मानव स्टेम सेल व्युत्पन्न Ileal Enteroid Monolayers में एम सेल की तरह कोशिकाओं के प्रेरित भेदभाव

Immunology and Infection
 

Summary

इस प्रोटोकॉल का वर्णन कैसे मानव स्टेम सेल व्युत्पन्न ileal monolayers और उनके विकास का आकलन करने के लिए तरीकों में एम कोशिकाओं के भेदभाव प्रेरित करने के लिए.

Cite this Article

Copy Citation | Download Citations

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

आंत के एम (माइक्रोफोल्ड) कोशिकाओं को शीर्ष लुमेन से अंतर्निहित पेयर के पैच और लेमिना प्रोप्रिया में एंटीजन के परिवहन के लिए कार्य करता है जहां प्रतिरक्षा कोशिकाएं रहती हैं और इसलिए आंत में म्यूकोसल प्रतिरक्षा में योगदान देती हैं। एम कोशिकाओं आंत में अंतर के रूप में के रूप में अच्छी तरह से एम कोशिकाओं द्वारा प्रतिजन तेज के आणविक तंत्र की एक पूरी समझ की कमी है. इसका कारण यह है कि एम कोशिकाओं आंत में कोशिकाओं की एक दुर्लभ आबादी है और क्योंकि एम कोशिकाओं के लिए इन विट्रो मॉडल मजबूत नहीं हैं. आंत के एक आत्म नवीनीकरण स्टेम सेल संस्कृति प्रणाली की खोज, enteroids कहा जाता है, एम कोशिकाओं culturing के लिए नई संभावनाएं प्रदान की गई है. Enteroids मानक सुसंस्कृत सेल लाइनों पर फायदेमंद होते हैं क्योंकि उन्हें आंत में पाए जाने वाले कई प्रमुख सेल प्रकारों में विभेदित किया जा सकता है, जिसमें गोब्लेट कोशिकाएं, पैनेथ सेल, आंत्रअंती कोशिकाएं और आंत्रसाइट्स शामिल हैं। साइटोकिन RANKL एम सेल विकास में आवश्यक है, और RANKL और TNF-जेड के अलावा संस्कृति मीडिया के लिए एम कोशिकाओं में अंतर करने के लिए ileal enteroids से कोशिकाओं के एक सबसेट को बढ़ावा देता है. निम्नलिखित प्रोटोकॉल मानव ileal enteroids का उपयोग कर आंत के एक ट्रांसवेल उपकला polarized मोनोलेयर प्रणाली में एम कोशिकाओं के भेदभाव के लिए एक विधि का वर्णन करता है। इस विधि एम सेल विकास और समारोह के अध्ययन के लिए लागू किया जा सकता है.

Introduction

एम (माइक्रोफोल्ड) कोशिकाओं को मुख्य रूप से आंत से जुड़े उपकला (एफएई) में पाए जाने वाले विशेष आंत उपकला कोशिकाओं को आंत के अति-लीइंग छोटे लसीकाभ क्षेत्रों में पाया जाता है जिसे पीयर के पैच1कहा जाता है। एम कोशिकाओं में कम अनियमित शीर्ष माइक्रोविली होते हैं और उनके बासोपार्श्व पक्ष पर गहराई से अंतर्वेधित होते हैं, जो प्रतिरक्षा कोशिकाओं को उनके कोशिका शरीर2के निकट रहने की अनुमति देता है। यह अद्वितीय आकृति विज्ञान एम कोशिकाओं को आंत के शीर्ष लुमेन से प्रतिजन का नमूना लेने में सक्षम बनाता है और इसे सीधे अंतर्निहित प्रतिरक्षा कोशिकाओं को वितरित करताहै 2. इस तरह, एम कोशिकाओं आंत में प्रतिरक्षा निगरानी के लिए महत्वपूर्ण हैं, लेकिन यह भी lamina प्रोप्रिया1,2,3,4,5में प्रवेश के लिए रोगजनकों द्वारा शोषण किया जा सकता है, 6,7.

एम कोशिकाओं के अध्ययन में कई कारकों द्वारा बाधा डाल दी गई है। सबसे पहले, एम कोशिकाओं माउस और मानव आंत8में एक कम आवृत्ति पर पाए जाते हैं। सुसंस्कृत कोशिकाओं प्रणालियों में, एम सेल की तरह कोशिकाओं को एक polarized एडेनोकार्सीनोमा सेल लाइन, Caco-2, या तो बी लिम्फोसाइटों के साथ माउस Peyer के पैच या बी सेल लिंफोमा सेल लाइन, रजी बी9,10 के सह-कुलिंग द्वारा अंतर करने के लिए प्रेरित किया गया है . इसका परिणाम यह होता है कि कैको-2 कोशिकाओं के एक सबसेट में जो एम सेल मार्कर सियाल लुईस ए एंटीजन और यूए-1 को ध्रुवित उपकला9,10में व्यक्त करते हैं . (इन मार्करों भी आंतों के ऊतकों में goblet कोशिकाओं पर व्यक्त कर रहे हैं, तो आजकल कम बार निश्चित एम सेल मार्करों11के रूप में उपयोग किया जाता है,12.) इस कैको-2-एम कोशिका प्रणाली का उपयोग कण-अपटेक तथा जीवाणु स्थानांतरण13,14का अध्ययन करने के लिए किया गया है। हालांकि, Caco-2 कोशिकाओं को एक बड़ी आंत्र एडेनोकार्सीनोमा से एक स्थापित सेल लाइन confounding कारक है कि Caco-2 कोशिकाओं के विभिन्न स्रोतों प्रयोगशालाओं के बीच विभिन्न phenotypes प्रदर्शित15के साथ कर रहे हैं. इसके अलावा, वे पूरी तरह से सच एम कोशिकाओं के प्रतिलेखन के स्तर recapitulate नहीं हो सकता है, क्योंकि वे वर्तमान में जाना जाता एम सेल मार्करों GP2 और SpiB16की अभिव्यक्ति की कमी है. इसलिए, अतिरिक्त और अधिक शारीरिक रूप से प्रासंगिक संस्कृति मॉडल एम सेल विकास और कार्यों का अध्ययन करने में सक्षम होने की जरूरत है.

पिछले दस वर्षों के भीतर, आंत के enteroid व्युत्पन्न मॉडल प्रणालियों के क्षेत्र में तेजी से प्रारंभिक खोज से आगे बढ़ रहा है कि आंतों स्टेम कोशिकाओं मानव आंतों बायोप्सी से व्युत्पन्न स्वयं को प्रचार और संस्कृति में स्वयं को नवीनीकृत कर सकता है 17 , 18. महत्वपूर्ण बात यह है कि विकास मीडिया से स्टेम सेल को बढ़ावा देने वाले कारकों को हटाने से इन स्टेम सेल संस्कृतियों को आंत में पाए जाने वाले कई कोशिकाओं में अंतर करने की अनुमति मिलतीहै . इसके अलावा, हाल के कार्य से पता चलता है कि आंत19,20में एम सेल विकास में RANKL-RANK संकेतन के महत्व को दर्शाता है। RANK रिसेप्टर रिसेप्टर्स के TNF परिवार का एक सदस्य है कि आंत में उपकला अग्रदूत कोशिकाओं पर व्यक्त किया जाता है19 जबकि RANKL (रैंक रिसेप्टर ligand) Peyer पैच20के stromal कोशिकाओं द्वारा जारी किया जाता है. चूँकि इलेल एंटरोइड्स में विद्यमान उपकला कोशिका प्रकार RANKL का उत्पादन नहीं करते हैं, इसलिए ऐलेल एंटरोइड संस्कृतियों में एम सेल विभेदन को संस्कृति माध्यम21,22में RANKL के योग द्वारा प्रेरित किया जा सकता है । संस्कृति मीडिया में टी एन एफ जेड को शामिल करने से एम सेल विकास को ileal enteroids23में समर्थन करने में मदद मिलती है. यहाँ, हम मानव ileal enteroids से व्युत्पन्न आंतों monolayers में एम कोशिकाओं के भेदभाव को प्रेरित करने के लिए तरीकों का वर्णन. हमारे तरीके निम्नलिखित प्रोटोकॉल21,22,23के संशोधनों पर आंशिक रूप से आधारित हैं .

Protocol

यहाँ वर्णित सभी तरीकों Tufts विश्वविद्यालय आईबीसी और आईआरबी द्वारा अनुमोदित किया गया है.

1. मानव इलेअल एंटरॉइड व्युत्पन्न मोनोलेयर्स में एम सेल भेदभाव को प्रेरित करना

नोट: इस प्रोटोकॉल मानव ऊतक बायोप्सी से व्युत्पन्न ileal enteroids का उपयोग करता है. कृपया इन कोशिकाओं के विकास और मार्ग के बारे में विधियों के लिए प्रकाशित प्रोटोकॉल देखें18,24. मोनोलेयर्स विकसित करने के लिए निम्नलिखित विधियों को ज़ू एट अल24से अनुकूलित किया गया था . इलेल एंटरोइड व्युत्पन्न संस्कृतियों में एम कोशिकाओं को प्रेरित करने के तरीके पिछली रिपोर्ट21,22,23से अनुकूलित किए गए थे . सभी काम एक बाँझ ऊतक संस्कृति हुड में किया जाता है और इनक्यूबेशन हुड या ऊतक संस्कृति इनक्यूबेटर में हैं जैसा कि संकेत दिया गया है। ileal enteroid monolayers और विभिन्न medias तैयार करने के लिए आवश्यक सामग्री की तालिका देखें.

  1. अतिकोशिकीय मैट्रिक्स (ईसीएम) में 4-10 दिनों के लिए ileal enteroids उगाएँ (सामग्री की तालिकादेखें ) (चित्र 1), उनके आंतरिक वृद्धि दर पर निर्भर करता है, transwells पर बोने से पहले.
  2. कोटिंग ट्रांसवेल झिल्ली
    1. एक 24 अच्छी तरह से थाली में transwells की वांछित संख्या प्लेस एक दो कक्ष प्रणाली बनाने.
    2. ठंड बाँझ फॉस्फेट-बफर ्ड नमकीन (पीबीएस) में 25 गुना ईसीएम को पतला करें और प्रत्येक ऊपरी कक्ष में 100 डिग्री सेल्सियस ठंडे पतला समाधान को झिल्ली पर जोड़ें।
      नोट: ECM और पतला ECM समाधान बर्फ पर रखा जाना चाहिए जब तक तुरंत इसके अलावा से पहले.
    3. 24-वेल प्लेट को ढक्कन से ढक दें और प्लेट को टिश्यू कल्चर इनक्यूबेटर में 37 डिग्री सेल्सियस पर रखें ताकि झिल्ली पर ईसीएम ठोसीकरण की अनुमति मिल सके।
    4. 2 ज के बाद, इनक्यूबेटर से प्लेट को हटा दें और ऊतक संस्कृति हुड में रखें। बाँझ चम्मियों का उपयोग करना, धीरे शेष समाधान को दूर करने के लिए प्रत्येक ट्रांसवेल उलटा. झिल्ली को हुड में ढक्कन के साथ हवा में जाने की अनुमति दें जबकि कोशिकाओं को एकत्र किया जा रहा है (चरण 1.3.1- 1.3.11)।
  3. ऐलेल एंटरोइड्स को एकल कोशिकाओं में अलग करना
    1. इनक्यूबेटर से ileal enteroids की प्लेट निकालें और धीरे वैक्यूम आकांक्षा या एक पिपेट के साथ प्रत्येक अच्छी तरह से संस्कृति मीडिया को हटा दें।
      नोट: लगभग 100 स्वस्थ अल्सर युक्त ileal enteroids की एक अच्छी तरह से बीज के लिए पर्याप्त है 1.5-2 कुओं.
    2. ईसीएम को तोड़ने के लिए ईसीएम में निलंबित प्रत्येक कुएं में 500 डिग्री सेल्सियस बर्फ की ठंड 0.5 एमएम एथिलीनडायमिनेटेरेएटिक एसिड (EDTA) जोड़ें। Pipette ऊपर और नीचे एक P1000 pipettor के साथ जोरदार 500 $L पर सेट करने के लिए ECM को तोड़ने के लिए जिससे समाधान में ileal enteroids जारी. ईसीएम के विघटन में सुधार करने के लिए, पाइपिंग के बाद, प्लेट को 30 मिनट के लिए 4 डिग्री सेल्सियस पर जोरदार हिलाएं।
    3. प्रत्येक कुएं से 15 एमएल शंकु-ट्यूबों में विलयन लीजिए।
      नोट: इष्टतम एकल सेल संग्रह के लिए 15 एमएल शंकु ट्यूब प्रति 10 कुओं के लिए लीजिए।
    4. 140 x g और 5 मिनट के लिए 4 डिग्री सेल्सियस पर एक अपकेंद्रित्र में कोशिकाओं को गोली गोली दिखाई देना चाहिए, लेकिन आसानी से disloged किया जा सकता है, तो धीरे धीरे वैक्यूम आकांक्षा या एक पिपेट के साथ supernatant हटा दें।
      नोट: यदि गोली और कोशिकाओं के नुकसान के बारे में चिंतित हैं, एक पिपेट का उपयोग करें और एक अलग ट्यूब में supernatant बचाने के लिए.
    5. तंग जंक्शन लिंकेज को पचाने और एकल कोशिकाओं में ileal enteroids को तोड़ने के लिए, चरण 1.3.3 में एकत्र हर 5 कुओं प्रति कमरे के तापमान trypsin के 500 $L में गोली resuspend. एक P1000 का उपयोग करना, pipette ऊपर और नीचे clumps अलग करने के लिए और 5 मिनट या उससे कम के लिए एक 37 डिग्री सेल्सियस पानी स्नान में ट्यूबों incubate.
      नोट: अनुकूलन ट्यूब ों को इनक्यूबेट करने के लिए आवश्यक समय की उचित मात्रा निर्धारित करने के लिए आवश्यक है ताकि कोशिकाओं को टूट रहे हैं, लेकिन नहीं अधिक trypsinized बात करने के लिए कि वे मर जाते हैं. चरण 1.3.9 में Trypan नीले रंग का प्रयोग करें सुनिश्चित करें कि कोशिकाओं trypsin उपचार के बाद व्यवहार्य हैं.
    6. ट्रिप्सिन को निष्क्रिय करने के लिए ट्रिप्सिन के 500 डिग्री सेल्सियस प्रति 10% भ्रूण बोवाइन सीरम (एफबीएस) के साथ उन्नत DMEM/F12 का 1 एमएल जोड़ें।
    7. पिपेट ऊपर और नीचे एक P1000 पर सेट के साथ 500 $L कम से कम 50 बार शंकु ट्यूब के पक्ष के खिलाफ आगे एकल कोशिकाओं में शेष clumps अलग करने के लिए.
    8. एक 50 एमएल शंकु पर एक 40 डिग्री सेल छलनी प्लेस और सेल छलनी गीला करने के लिए 10% FBS के साथ उन्नत DMEM/F12 के 1 एमएल जोड़ें। छलनी पर 15 एमएल शंकु से एकल सेल निलंबन पिपेट। 10% FBS के साथ उन्नत DMEM/F12 के 1 एमएल के साथ छलनी धो लें।
    9. कोशिकाओं है कि एक नया 15 एमएल शंकु ट्यूब में 50 एमएल शंकु से सेल छलनी के माध्यम से चला गया स्थानांतरण. 1.3.10 सेंट्रीफ्यूगेशन चरण के दौरान, सेलुलर गोली 15 एमएल शंकु नली में अधिक आसानी से देखी जाएगी। हेमोसाइटोमीटर का उपयोग करके कोशिकाओं की गणना करें। यह सत्यापित करने के लिए कि कक्ष अभी भी जीवित हैं, Trypan नीले रंग का उपयोग करें. आमतौर पर, और 95% व्यवहार्यता मनाया जाता है.
    10. कोशिकाओं की गिनती करते समय, 400 x g पर नई 15 एमएल ट्यूब में कोशिकाओं को अपकेंद्रण और 5 मिनट के लिए कमरे के तापमान को 5 मिनट सेल गोली दिखाई देनी चाहिए। ध्यान से एक पिपेट के साथ supernatant निकालें, फिर से गोली disloged हो जाता है मामले में supernatant बचत.
    11. संशोधित पूर्ण विकास मीडिया25 (MCMGF + मीडिया) 10 $M Y-27632 के साथ पूरक तैयार करें। MCMGF + में 2.5 x 105 कोशिकाओं/2000 $L पर गोलीदार कोशिकाओं को पुन: निलंबित करें। सेल बोने की संख्या के अनुकूलन के बारे में चर्चा में टिप्पणी देखें.
      नोट: MCMGF + मीडिया उन्नत DMEM/F12 के साथ 75% एल-Wnt3a वातानुकूलित मीडिया है, 10% आर-स्पॉन्डिन वातानुकूलित मीडिया, 5% नोगिन वातानुकूलित मीडिया, 1x B27 अनुपूरक, 1x N2 अनुपूरक, 1 m N-acetylcysteine, 50 ng/mL माउस पुनः संयोजक EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin मैं, 10 एमएम हेप्स, 2 एमएम ग्लूटामैक्स, और 1x पेनिसिलिन/
    12. सुनिश्चित करें कि कदम 1.2 में तैयार ईसीएम लेपित झिल्ली पूरी तरह से सूख गई है, जैसा कि आंख द्वारा मूल्यांकन किया गया है। MCMGF + के 200 $L के साथ ऊपरी कक्ष धो लें. प्रत्येक ऊपरी कक्ष में सेल समाधान के 200 $L जोड़ें.
    13. प्रत्येक निचले कक्ष में 10 डिग्री सेल्सियस Y-27632 के साथ MCMGF+ के 700 $L जोड़ें। प्लेट को 37 डिग्री सेल्सियस ऊतक संस्कृति इनक्यूबेटर में 5% ब्व्2के साथ रखें।
    14. विकास के 1 दिन के बाद, ऊपरी कक्ष से मीडिया को हटा दें और कई सेल परतों के विकास को रोकने के लिए ताजा MCMGF + के 200 डिग्री सेल्सियस के साथ बदलें।
  4. माध्यम की जगह
    1. एक बार monolayers $ 80% confluent हैं, आम तौर पर दिनों के बीच 1-3 के बाद बीज, नियंत्रण कुओं के लिए भेदभाव मीडिया (डीएम) के साथ basolateral मीडिया की जगह (अधिक विस्तार के लिए कदम 1.4.2 देखें) या एम सेल प्रेरण कुओं के लिए एम सेल मीडिया के साथ (अधिक विस्तार के लिए कदम 1.4.3 देखें). दोनों स्थितियों के लिए डीएम के साथ ऊपरी कक्ष में मीडिया बदलें.
      नोट: डीएम 5% नोगिन वातानुकूलित मीडिया के साथ उन्नत DMEM/ 1x B27 अनुपूरक, 1x N2 अनुपूरक, 1 mM N-acetylcysteine, 50 ng/mL माउस रिकॉमबिनेंट EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 MM HEPES बफर, 2 mM GlutaMAX, और 1xillin/ ). एम सेल मीडिया डीएम 200 एनजी/एमएल रैंकल और 50 एनजी/एमएल टीएनएफ जेड के साथ पूरक है।
    2. नियंत्रण कुओं कि एम कोशिकाओं को शामिल नहीं करना चाहिए के लिए, ऊपरी कक्ष में डीएम के 200 डिग्री एल और नीचे कक्ष में 700 डिग्री एल डीएम जोड़ें.
    3. एम कोशिकाओं को प्रेरित करने के लिए, ऊपरी कक्ष में डीएम के 200 डिग्री सेल्सियस और एम सेल मीडिया के 700 डिग्री एल को नीचे कक्ष में जोड़ें।
    4. हर 2 दिन में मीडिया को बदलें. नियंत्रण कुओं के लिए, ऊपरी और निचले कक्षों में डीएम की जगह. एम सेल कुओं के लिए, ऊपरी कक्ष में डीएम और निचले कक्ष में एम सेल मीडिया की जगह.
      नोट: 7 दिन के बाद सेल-सीडिंग, एम कोशिकाओं को मोनोलेयर्स में पूरी तरह से प्रेरित किया जाता है।

2. क्यूआरटी-पीसीआर द्वारा एम सेल भेदभाव का सत्यापन

नोट: एक बाँझ RNAse मुक्त बेंच अंतरिक्ष में निम्नलिखित काम करते हैं. QRT-PCR के लिए पसंदीदा सामग्री की एक सूची के लिए सामग्री की तालिका देखें.

  1. ऊपरी और नीचे कक्षों से मीडिया निकालें और कमरे के तापमान PBS के 300 डिग्री सेल्सियस के साथ धीरे से ऊपरी कक्ष 2x धो लो.
  2. प्रत्येक ऊपरी कक्ष में त्रिजोल के 300 डिग्री सेल्सियस जोड़ें। 5 मिनट के लिए कमरे के तापमान पर इनक्यूबेट।
    चेतावनी: निर्माता के निर्देशों में संकेत के रूप में त्वचा के साथ संपर्क से बचने के लिए Trizol का उपयोग करते समय दस्ताने और आंख की सुरक्षा पहनें।
  3. इस बीच, प्रत्येक कुएं के लिए माइक्रोसेंट्रीफ्यूज ट्यूबों को लेबल करें और प्रत्येक ट्यूब में त्रिजोल के 700 डिग्री सेल्सियस जोड़ें।
  4. एक P1000 के साथ धीरे से 3x pipeting द्वारा सेल homogenate लीजिए और इसी microcentrifuge ट्यूब में सामग्री हस्तांतरण. मिश्रण करने के लिए 5 s के लिए भंवर.
  5. एक अतिरिक्त 3 मिनट के लिए कमरे के तापमान पर नमूने रखें. फिर एक महीने के लिए -80 डिग्री सेल्सियस पर स्टोर।
  6. आरएनए अलगाव, DNase उपचार, रिवर्स ट्रांसक्रिप्शन और क्यूआरटी-पीसीआर प्रतिक्रियाओं के लिए मानक क्यूआरटी-पीसीआर पद्धति का पालन करें। सामग्री तालिका में प्राइमर सूची कासंदर्भ लें।

3. इम्यूनोफ्लोरेसेंस द्वारा एम सेल विभेद का सत्यापन

नोट: पीबीएस से भरी प्लेट के निचले कक्ष को हमेशा रखें ताकि झिल्ली गीली रहे। यह प्रक्रिया बेंच पर की जाती है। इम्यूनोफ्लोरेसेंस के लिए पसंदीदा सामग्री की एक सूची के लिए सामग्री की तालिका देखें।

  1. ऊपरी कक्ष से मीडिया निकालें और कमरे के तापमान PBS के 300 डिग्री एल के साथ धीरे से 2x धो लो. ऊपरी कक्ष में पीबीएस में कमरे के तापमान 4% पीएफए के 100 डिग्री सेल्सियस जोड़ें। पन्नी के साथ थाली कवर और कमरे के तापमान पर 25 मिनट के लिए खड़े हो जाओ. 4% पीएफए निकालें.
    चेतावनी: 4% पीएफए को खतरनाक रासायनिक अपशिष्ट के रूप में ठीक से निपटान किया जाना चाहिए।
  2. कमरे के तापमान PBS के 300 डिग्री एल के साथ ऊपरी कक्ष 3x धो लें. इस बिंदु पर, नमूने धुंधला करने से पहले एक महीने के लिए 4 डिग्री सेल्सियस पर रह सकते हैं। एक बार दाग, नमूने सबसे अच्छी गुणवत्ता छवियों के लिए एक सप्ताह के भीतर कल्पना की जानी चाहिए.
  3. मोनोलेयर्स को 5% बोवाइन सीरम एल्बुमिन (बीएसए) के 100 $एल के साथ इनक्यूबेट करें जो मोनोलेयर्स को ब्लॉक करने के लिए कमरे के तापमान पर अंधेरे में 30 मिनट के लिए पीबीएस में भंग कर दिया गया।
  4. 1:100 के कमजोर पड़ने पर पीबीएस में 1% बीएसए में GP2 प्राथमिक एंटीबॉडी समाधान तैयार करें। प्रति अच्छी तरह से 100 $L जोड़ें. अंधेरे में कमरे के तापमान पर 1 एच के लिए दाग. समाधान निकालें.
    नोट: GP2 के लिए प्राथमिक दाग से पहले monolayers permebilize नहीं है क्योंकि इष्टतम प्राथमिक GP2 सतह m कोशिकाओं के धुंधला permeabilization के बिना हासिल की है.
  5. कमरे के तापमान PBS के 300 डिग्री एल के साथ ऊपरी कक्ष 3x बार धो लें.
  6. फ्लोरोसेंट टैग बकरी विरोधी माउस IGG के माध्यमिक दाग समाधान तैयार 1:200 पर, phaloidin पर 1:100 और DAPI में 1% बीएसए + 0.1% triton PBS में. प्रति अच्छी तरह से 100 $L जोड़ें. अंधेरे में कमरे के तापमान पर 30 मिनट के लिए दाग.
    नोट: Triton उचित phalloidin दाग के लिए इस कदम के दौरान कोशिकाओं permebilize करने के लिए माध्यमिक दाग समाधान करने के लिए जोड़ा जाता है.
  7. 300 डिग्री एल पीबीएस के साथ 3x धो लें।
  8. कांच की स्लाइड पर बढ़ते विलयन (सामग्री सारणी )की5 डिग्री सेल्सियस की एक बूंद रखें। 24 अच्छी तरह से थाली और व्युत्क्रम से अच्छी तरह से निकालें. ध्यान से एक स्केलपेल का उपयोग कर अच्छी तरह से झिल्ली में कटौती. कांच स्लाइड पर बढ़ते समाधान की बूंद पर सामना करना पड़ कोशिकाओं के साथ झिल्ली प्लेस. झिल्ली के शीर्ष और केंद्र पर बढ़ते समाधान के 10 डिग्री सेल्सियस जोड़ें और कांच स्लाइड और कवरस्लिप के बीच झिल्ली को सील करने के लिए शीर्ष पर एक कवरस्लिप रखें।
  9. 24 घंटे के लिए अंधेरे में कमरे के तापमान पर स्लाइड सूखी दाग स्लाइड 1 सप्ताह के बाद दाग के भीतर confocal माइक्रोस्कोप पर कल्पना की जानी चाहिए।

Representative Results

ECM में उगाए गए Ileal enteroids नेत्रहीन विश्लेषण कर रहे हैं और उनके रिश्तेदार स्वास्थ्य की स्थिति और ileal enteroid संस्कृतियों के लिए गुणवत्ता नियंत्रण के एक साधन के रूप में भेदभाव राज्यों के लिए और monolayers में उपयोग के लिए क्यूआरटी-पीसीआर द्वारा. ईसीएम में उगाए जाने वाले अपृथक्कृत ऐलेल एंटॉइड आकारिकी में स्पष्ट और सिस्टिक दिखाई देते हैं, जो कई स्टेम कोशिकाओं की उपस्थिति का संकेत देते हैं (चित्र 1क)। समय के साथ, विकास मीडिया में उगाए गए असमान इलेल एंटरोइड एक मध्यवर्ती फीनोटाइप पर ले जा सकते हैं जहां कुछ सिस्टिक दिखाई देंगे और कुछ अपारदर्शी दिखाई देंगे (चित्र 1ख)। अक्सर, हमारे अलग-अलग नमूने चित्र 1A के बजाय चित्र 1B में दिखाए गए नमूनों से मिलते-जुलते होते हैं। इन मध्यवर्ती संस्कृतियों में अधिक टर्मिनल विभेदित आंत्रकोशिकाएं होती हैं, जो आंत्रकोशिका मार्कर, सुक्रेस आइसोमलटसी (एसआई) की अभिव्यक्ति द्वारा मापी जाती हैं, और संभवतः लुमेन में मृत आंत्रकोशिकाएं उनके घने रूप में योगदान देती हैं। Ileal enteroids monolayer विकास के लिए इस मध्यवर्ती राज्य में इस्तेमाल किया जा सकता है, लेकिन यह ध्यान में रखा जाना चाहिए कि आंतों स्टेम कोशिकाओं की मात्रा संस्कृतियों में मौजूद कम हो सकता है, और कुछ विभेदित सेल प्रकार मौजूद हो सकता है (उदाहरण के लिए, देखें QRT-PCR ईसीएम में उगाए गए अलग-अलग नमूनों के स्तर चित्र 1ख के चित्र 2में ) के समान होते हैं। तुलना के लिए, 5 + दिनों के लिए ईसीएम में भेदभाव मीडिया के साथ सुसंस्कृत ileal enteroids समान रूप से अंधेरे और lobular दिखाई देगा और इस आकृति विज्ञान के साथ संस्कृतियों monolayers बोने के लिए अच्छे उम्मीदवार नहीं हैं (चित्र 1C) .

स्टेम सेल जीन और आंतों की कोशिका विभेदन के जीन की अभिव्यक्ति का विश्लेषण क्यूआरटी-पीसीआर द्वारा किया जा सकता है ताकि ईसीएम में उगाए गए इलेअल एंटॉइड्स की स्वास्थ्य स्थिति और उनके विभेदन क्षमताओं का आकलन किया जा सके, जो एक बार ट्रांसवेल्स पर मोनोलेयर्स के रूप में बीजित होता है। स्टेम सेल जीन, एलजीआर 5, एक आंत्रकोशिका जीन, एसआई, एक गोबल सेल जीन , MUC2, और एक Paneth सेल जीन, एलईजेड, की अभिव्यक्ति ECM में विकसित undifferentiateतया ileal enteroid संस्कृतियों के बीच तुलना की है और विभेदित ileal RANKL/TNF की उपस्थिति या अनुपस्थिति में enteroid monolayers (चित्र2)। जबकि मूल्यों प्रयोगों के बीच अलग हो सकता है, LGR5 की अभिव्यक्ति monolayers18,26के भेदभाव के बाद कम होना चाहिए. LGR5 अभिव्यक्ति आमतौर पर 7 दिन तक RANKL और TNF ] बिना विभेदित ileal monolayers में नहीं पाया जाता है. इसके विपरीत, विशिष्ट सेल प्रकार, ऐसे एसआई और MUC2 के भेदभाव के मार्करों की अभिव्यक्ति, भेदभाव के बाद वृद्धि18. हमारी संस्कृतियों में भेदभाव के बाद लदने की अभिव्यक्ति आम तौर पर कम हो जाती है। यदि मोनोलेयर्स बनाने के लिए प्रयुक्त ऐलेल एंटरोइड कल्चर चित्र 1ककी तुलना में चित्र 1ख की तरह अधिक दिखते हैं , तो आंतों में अंतरीकरण मार्कर में वृद्धि मामूली हो सकती है क्योंकि ये प्रारंभिक संस्कृतियों में विषम हैं आंत्र कोशिका प्रकार और एसआई और MUC2के एक उच्च बेसल स्तर है. हालांकि, monolayers में भेदभाव अभी भी LGR5 अभिव्यक्ति और माइक्रोस्कोपी के नुकसान से मूल्यांकन के रूप में होता है (नीचे देखें). इसके अलावा, भेदभाव मीडिया में RANKL और TNF के अलावा LGR5 अभिव्यक्ति की हानि कम कर देता है (चित्र2). समानांतर में, एसआई और MUC2 की अभिव्यक्ति रैंकएल और TNF की कमी विभेदित स्थिति की तुलना में थोड़ा कम कर रहे हैं, हालांकि उनके स्तर undifferentiated हालत से ऊपर वृद्धि