 inserties kan mogelijk tumorigenesis rijden, en daarom is het belangrijk om systematisch te bestuderen lijn-1 retrotransponering in kanker. Uit ~ 150 retrotransponering-bevoegde lijn-1S aanwezig in het menselijk genoom, slechts een handvol lijn-1 loci, ook wel aangeduid als "hot" lijn-1S, rekening voor de meerderheid van de Novo line-1 inbrengen in verschillende kankersoorten. We hebben een eenvoudige polymerase chain reaction (PCR) gebaseerde methode ontwikkeld om de retrotransponerings activiteit van deze Hot LINE-1S te monitoren. Deze methode, gebaseerd op de lange afstand inverse (LDI)-PCR, maakt gebruik van 3 ́ transductie, een mechanisme waarmee een lijn-1 zijn flankerende niet-repetitieve regio mobiliseert, die vervolgens kan worden gebruikt om de Novo line-1 3 ́ transductie events te identificeren die voortvloeien uit een bepaalde Hot LINE-1.

Introduction

Lang afgewisseld nucleaire elementen (lijn-1s) zijn een familie van mobiele genetische elementen genaamd retrotransposons die zelfstandig van de ene plaats naar de andere kunnen verhuizen via een Kopieer-en-plak mechanisme genaamd retrotransponering. In de evolutionaire tijd heeft het menselijk genoom meer dan 500.000 exemplaren van lijn 1 herhalingen1opgebouwd. De meeste van de in het genoom aanwezige lijn 1-exemplaren zijn echter gemuleerd en kunnen dus niet worden verplaatst via retrotransponering; slechts ~ 150 exemplaren hebben een intacte kopie van de DNA sequentie die nodig is om te bewegen2. In normale somatische cellen wordt de mobiliteit van deze lijn-1S beperkt door verschillende hostfactoren3. Deze beperkingen zijn opgelucht in verschillende epitheliale tumoren, waardoor lijn-1S worden ontlast en resulterend in veel de Novo inserties in de tumor genoom4. Sommige van deze tumor-geassocieerde de Novo inserties is aangetoond dat insertionele mutagenese in genen veroorzaken, vandaar het stimuleren van de tumorprogressie5,6. Daarom is het belangrijk om te kunnen toewijzen van nieuwe inserties in het tumor genoom.

Bestaande methoden voor het detecteren van de Novo line-1 inserties gebruik (1) Whole-genoom sequencing aanpak4,7,8, waarbij verschillende computationele algoritmen worden gebruikt om de Novo line-1 inserties te vinden van WGS-gegevens, of (2) sequentiëren van de volgende generatie die gericht is op de 3 ' einde van jonge, potentieel actieve lijn-1S9, 10,11,12,13. Het vinden van nieuwe inserties tussen enkele duizend bijna identieke kopieën met deze methoden is echter verre van triviaal, en de uitdaging wordt verder verergerd door tumor heterogeniteit en genomische veranderingen in verband met LINE-1 insertion4.

Studies met behulp van deze bestaande methoden toonden aan dat slechts een paar line-1S rekening voor de meerderheid van de Novo line-1 inserties waargenomen in tumoren7,8. Daarom, om te beantwoorden of een bepaald tumor monster lijn 1-activiteit weergeeft, volstaat het om de retrotransponerings gebeurtenissen in kaart te plaatsen, veroorzaakt door dit handvol zeer actieve lijn-1 loci. In dit artikel beschrijven we een eenvoudige polymerase kettingreactie (PCR) gebaseerde methode14 die kan worden gebruikt om de activiteit van een bepaalde lijn te monitoren-1 Locus in het eerste intron van het TTC28 gen op 22q 12.1 dat zeer actief is in colorectale kanker 7 , 8. deze lijn-1 Locus zal worden aangeduid als TTC28-line-1 in het hele artikel. Deze bepaling identificeert specifiek de Novo line-1 retrotransponerings gebeurtenissen die niet-repetitieve sequenties op de 3 ' flankerende regio van de bron lijn-1 mobiliseren door een mechanisme genaamd 3 ́ transductie15. 3 ́ transductie treedt op als gevolg van het zwakke LINE-1 polyadenylatie signaal (PAS) dat ervoor zorgt dat de transcriptionele machines het overslaan en om in plaats daarvan transcriptie te beëindigen op het sterkere PAS stroomafwaarts, waardoor de flankerende niet-repetitieve sequentie wordt vastgelegd ( hierna aangeduid als de "unieke tag") die vervolgens wordt ingevoegd in de doellocatie naast de lijn-1-reeks. Philippe et al.16 toonde onlangs aan dat verschillende CELTYPEN verschillende lijn-1 loci kunnen uitdrukken. In het licht van deze bevinding, deze methode kan worden toegepast om de activiteit van de meest uitgesproken lijn-1 die hun unieke tag in de kankersoort van belang mobiliseren te bewaken.

De eerste stap in LDI-PCR is de vertering van genomisch DNA met een restrictie-enzym dat een restrictie fragment genereert met de lijn-1 die wordt getest (hier, TTC28-line-1) en zijn unieke tag (Figuur 1). Verteerd DNA wordt dan gecircuariseerd door zelf-ligatie en PCR versterkt met behulp van inverse primers gelegen binnen de unieke tag. Door dit te doen, wordt de volledige bron lijn-1 op zijn "native" locatie altijd versterkt en ernaast worden nakomelingen LINE-1-inserties op verschillende doel loci met de unieke tag ook versterkt (Figuur 1), waardoor rapportage de retrotransponerings activiteit van de betrokken lijn 1.

Protocol

Dit onderzoek werd goedgekeurd door de instellings Raad voor institutionele toetsing en ethisch comité van het universitair ziekenhuis van Helsinki. De ondertekende geïnformeerde toestemming werd verkregen van het onderwerp voor het bloedmonster dat werd gebruikt om dit protocol aan te tonen.

1. het ontwerpen van inverse primers en het selecteren van restrictie enzymen (bio-informatica)

  1. Het bepalen van een lijn-1 bijbehorende unieke tag
    1. Download de TTC28-line-1 sequentie in fasta formaat uit een line-1 database zoals L1Base17. De L1base-ID voor TTC28-line-1 is 135.
    2. Voeg 5 KB opeenvolging van zowel 5 ́ als 3 ́ uiteinden van de lijn-1 sequentie toe en annoteren deze in een tekstverwerker.
      Opmerking: hier wordt de lijn-1 flankerende sequentie geannoleerd in bruin lettertype, en lijn-1 sequentie is in grijs lettertype (aanvullend bestand).
    3. Voer 1 KB sequentie stroomafwaarts van geselecteerde lijn-1's verwant pas in een pas voorspelling gereedschap zoals polyadq18 of Dragon Polya Spotter19 en annoteren van alle het polyadenylatie signaal in dit 1 KB-venster.
      Let op: als er geen PAS in de 1 KB venster, zoeken naar PAS in volgende 1 KB venster stroomafwaarts. TTC28-line-1's eigen zwakke pas is gemarkeerd in roze en alle andere pas in 1 KB venster downstream is gemarkeerd in het rood (aanvullende bestand).
    4. Annoteren de sequentie tussen het einde van de lijn-1's verwant pas en de sterkste pas stroomafwaarts als "unieke tag".
      Opmerking: de "Unique tag" van TTC28-line-1 is geel gemarkeerd (aanvullend bestand).
  2. Het ontwerpen van inverse primers
    1. Ontwerp inverse PCR-primers door de "Unique tag"-volgorde in te voeren in een webgebaseerde primer-Designing tool zoals primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) of NCBI'S primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Aangezien primer paren die door deze gereedschappen zijn ontworpen, met elkaar worden geconfronteerd en de conventionele PCR vergemakkelijken, gebruikt u de omgekeerde complement functie voor het primer paar om inverse PCR uit te voeren.
      Opmerking: omdat lijn-1-transducties sterk afgekapt zijn op hun 5 ́-uiteinde en de grootte van het getransduceerde-gebied zeer variabel is, streven we ernaar om de afstand tussen de twee inverse primers minimaal te houden, door de parameter "PCR-product lengte" in NCBI primer-BLAST in te stellen op de Minimum. In het geval van meerdere PAS binnen de unieke tag, ontwerp verschillende primer paren die overeenkomen met verschillende passen. Ontwerp primers dicht bij het PAS, als lijn-1 inserties initiëren vanaf de 3 ́einde van de RNA intermediair en de 5 ́ einde wordt variabel afgekapt. Hier werden drie primer paren ontworpen, gemarkeerd in Teal en groen, overeenkomend met drie sterke polyadenylatie signalen in de unieke tag van TTC28 line-1 (aanvullend bestand).
  3. Beperking van enzymen selecteren
    1. Digest de lijn 1-volgorde samen met de 5 KB upstream en downstream flanken in silico met behulp van web-based tool zoals restrictionmapper. Dit geeft een uitgebreide lijst van beperkings enzymen die deze regio verteerd, waardoor verschillende beperkings fragmenten worden gegenereerd.
    2. Selecteer restrictie enzymen die de native locus van lijn-1 als volgt knippen: aan het einde van de 5 ́, ofwel stroomopwaarts van de lijn-1 's 5 ́end of far 5 ́einde van de lijn-1 zelf, en aan het uiteinde van de 3 ́, stroomafwaarts van de unieke tag van de lijn 1.
      Opmerking: het geselecteerde restrictie-enzym moet ongevoelig zijn voor DNA-methylatie, moet warmte-inactivatabel zijn en moet gespreide "kleverige" uiteinden genereren die complementair zijn aan elkaar. Om te demonstreren LDI-PCR, SACI restrictie ENZYM dat DNA snijdt op GAGCTC-sites, hier gemarkeerd in licht groen, wordt gebruikt (aanvullend bestand).
    3. Noteer de restrictie fragment grootte gemaakt door geselecteerde beperkings enzymen. Dit mag niet langer zijn dan 12 KB, omdat het mogelijk niet efficiënt wordt versterkt door PCR.

2. circulaire DNA-templates maken voor lange afstand inverse PCR

  1. DNA-extractie en kwaliteitsbeoordeling
    1. Extract genomisch DNA uit monsters (tumor of bloed) met behulp van in de handel verkrijgbare DNA-extractie kits die een goede kwaliteit, hoog moleculair gewicht DNA dat nodig is voor LDI-PCR, kunnen extraheren volgens de instructies van de fabrikant. Als alternatief kan een hoog moleculair gewicht DNA ook worden geëxtraheerd door fenol: chloroform20.
    2. Meet de DNA-concentratie met behulp van een fluor meter volgens de instructies van de fabrikant en voer 100 ng van het DNA uit op 1% (g/v) agarosegel met ethidiumbromide bromide (0,5 μg/mL) in 1x tris-acetaat-EDTA (TAE) buffer op 4,5 V/cm21 naast λ-HindIII DNA-molecuulgewicht markeringen om de DNA-kwaliteit en kwantiteit te controleren.
  2. Verteerd genomisch DNA
    1. Maak een digestieactiemix (eindvolume van 50 μL) door toevoeging van 20 eenheden SACI-restrictie enzym, 5 μL 10x-reactiebuffer (tabel met materialen), 100 ng van DNA (tot 44 ΜL) in een PCR-buis van 0,2 ml op ijs (1 μL restrictie-enzym van de meeste fabrikanten I s voldoende om 100 ng van genomisch DNA volledig te verteren). Meng de oplossing door de buis te flikken en centrifugeer kort.
    2. Gebruik een thermische cycler om de reactiemix bij 37 °C gedurende 1 uur te inbroed, gevolgd door een warmteafgifte bij 65 °C gedurende 5 minuten.
  3. Zelf-ligende het verteerde genomisch DNA
    1. Aan de digestie van 50 μL (na stap 2.2.2), voeg 8 μL 10x T4 DNA-ligase buffer, 1 μL (5 eenheden) van T4 DNA ligase en 21 μL ultrapuur water toe om een laatste reactievolume van 80 μL te maken. Meng de oplossing door de buizen te flikken en centrifugeer kort.
    2. Inincuberen in een thermische cycler gedurende 10 min bij 22 °C, eindigend met een warmte-activerings stap bij 65 °C gedurende 10 minuten.

3. interlokale inverse PCR

  1. Bepaling van de primer gloeien temperatuur met gradiënt PCR
    1. Stel een vergloeien temperatuurgradiënt van (A-4) °C, (A-2) °C, A, (A + 2) °C, (A + 4) °C in waarbij A de theoretische gloeien temperatuur is van het primer paar berekend met behulp van het webgebaseerde hulpmiddel van de commerciële leverancier.
      Opmerking: bij thermische fietsers van sommige fabrikanten is het mogelijk dat de temperatuurgradiënt niet handmatig wordt ingesteld. In dat geval kan de instelling voor automatische gradiënt worden gebruikt met een temperatuurbereik van (A-4) °C tot (A + 4) °C.
    2. Maak een Master mix voor de PCR door de volgende componenten te combineren en te mengen in een micro centrifugebuis van 1,5 mL: 4 μL 5x reactiebuffer, 0,4 μL van 10 mM dNTP, 5 μL PCR-primer (voorwaarts en omgekeerd, ontworpen in stap 1.3.1) , 0,2 μL (0,1 U) van de DNA-polymerase per reactie. Stel één reactie in voor elke gloeien temperatuur in het verloop.
    3. Voor elke reactie, aliquot 19 μL van de Master mix in 0,2 mL PCR-buisjes en voeg 1 μL (1,25 ng) van de circulaire DNA-template gemaakt in rubriek 2.
      Opmerking: gebruik circulair zelf-gebandeerd DNA dat wordt gegenereerd uit een normaal bloed-DNA als template om te voorkomen dat er potentieel kostbaar tumor-DNA wordt geconsumeerd voor deze optimalisatie stap.
    4. Voer een gradiënt PCR-programma uit op een thermische cycler zoals hieronder beschreven: (i) één cyclus van 3 min bij 98 °C (denaturatie); II) 35 cycli van (10 s bij 98 °C [denaturatie], 20 s bij de temperatuurgradiënt van [A-4] tot [A + 4] °C [gloeien] en 1 − 6 min [30 s per kilo basis van het verwachte PCR-product] bij 72 °C [uitbreiding]); (III) één cyclus van 10 min bij 72 °C (uiteindelijke verlenging).
    5. Voer 6 μL van het PCR-product uit in 1% agarose gel21 , bereid in 1x TAE buffer bij 4,5 V/cm en analyseer de PCR-producten die op verschillende gloeiings temperaturen zijn opgeleverd.
    6. Selecteer de gloeien temperatuur die een PCR-product oplevert dat overeenkomt met de verwachte grootte.
  2. Detectie van de Novo line-1 retrotransponerings activiteit in het tumor genoom
    1. Voer LDI-PCR uit met behulp van het inverse PCR-primer paar op circulaire DNA-templates gegenereerd uit tumormonsters (sectie 2). Volg dezelfde instructies als voor gradiënt PCR (paragraaf 3,1), maar dit keer de temperatuurgradiënt vervangen door de optimale gloeien temperatuur.
    2. Analyseer de PCR-producten door agarose gel elektroforese zoals gedaan in stap 3.1.5. PCR-product van bekende grootte of het "inheemse" PCR-product dat overeenkomt met de lijn-1 op zijn oorspronkelijke Locus, moet voor elke reactie zichtbaar zijn. De Novo LIJN-1 3 ́ transductie in het tumor monster is detecteerbaar als PCR-producten van verschillende groottes, samen met het inheemse PCR-product in de agarose-gel.

4. sequentiëren van LDI-PCR-producten om de identiteit van doellocaties voor lijn-1 3 ́ transductie te onthullen

  1. Voer een lange leesvolgorde van één molecuul uit van alle PCR-amplicons die in elke LDI-PCR-reactie worden gegenereerd om de doel integratie-sites van deze line-1 3 ́ transductie-gebeurtenissen te identificeren.
    Opmerking: klonen en Sanger-sequencing van de LDI-PCR-producten is ook een mogelijke, zij het omslachtige, aanpak.
  2. Uitlijnen van de leesbewerkingen die zijn geproduceerd door één-molecuul lang lezen sequentiëren platforms naar het referentie-genoom met behulp van standaardvolgorde uitlijning pijplijnen. Analyseer de uitgelijnde leesbewerkingen met behulp van LDI-PCR-software14 om de Novo line-1-inserties en de bijbehorende doellocaties te identificeren.

Representative Results

In het geval van TTC28-line-1 is er meer dan één pas binnen een 1 KB-venster stroomafwaarts van zijn verwant pas, vandaar dat de regio tussen de TTC28-line-1 pas en de sterkste pas op 811 BP stroomafwaarts werd beschouwd als de unieke tag voor TTC28-line-1. Drie inverse PCR-primer paren zijn ontworpen op deze unieke tag die overeenkomt met de verschillende pas aanwezig14. We selecteerden drie restrictie enzymen: (i) NSIi die 5 ́ stroomopwaarts van TTC28-line-1 en 3 ́ snijdt buiten de unieke tag, en (II) SACi en (III) psti die 5 ́ knippen in de lijn-1 in het verre 5 ́ uiteinde, en 3 ́ buiten de unieke tag. Deze genereren restrictie fragmenten van respectievelijk 10.288 BP, 5.699 BP en 6.305 BP.

Om deze methode aan te tonen, voerden we LDI-PCR uit op DNA geëxtraheerd uit MCF7 cellijn. Deze borstkanker cellijn is eerder gerapporteerd om TTC28-line-1 activiteit16weer te geven. Voor het gemak maakten we een circulaire DNA-template met behulp van één restrictie-enzym, SACI, uit drie en voerde een LDI-PCR uit met behulp van één primer paar uit drie (tabel 1) om de Novo line-1 inserties te detecteren die voortvloeien uit TTC28- LIJN-1.

Goede kwaliteit van DNA geëxtraheerd uit MCF7 cellijn werd verzekerd door agarose gel elektroforese (Figuur 2). Intact hoog moleculair gewicht DNA toont aan dat het genomisch DNA van optimale kwaliteit is voor deze test. Als in plaats daarvan een uitstrijkje zichtbaar is, duidt dit op een slechte kwaliteit van het geëxtraheerde DNA, wat op zijn beurt de downstream-procedures belemmert.

Figuur 3 toont een representatief resultaat van een GRADIËNT PCR-experiment, gericht op het bepalen van de optimale gloeien temperatuur van de TTC28-line-1 inverse primer pair. Bloed genomisch DNA verteerd met SACI, gevolgd door zelf-ligatie om een circulaire DNA-sjabloon te vormen, werd gebruikt voor deze reactie. Een zeer specifiek PCR-product van de verwachte grootte (5.649 BP) bij 62, 64 en 66 °C toont aan dat de optimale gloeien temperatuur voor dit primer paar binnen het bereik van 62 − 66 °C ligt.

We hebben een circulaire DNA-template gegenereerd door MCF7 genomisch DNA te verteerd met het SACI restrictie-enzym gevolgd door zelf-ligatie. Figuur 4 toont aan dat TTC28-line-1 3 ́ TRANSDUCTIE optreedt in MCF7 cellijnen: de Novo INSERTIES kunnen worden gedetecteerd als LDI-PCR-producten van verschillende GROOTTES, samen met een native PCR-product van bekende grootte (5.649 BP). Om genomische coördinaten van de de Novo target sites te identificeren, kan PCR amplicons worden gesequentieerd (zie protocol sectie 4).

Figure 1
Figuur 1 : Overzicht van LDI-PCR om lijn-1 3 ́ transductie te detecteren. Een circulaire DNA-template wordt gegenereerd door eerst verteerd (I) het met een restrictie-enzym en zelf-ligating (II) het. Deze stap wordt gevolgd door inverse PCR (III) met inverse PCR-primers die zijn gericht op de unieke tag van de lijn-1 van belang (volgorde tussen de zwakkere PAS van lijn 1's, in roze en sterkere PAS downstream, in rood). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 : Kwaliteitsbeoordeling van geëxtraheerd DNA. 100 ng van DNA geëxtraheerd uit de MCF7 cellijn en bloed van een normaal individu, dat zal worden gebruikt als een controlemonster, werden uitgevoerd langs 1 μL en 2 μL λ DNA/HindIII marker als M. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Verloop PCR om de optimale gloeien temperatuur voor inverse PCR-primers te bepalen (tabel 1). LDI-PCR met behulp van inverse primer paren bij gloeien temperatuur variërend van 56 tot 66 ° c toont een duidelijk PCR-product bij 62 − 66 °C. Groene pijl geeft de geselecteerde gloeien temperatuur voor toekomstige experimenten. Circulaire DNA-template gegenereerd door verteerd bloed genomisch DNA van een normaal individu met SACik gevolgd door zelf-ligatie werd gebruikt voor deze optimalisatie stap. M, marker (1 KB plus DNA-ladder). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 : LDI-PCR voor de identificatie van lijn-1 3 ́ transductie als gevolg van TTC28 -Line-1. Circulaire DNA-templates gegenereerd door verdichting MCF7 en bloed (van normaal individu) genomisch DNA met SACik gevolgd door zelf-ligatie werden versterkt door inverse primers in optimale gloeien temperatuur. "Native" PCR-product, gemarkeerd met een sterretje, van de verwachte grootte (5.649 BP) werd gedetecteerd in zowel MCF7 DNA als normaal bloed DNA, terwijl MCF7 ook aanvullende PCR-producten van verschillende groottes produceerde, die de Novo line-1 retrotransponering aangeven. M, marker (1 KB DNA ladder). Klik hier om een grotere versie van dit cijfer te bekijken.

Naam primer Sequentie (5 ́ → 3 ́)
L1_001 (rev) Een van de meest GEAAGDE
L1_002 (FWD) CCCAAAATATACCCAATTACTGGCA

Tabel 1: inverse PCR-primer paar ontworpen voor de unieke tag van TTC28 -Line-1 14 .

Aanvullend bestand. Klik hier om dit bestand te downloaden.

Discussion

Hier beschrijven we een methode die kan worden gebruikt om de Novo line-1 inserties te identificeren die voortvloeien uit elke actieve lijn-1 van belang. We hebben deze methode geoptimaliseerd voor een zeer actieve lijn-1, gelegen op 22q 12.1, en eerder aangetoond dat het zeer gevoelig zijn bij het opsporen van sub-klonale inserties in colorectale kanker14.

Succes van LDI-PCR is afhankelijk van de kwaliteit van het genomische DNA. Daarom hebben we een aanvullende kwaliteitscontrole stap opgenomen om ervoor te zorgen dat bij het begin van het protocol het DNA van hoog moleculair gewicht aanwezig is (stap 2.1.2). We raden aan om genomisch DNA bij-20 °C op te slaan voor lange termijn opslag, en om aliquots voor te bereiden om cycli van invriezen en ontdooien te voorkomen. Het gebruik van genomisch DNA uit bloed of door de patiënt overeenkomend normaal weefsel wordt ten zeerste aanbevolen om te onderscheiden of de waargenomen lijn-1 retrotransponering een kiembaan of een somatische gebeurtenis is. Aangezien cut-sites voor restrictie enzymen stochastisch zijn in het genoom, is het mogelijk dat een bepaalde de Novo line-1 insertion site geen snij plekken kan plaatsen voor het restrictie-enzym dat in zijn omgeving wordt gebruikt. Vandaar om de kans op het detecteren van de meerderheid van de Novo line-1 inserties in tumor DNA te verhogen, meer dan één restrictie enzym moet worden gebruikt in afzonderlijke reacties om verschillende bibliotheken van circulaire DNA-sjabloon te genereren. Bovendien, als de unieke tag van de lijn-1 van belang meer dan één PAS heeft, dan verbetert het gebruik van primer paren naast elk PAS de kans op het detecteren van zwaar afgeknotte transducties.

Hoewel er elegante methoden voor genoom-brede detectie van de Novo line-1 inserties bestaan, kunnen ze overweldigend zijn als het doel is om de competentie voor retrotransponering van een bepaalde lijn-1 in een specifieke cellulaire context te peilen. Voor dit doel kan LDI-PCR een goedkope en eenvoudige maar robuuste benadering zijn om lijn 1-retrotransponerings gebeurtenissen te visualiseren. De targetingbenadering die in deze methode wordt gebruikt, is vergelijkbaar met TS-ATLAS22; echter, LDI-PCR vermijdt het gebruik van linker oligonucleotiden en kan zowel 5 ́ en 3 ' kruispunten van de Novo line-1 insertion gelijktijdig versterken. Informatie over zowel 5 ́ als 3 ' knooppunten van de lijn-1 invoeging, de doelsite van integratie, polyA tail en target-site modificaties, die allemaal kenmerkend zijn voor lijn-1 retrotransponering, kan worden verkregen door koppeling LDI-PCR met enkelvoudig molecuul sequentiëren van lange leesvolgorde technologieën. Lange leest aldus gegenereerde bevatten de ingevoegde lijn-1 sequentie, de unieke tag en de doel sequenties in één enkele lezen, het omzeilen van moeilijkheden van het in kaart brengen van korte leesbewerkingen in de repetitieve regio.

Er zijn twee belangrijke beperkingen voor het gebruik van LDI-PCR voor detectie van lijn 1-activiteit. De eerste is inherent aan PCR: het kan alleen betrouwbaar versterken fragmenten tot 10 KB groot. Dit moet worden overwogen tijdens het selecteren van restrictie-enzym (s), omdat het oorspronkelijke fragment deze limiet niet mag overschrijden. Ten tweede kan deze methode alleen retrotransponerings gebeurtenissen detecteren die de 3 ́ flankerende regio van de lijn 1 door 3 ' transducties mobiliseren. Vandaar, activiteit van die lijn-1S die niet vertonen 3 ́ transductie zal niet worden gedetecteerd met behulp van deze methode. Bovendien, ondanks het feit dat ze worden versterkt door LDI-PCR, zijn sommige lijn-1 retrotransponerings gebeurtenissen die (a) een PCR-doel van vergelijkbare grootte als de "inheemse" locatie of andere retrotransposities genereren of (b) zeldzaam of subclonal zijn, niet te detecteren door agarose gel Elektroforese. Dergelijke LINE-1 retrotransponerings gebeurtenissen kunnen worden vastgelegd door de sequencing van het LDI-PCR-product met behulp van één molecuul met lange leesvolgorde technologieën14.

De hier beschreven workflow kan eenvoudig worden aangepast om de activiteit van andere "hot" LINE-1S te detecteren met behulp van een geschikt restrictie-enzym en door het ontwerpen van inverse primers die gericht zijn op deze lijn-1S. Naast de detectie van lijn-1 gemedieerde 3 ́ transductie, kan deze methode worden aangepast om minder frequente lijn-1 gemedieerde 5 ́ transductions23te detecteren. Vergelijkbare methode is gebruikt voor het identificeren van de integratie site van line-1 verslaggevers in cel gebaseerde assays24 en proviral integratie sites in Cancer25. Naast lijn-1 inserties, deze methode kan ook worden gebruikt voor het detecteren van andere genomische aberraties, zoals DNA-herschikking, waar informatie over de herschikkingen-gevoelige regio pre-bestaat26.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

We willen al onze medeauteurs bedanken in het artikel waarin deze methode voor het eerst werd beschreven14, vooral Tatiana Cajuso, Kimmo Palin, Outi Kilpivaara en ESA Pitkänen voor waardevolle discussies tijdens het ontwikkelen van de methode. L.K. wordt gefinancierd door de Academie van Finland (Grant nummers 25996, 292789, 306026 en 314394), de Sigrid Juselius Foundation en de Finse Kankervereniging. Hij is de ontvanger van het doctoraatsdiploma van de University of Helsinki Research Foundation, een proefschrift voor de Finse Kankervereniging en een promotieonderzoek van IDA Montinin Säätiö. We danken ook Teemu Masalin (Universiteit van Helsinki) en KUL Shrestha van L.K. Research Group om ons te helpen met de videoproductie.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics