Author Produced

Påvisning af tilbagevirkende aktivitet af Hot LINE-1s ved lang distance-inverse PCR

Cancer Research
 

Summary

Denne artikel skitserer en simpel PCR-baseret analyse til at overvåge aktiviteten af en aktiv linje-1 retroomsætning og til at kort de Novo retrogennem førelser i et givent genom. Ved hjælp af MCF7 Cell line, viser vi heri, hvordan denne metode kan anvendes til at detektere aktivitet af en linje-1 placeret på 22q 12.1.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pradhan, B., Kauppi, L. Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR. J. Vis. Exp. (149), e59880, doi:10.3791/59880 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lange spækket nukleare elementer 1 (linje-1s) er den eneste familie af mobile genetiske elementer i det menneskelige genom, der kan bevæge sig autonomt. De gør det ved en proces, der kaldes retrogennem førelse, hvori de transskribere til at danne en mRNA-mellemprodukt, som derefter indsættes i genomet ved omvendt transskription. På trods af at være tavs i normale celler, linje-1s er meget aktive i forskellige epiteliale tumorer. De Novo LINE-1 indsættelser kan potentielt drive tumorigenesis, og derfor er det vigtigt at systematisk studere linje-1 retrotransponering i kræft. Ud af ~ 150 retrotransponering-kompetent linje-1s til stede i det menneskelige genom, kun en håndfuld af linje-1 loci, også omtalt som "hot" linje-1s, tegner sig for størstedelen af de Novo line-1 indsættelse i forskellige kræfttyper. Vi har udviklet en simpel polymerase kædereaktion (PCR)-baseret metode til at overvåge retrotransponering aktivitet af disse hot LINE-1s. Denne metode, baseret på langdistance-inverse (LDI)-PCR, udnytter 3 ' transduktion, en mekanisme, hvormed en linje-1 mobiliserer sin ledsage ikke-repetitive region, som efterfølgende kan bruges til at identificere de Novo line-1 3 ́ transduktionshændelser stammer fra en bestemt varm linje-1.

Introduction

Lange spækket nukleare elementer (linje-1s) er en familie af mobile genetiske elementer kaldet retrotransposons, der selvstændigt kan flytte fra et sted til et andet via en Copy-and-paste mekanisme kaldet retrotransponering. Over evolutionær tid, det menneskelige genom har akkumuleret mere end 500.000 kopier af linje-1 gentager1. Men de fleste af de linje 1 eksemplarer, der findes i genomet, er muterede og kan derfor ikke bevæge sig gennem retrogennemførelse; kun ~ 150 kopier har intakt kopi af DNA-sekvens nødvendig for dem at flytte2. I normale somatiske celler er mobiliteten for disse linje-1s begrænset af forskellige værts faktorer3. Disse restriktioner er lettet i forskellige epiteliale tumorer, forårsager linje-1s at være derepresses og resulterer i mange de Novo indsættelser i tumor genom4. Nogle af disse tumor-associerede de Novo indsættelser har vist sig at forårsage af mutagenese i gener, dermed kørsel tumorprogression5,6. Derfor er det vigtigt at være i stand til at kort nye indsættelser i tumor genomet.

Eksisterende metoder til påvisning af de Novo line-1 indsættelser brug (1) hel-genom sekvensering tilgang4,7,8, hvor forskellige beregningsmæssige algoritmer bruges til at finde de Novo line-1 indsættelser fra WGS-data eller (2) næste generations sekvensering, der er rettet mod 3 ' ende af unge, potentielt aktive linje-1s9,10,11,12,13. Men at finde nye indsættelser blandt flere tusinde næsten identiske eksemplarer med disse metoder er langt fra trivielt, og udfordringen forværres yderligere af tumor heterogenitet og genomændringer forbundet med LINE-1 indsættelse4.

Undersøgelser ved hjælp af disse eksisterende metoder viste, at blot et par linje-1s tegner sig for størstedelen af de Novo line-1 indsættelser observeret i tumorer7,8. For at svare på, om en bestemt tumorprøve viser linje 1-aktivitet, er det derfor tilstrækkeligt at kort sætte retrotransponerings hændelser forårsaget af denne håndfuld meget aktive linje-1 loci. I denne artikel beskriver vi en simpel polymerase-kædereaktion (PCR)-baseret metode14 , der kan bruges til at overvåge aktiviteten af en bestemt linje-1 locus i den første intron af TTC28 genet på 22q 12.1, der er meget aktiv i kolorektal cancer 7 , 8. denne linje-1 locus vil blive omtalt som TTC28-line-1 i hele artiklen. Denne analyse identificerer specifikt de Novo line-1-retrotransponerings hændelser, der mobiliserer ikke-gentagne sekvenser på 3-flanken-regionen af kildelinjen-1 ved en mekanisme kaldet 3 ́ transduktion15. 3 ́ transduktion opstår på grund af den svage linje-1 polyadenylations signal (pas), der forårsager transkriptional maskineri til at springe den over og i stedet opsige transkriptionen på den stærkere pas downstream, og dermed fange den ledsage ikke-gentagne sekvens ( herefter benævnt "Unique tag"), som derefter indsættes i målet placering sammen med linje-1 sekvens. Philippe et al.16 viste for nylig, at forskellige celletyper kan udtrykke forskellige linje-1 loci. I lyset af denne konstatering, denne metode kan anvendes til at overvåge aktiviteten af de mest udtrykte linje-1, der mobiliserer deres unikke tag i kræfttype interesse.

Det første trin i LDI-PCR er fordøjelsen af genomisk DNA med et restriktionsenzym, der genererer et Begrænsnings fragment, der indeholder den linje-1, der er analyseret (her, TTC28-line-1) og dens unikke tag (figur 1). Fordøjet DNA er derefter cirkuleret af selv-ligation og PCR forstærket ved hjælp af inverse primere placeret inden for den unikke tag. Ved at gøre det, den fulde længde kildelinje-1 på sin "native" placering er altid forstærket og ved siden af det, afkom linje-1 indsættelser på forskellige Target loci indeholder den unikke tag vil også blive forstærket (figur 1), og dermed rapportering den pågældende linje 1.

Protocol

Denne forskning blev godkendt af bestyrelsen for institutions revision og det etiske udvalg på Helsinkis Universitets Hospital. Underskrevet informeret samtykke blev indhentet fra emnet for den blodprøve, der anvendes til at påvise denne protokol.

1. design af inverse primere og udvælgelse af begrænsnings enzymer (Bioinformatik)

  1. Bestemmelse af en linje 1-tilknyttet entydig kode
    1. Download den TTC28-line-1 SEKVENS i fasta format fra en linje-1 database, såsom L1Base17. L1base-ID'ET for TTC28-linje-1 er 135.
    2. Medtag 5 KB sekvens ledsage både 5 ́ og 3 ́ ender af linjen-1 sekvens og anmærke det i et tekstbehandlingsprogram.
      Bemærk: her er linje-1 ledsage sekvens kommenteret i brun skrifttype, og linje-1 sekvens er i grå skrifttype (supplerende fil).
    3. Indtast 1 kb sekvens nedstrøms for udvalgte linje-1's cognate PAS i en PAS forudsigelse værktøj såsom polyadq18 eller Dragon polya spotter19 og annotering alle polyadenylation signal i dette 1 kb vindue.
      Bemærk: Hvis der ikke er nogen PAS i 1 kb-vinduet, Søg efter PAS i næste 1 kb vindue nedstrøms. TTC28-line-1's egne svage pas er fremhævet i pink og alle de andre pas i 1 kb vindue nedstrøms er fremhævet med rødt (supplerende fil).
    4. Anmærk sekvensen mellem slutningen af linje-1's cognate PAS og den stærkeste PAS downstream som "Unique tag".
      Bemærk: "Unique tag" af TTC28-line-1 er fremhævet med gult (supplerende fil).
  2. Design af inverse primere
    1. Design inverse PCR primere ved at indtaste "Unique tag"-sekvensen i et webbaseret primer-design værktøj som primer 3 (http://bioinfo.UT.ee/primer3-0.4.0/) eller ncbi's primer-blast (https://www.NCBI.NLM.NIH.gov/Tools/primer-blast/). Da primer-par designet af disse værktøjer står over for hinanden og letter konventionel PCR, skal du bruge den omvendte komplement funktion for primer pair til at udføre inverse PCR.
      Bemærk: da linje 1 transducere er stærkt afkortet ved deres 5 ' ende, og størrelsen af den transducerede region er meget variabel, har til formål at holde afstanden mellem de to inverse primere minimal, ved at indstille "PCR produkt længde" parameter i NCBI primer-blast til Minimum. I tilfælde af flere PAS inden for det unikke tag, designe flere primer par, der svarer til forskellige PASs. Design primere tæt på pas, som linje-1 indsættelser initierer fra 3 ́enden af RNA-mellem produktet og 5 ' enden er trinløst afkortet. Her blev tre primer par designet, fremhævet i Teal og grøn, svarende til tre stærke polyadenylations signaler i det unikke tag af TTC28 line-1 (supplerende fil).
  3. Valg af begrænsnings enzymer
    1. Fordøje linjen-1 sekvens sammen med dens 5 KB upstream og downstream flanker i silico ved hjælp af web-baseret værktøj såsom restrictionmapper. Dette vil give en omfattende liste over restriktionsenzymer, der fordøjer denne region, genererer forskellige begrænsnings fragmenter.
    2. Vælg restriktionsenzymer, der skærer den indfødte locus af linje-1 som følger: ved 5 ' enden, enten opstrøms for LINJEN-1 's 5 ́end eller langt 5 ́enden af LINJEN-1 selv, og ved 3 ' enden, nedstrøms for LINE-1's unikke tag.
      Bemærk: det valgte restriktionsenzym bør være ufølsomt over for DNA-methylering, bør være varme-inaktiverbar, og bør generere forskudt "klæbrig" ender, der supplerer hinanden. For at demonstrere LDI-PCR anvendes SACi restriktions enzymet, der skærer DNA på gagctc-steder, der er fremhævet her i lysegrøn, (supplerende fil).
    3. Vær opmærksom på begrænsningen fragment størrelse lavet af udvalgte restriktionsenzymer. Dette bør ikke være længere end 12 KB, da det måske ikke effektivt forstærkes af PCR.

2. lave cirkulære DNA-skabeloner til langdistance-inverse PCR

  1. DNA-udvinding og kvalitetsvurdering
    1. Uddrag genomisk DNA fra prøver (tumor eller blod) ved hjælp af kommercielt tilgængelige DNA ekstraktions kits, der kan udtrække god kvalitet, høj molekylvægt DNA nødvendig for LDI-PCR i henhold til producentens anvisninger. Alternativt kan høj molekylvægt DNA også udvindes af phenol: chloroform20.
    2. DNA-koncentrationen måles ved hjælp af et fluorometer i henhold til fabrikantens anvisninger, og der køres 100 ng DNA på 1% (w/v) agopstået gel indeholdende ethidium bromid (0,5 μg/mL) i 1x Tris-acetat-EDTA (TAE) buffer ved 4,5 V/cm21 sammen med λ-HindIII DNA molekylvægt markører til at kontrollere DNA-kvalitet og kvantitet.
  2. Fordøje genomisk DNA
    1. Lav en nedbrydnings reaktionsblanding (slutvolumen på 50 μL) ved at tilføje 20 enheder SACi restriktionsenzym, 5 μl 10x reaktionsbuffer (tabel over materialer), 100 ng af DNA (op til 44 μL) i et 0,2 ml PCR-rør på is (1 μl restriktionsenzym fra de fleste producenter i s tilstrækkelig til fuldstændigt at fordøje 100 ng af genomisk DNA). Bland opløsningen ved at fslikke røret og centrifugeres kortvarigt.
    2. Brug en termisk variator til at inkubere reaktionsblandingen ved 37 °c i 1 time efterfulgt af varme inaktivering ved 65 °c i 5 min.
  3. Selv-ligating den fordøjet genomisk DNA
    1. Til 50 μl nedbrydnings blanding (efter trin 2.2.2) tilsættes 8 μl 10x T4 DNA-ligasebuffer, 1 μl (5 enheder) T4-DNA-ubiquitinligase og 21 μl ultrarent vand for at fremstille en endelig reaktions volumen på 80 μl. Bland opløsningen ved at svirpe rørene , og centrifugeres kortvarigt.
    2. Der inkubates i en termisk variator ved 22 °c i 10 minutter, og der afsluttes med et varme inaktiverings trin ved 65 °c i 10 min.

3. langdistance-inverse PCR

  1. Bestemmelse af primer udglødning temperatur ved gradient PCR
    1. Indstil en udglødnings temperaturgradient på (A-4) °C, (A-2) °C, A, (A + 2) °C, (A + 4) °C, hvor A er den teoretiske udglødnings temperatur for primer-parret beregnet ved hjælp af den kommercielle leverandørs webbaserede værktøj.
      Bemærk: termiske cyclere fra nogle producenter kan ikke tillade indstilling af temperaturgradient manuelt. I så fald kan den automatiske gradient indstilling anvendes med et temperaturområde på (A-4) °C til (A + 4) °C.
    2. Forbered en masterblanding til PCR ved at kombinere og blande følgende komponenter i et 1,5 mL mikrocentrifuge glas: 4 μL 5x reaktionsbuffer, 0,4 μL 10 mM dNTP, 5 μL 2 μM PCR primer (frem og tilbage, designet i trin 1.3.1) , 0,2 μL (0,1 U) af DNA-Polymerase pr. reaktion. Indstil én reaktion for hver udglødnings temperatur i forløbet.
    3. For hver reaktion, alikvot 19 μl af masterblandingen i 0,2 ml PCR-rør og tilsættes 1 μl (1,25 ng) af cirkulær DNA-skabelon i punkt 2.
      Bemærk: Brug cirkulær selv-ligeret DNA genereret fra normale blod-DNA som skabelon for at undgå forbrugende potentielt dyrebare tumor DNA for denne optimering trin.
    4. Kør gradient PCR program på en termisk variator som beskrevet nedenfor: (i) en cyklus på 3 min ved 98 °c (denaturering); II) 35 cyklusser af (10 s ved 98 °C [denaturering], 20 s ved temperaturgradient på [A-4] til [A + 4] °C [annealing] og 1 − 6 min [30 s pr. kilo base af forventet PCR-produkt] ved 72 °C [udvidelse]); III) en cyklus på 10 min. ved 72 °C (endelig forlængelse).
    5. Kør 6 μl af PCR-produktet i 1% agopstået gel21 fremstillet i 1x Tae buffer ved 4,5 V/cm og analysér PCR-produkterne givet ved forskellige udglødning temperaturer.
    6. Vælg den udglødnings temperatur, der giver et PCR-produkt, der svarer til den forventede størrelse.
  2. Påvisning af de Novo linje-1 retrotransponerings aktivitet i tumor genomet
    1. Udfør LDI-PCR ved hjælp af det inverse PCR-primer-par på cirkulære DNA-skabeloner genereret fra tumorprøver (afsnit 2). Følg samme anvisninger som for gradient PCR (afsnit 3,1), men denne gang erstatter temperaturgradienten med den optimale udglødnings temperatur.
    2. Analysér PCR-produkterne ved agrose gel elektroforese som udført i trin 3.1.5. PCR-produkt af kendt størrelse eller det "native" PCR-produkt, der svarer til linje 1 på dets oprindelige locus, skal være synligt for hver reaktion. De Novo LINE-1 3 ́ transduktion i tumor prøven er detekterbar som PCR-produkter i forskellige størrelser sammen med det oprindelige PCR-produkt i agrose-gelen.

4. sekvensering af LDI-PCR-produkter for at afsløre identiteten af mållokaliteter for linje-1 3 ́ transduktion

  1. Udfør enkelt-molekyle lang læsning sekvensering af alle PCR amplikoner genereret i hver LDI-PCR reaktion for at identificere de mål integration sites af disse linje-1 3 ́ transduktionshændelser.
    Bemærk: kloning og sanger sekvensering af LDI-PCR-produkterne er også en mulig, omend besværlig, tilgang.
  2. Juster de læsninger, der produceres af et enkelt molekyle Long Read sekventering-platforme, til reference genomet ved hjælp af standard sekvens justerings pipelines. Analysér de justerede læsninger ved hjælp af LDI-PCR-software14 for at identificere de Novo line-1-indsættelser og dens målsites.

Representative Results

I tilfælde af TTC28-line-1, der er mere end én pas inden for en 1 kb vindue nedstrøms for sin cognate pas, derfor regionen mellem TTC28-line-1 pas og stærkeste pas på 811 BP downstream blev betragtet som den unikke tag for TTC28-line-1. Tre inverse PCR-primer-par blev designet på dette unikke tag, der svarer til forskellige PASs present14. Vi valgte tre restriktionsenzymer: (i) NSIi, der skærer 5 ́ upstream af TTC28-line-1 og 3 ́ uden for det unikke tag, og (II) SACi og (III) PSTi, der skærer 5 ́ inden for linjen-1 i sin langt 5 ' ende, og 3 ́ uden for det unikke tag. Disse genererer begrænsnings fragmenter af henholdsvis 10.288 BP, 5.699 BP og 6.305 BP.

For at demonstrere denne metode udførte vi LDI-PCR på DNA udvundet fra MCF7 cellelinje. Denne brystkræft cellelinje er tidligere blevet rapporteret til at vise TTC28-line-1 aktivitet16. For nemheds skyld lavede vi en cirkulær DNA-skabelon ved hjælp af et restriktionsenzym, SACI, ud af tre og udførte en LDI-PCR ved hjælp af et primer-par ud af tre (tabel 1) for at detektere de Novo line-1-indsættelser, der stammer fra TTC28- LINJE-1.

God kvalitet af DNA udvundet fra MCF7 cellelinje blev sikret ved agrose gel elektroforese (figur 2). Intakt høj molekylvægt DNA viser, at genomisk DNA er af optimal kvalitet til denne analyse. Hvis en smøre er synlig i stedet, dette indikerer dårlig kvalitet af den ekstraherede DNA, som igen vil hæmme downstream procedurer.

Figur 3 viser et repræsentativt resultat af et GRADUERINGS PCR-eksperiment, der tager sigte på at bestemme den optimale udglødnings temperatur for TTC28-line-1 inverse primer-parret. Blod genomisk DNA fordøjet med SACi, efterfulgt af selv-ligation at danne en cirkulær DNA-skabelon, blev brugt til denne reaktion. Et meget specifikt PCR-produkt af forventet størrelse (5.649 BP) ved 62, 64 og 66 °C viser, at den optimale udglødnings temperatur for dette primer-par ligger inden for intervallet 62 − 66 °C.

Vi genererede en cirkulær DNA-skabelon ved at fordøje MCF7 genomisk DNA med SACi restriktions enzymet efterfulgt af selv ligering. Figur 4 viser, at TTC28-line-1 3 ́ transduktion forekommer i MCF7 cellelinjer: de Novo indsættelser kan DETEKTERES som LDI-PCR produkter af varierende størrelser sammen med en Native PCR produkt af kendte størrelse (5.649 BP). For at identificere genomkoordinaterne for de Novo målstederne kan PCR amplikoner sorteres (Se protokol afsnit 4).

Figure 1
Figur 1 : Oversigt over LDI-PCR til påvisning af linje-1 3 ́ transduktion. En cirkulær DNA-skabelon genereres ved først at fordøje (I) det med en restriktion enzym og selv-ligating (II) det. Dette trin efterfølges af inverse PCR (III) med inverse PCR-primere, der er målrettet mod den entydige kode for linje 1 af interesse (sekvens mellem linje-1's egne svagere pas, i pink og stærkere pas nedstrøms, i rødt). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Kvalitetsvurdering af UDVUNDET DNA. 100 ng af DNA ekstraheret fra MCF7 cellelinje og blod fra en normal person, som vil blive anvendt som en kontrolprøve, blev kørt sammen med 1 μL og 2 μL λ DNA/HindIII markør mærket som M. Klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Gradient PCR til bestemmelse af optimal udglødnings temperatur for inverse PCR-primere (tabel 1). LDI-PCR med inverse primer-par ved udglødnings temperatur fra 56 til 66 °C viser et særskilt PCR-produkt ved 62 − 66 °C. Grøn pil angiver den valgte udglødnings temperatur til fremtidige eksperimenter. Cirkulær DNA skabelon genereret ved at fordøje blod genomisk DNA fra en normal person med SACjeg efterfulgt af selv-ligation blev brugt til denne optimering trin. M, markør (1 kb plus DNA-stigen). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : LDI-PCR for at identificere linje-1 3 ́ transduktion som følge TTC28 -Line-1. Cirkulære DNA-skabeloner genereret ved at fordøje MCF7 og blod (fra normal individ) genomisk DNA med SACi efterfulgt af selv ligation blev forstærket af inverse primere i optimal udglødnings temperatur. "Native" PCR produkt, mærket med Asterisk, af forventet størrelse (5.649 BP) blev påvist i både MCF7 DNA og normal blod DNA, mens MCF7 også produceret yderligere PCR produkter af varierende størrelser, hvilket indikerer de Novo linje-1 retrotransponering. M, markør (1 kb DNA-stige). Venligst klik her for at se en større version af dette tal.

Primer-navn Sekvens (5 ́ → 3 ́)
L1_001 (rev) TTCACTAAGCATGTATGTGGAAAAC
L1_002 (FWD) CCCAAAATATACCCAATTACTGGCA

Tabel 1: invers PCR primer-par, der er designet til det unikke tag TTC28 -Line-1 14 .

Supplerende fil. Venligst klik her for at downloade denne fil.

Discussion

Her beskriver vi en metode, der kan bruges til at identificere de Novo line-1 indsættelser stammer fra enhver aktiv linje-1 af interesse. Vi har optimeret denne metode til en meget aktiv linje-1, placeret på 22q 12.1, og tidligere viste det at være meget følsom i påvisning sub-Clonal indsættelse i kolorektal cancer14.

LDI-PCR-succesen afhænger af kvaliteten af genomisk DNA. Derfor har vi inkluderet et ekstra kvalitetskontrol trin for at sikre, at der ved protokollens begyndelse findes højmolekyl vægt-DNA (trin 2.1.2). Vi anbefaler at opbevare genomisk DNA ved-20 °C ved langtidsopbevaring og at tilberede aliquoter for at undgå cyklusser med frysning og optøning. Ved hjælp af genomisk DNA fra blod eller patient-matchede normale væv anbefales stærkt at skelne, om den linje-1 retrotransponering opdaget er en kimcelle eller en somatisk begivenhed. Da cut steder for restriktionsenzymer er stokastiske i genomet, er det muligt, at en bestemt de Novo line-1 indsættelse site måske ikke havn nogen cut steder for restriktions enzymet, der anvendes i dets nærhed. Derfor at øge sandsynligheden for påvisning af størstedelen af de Novo line-1 indsættelser i tumor DNA, mere end ét restriktionsenzym bør anvendes i separate reaktioner til at generere forskellige biblioteker af cirkulære DNA-skabelon. Desuden, hvis den unikke tag af LINJEN-1 af interesse har mere end én PAS, derefter ved hjælp af primer par støder op til hver PAS forbedrer chancerne for at opdage stærkt trunkerede transducinger.

Selv om der findes elegante metoder til Genome-dækkende detektion af de Novo line-1-indsættelser, kan de være overvældende, hvis målet er at afprøve en bestemt linje-1 i en specifik cellekontekst. Til dette formål kan LDI-PCR være en billig og enkel, men robust tilgang til at visualisere linje 1-retrotransponerings hændelser. Den målretningsmetode, der anvendes i denne metode, svarer til TS-ATLAS22. LDI-PCR undgår dog at bruge link-oligonukleotider og kan forstærke både 5 og 3 '-kryds af de Novo line-1-indsætningen samtidigt. Oplysninger om både 5-og 3-vejkryds af linje 1-indsættelse, destinationsstedet for integration, polyA-hale og ændringer på målstedet, som alle er kendetegnende for linje 1-retrogennemførelse, kan opnås ved at koble LDI-PCR med et enkelt molekyle lang læse sekvensering teknologier. Lange læsninger således genereret indeholder den indsatte linje-1 sekvens, dens unikke tag og målsekvenser i en enkelt læse, omgåelse vanskeligheder med kort læsninger i den repetitive region.

Der er to store begrænsninger ved at bruge LDI-PCR til påvisning af linje 1-aktivitet. Den første er iboende til PCR: det kan kun pålideligt forstærke fragmenter op til 10 KB i størrelse. Dette bør overvejes, når der vælges begrænsnings enzym (er), da det oprindelige fragment ikke bør overskride denne grænse. For det andet, denne metode kan kun afsløre retrotransponering begivenheder, der mobiliserer linje-1's 3 ́ ledsage region ved 3 ́ transducinger. Derfor, aktivitet af disse linje-1s, der ikke udviser 3 ́ transduktion vil ikke blive opdaget ved hjælp af denne metode. På trods af at det forstærkes af LDI-PCR, kan nogle linje-1-retrotransponerings hændelser, der (a) genererer et PCR-mål af samme størrelse som "native"-placeringen eller andre retrogennemførelsespositioner eller (b) er sjældne eller subklonale, ikke påvises af agrose gel Elektroforese. Sådanne linje-1-retrotransponerings hændelser kan registreres ved at sekvense LDI-PCR-produktet ved hjælp af et enkelt molekyle lang læse sekvensering af teknologier14.

Arbejdsprocessen, der er beskrevet her, kan let ændres for at registrere aktiviteten af andre "hot" line-1s ved hjælp af et egnet begrænsnings enzym og ved at designe inverse primere, der er målrettet mod disse linje-1s. Ud over påvisning af linje 1-medieret 3 ́-transduktion kan denne metode tilpasses til at detektere mindre hyppige linje 1-medierede 5 ́-transducinger23. Lignende metode er blevet brugt til at identificere integrationen site af LINE-1 reportere i celle-baserede assays24 og proviral integration sites i Cancer25. Udover linje-1 indsættelser, denne metode kan også udnyttes til at opdage andre genomiske aberrationer, såsom DNA rearrangeringer, hvor oplysninger om omorganisering-tilbøjelige region præ-eksisterer26.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi vil gerne takke alle vores medforfattere i artiklen, hvor denne metode blev først beskrevet14, især Tatiana Cajuso, Kimmo Palin, Outi Kilpivaara og ESA Pitkänen for værdifulde diskussioner under udviklingen af metoden. L.K. er finansieret af Finlands Akademi (tilskudsnummer 25996, 292789, 306026 og 314394), Sigrid Juselius Foundation og det finske Cancer selskab. B.P. er modtager af universitetet i Helsinki Research Foundation ph. d. Studentship, en finsk Cancer Society afhandling Grant, og en doktor forskning tilskud fra Ida Montinin Säätiö. Vi takker også Teemu Masalin (University of Helsinki) og kul Shrestha fra L.K. forskergruppe for at hjælpe os med video produktion.

Materials

Name Company Catalog Number Comments
1 Kb DNA Ladder New England Biolabs N3232L
10 mM dNTP ThermoFisher Scientific 18427013
Acetic acid ThermoFisher Scientific 64-19-7 Used to make TAE buffer
Agarose BioNordika BN-50004
Blood sample (frozen) Blood sample from a healthy individual for control PCR
ChemiDoc XRS+ System Bio-rad 1708265
DNA Gel Loading Dye (6X) ThermoFisher Scientific R0611
DNeasy Blood & Tissue Kits Qiagen 69504
Ethidium Bromide Bio-rad 161-0433
Ethylenediaminetetraacetic acid (EDTA) ThermoFisher Scientific 25102-12-9 Used to make TAE buffer
FastDigest buffer ThermoFisher Scientific B64
FastDigest SacI ThermoFisher Scientific FD1133
Generuler 1 Kb plus DNA Ladder ThermoFisher Scientific SM1331
Generuler Lambda DNA/HindIII Marker, 2 ThermoFisher Scientific SM0103
Mini-Sub Cell GT Cell Bio-rad 1704406
Phusion Green Hot Start II High-Fidelity DNA Polymerase ThermoFisher Scientific F537L
PowerPac Basic Power Supply Bio-rad 1645050
Quantus Fluorometer Promega E6150
T4 DNA Ligase ThermoFisher Scientific EL0011
Tear-A-Way 96/8, 96 Well PCR Plate 4titude 4ti-0750/TA
Tris(hydroxymethyl)aminomethane ThermoFisher Scientific 77-86-1 Used to make TAE buffer
Veriti Thermal Cycler Applied Bioscience 4375786

DOWNLOAD MATERIALS LIST

References

  1. Lander, E. S., et al. Initial sequencing and analysis of the human genome. Nature. 409, (6822), 860-921 (2001).
  2. Brouha, B., et al. Hot LINE-1s account for the bulk of retrotransposition in the human population. Proceedings of the National Academy of Sciences of the United States of America. 100, (9), 5280-5285 (2003).
  3. Goodier, J. L. Restricting retrotransposons: a review. Mobile DNA. 7, 16 (2016).
  4. Lee, E., et al. Landscape of somatic retrotransposition in human cancers. Science. 337, (6097), 967-971 (2012).
  5. Miki, Y., et al. Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer. Cancer Research. 52, (3), 643-645 (1992).
  6. Scott, E. C., et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Research. 26, (6), 745-755 (2016).
  7. Pitkanen, E., et al. Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer. Oncotarget. 5, (3), 853-859 (2014).
  8. Tubio, J. M., et al. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes. Science. 345, (6196), 1251343 (2014).
  9. Badge, R. M., Alisch, R. S., Moran, J. V. ATLAS: a system to selectively identify human-specific L1 insertions. American Journal of Human Genetics. 72, (4), 823-838 (2003).
  10. Rodic, N., et al. Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma. Nature Medicine. 21, (9), 1060-1064 (2015).
  11. Ewing, A. D., Kazazian, H. H. Jr High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes. Genome Research. 20, (9), 1262-1270 (2010).
  12. Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans. Methods in Molecular Biology. 1400, 47-77 (2016).
  13. Zhao, B., et al. Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals. PLOS Genetics. 15, (4), e1008043 (2019).
  14. Pradhan, B., et al. Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing. Scientific Reports. 7, (1), 14521 (2017).
  15. Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. Jr Exon shuffling by L1 retrotransposition. Science. 283, (5407), 1530-1534 (1999).
  16. Philippe, C., et al. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci. Elife. 5, (2016).
  17. Penzkofer, T., et al. L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Research. 45, (D1), D68-D73 (2017).
  18. Tabaska, J. E., Zhang, M. Q. Detection of polyadenylation signals in human DNA sequences. Gene. 231, (1-2), 77-86 (1999).
  19. Kalkatawi, M., et al. Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences. Bioinformatics. 29, (11), 1484 (2013).
  20. Sambrook, J., Russell, D. W. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harbor Protocols. 2006, (1), (2006).
  21. Green, M. R., Sambrook, J. Agarose Gel Electrophoresis. Cold Spring Harbor Protocols. 2019, (1), (2019).
  22. Macfarlane, C. M., et al. Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations. Human Mutation. 34, (7), 974-985 (2013).
  23. Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. LINE-1 elements in structural variation and disease. Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).
  24. Morrish, T. A., et al. DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nature Genetics. 31, (2), 159-165 (2002).
  25. Li, J., et al. Leukaemia disease genes: large-scale cloning and pathway predictions. Nature Genetics. 23, (3), 348-353 (1999).
  26. Pradhan, B., et al. Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR. Genes, Chromosomes and Cancer. 55, (3), 215-226 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics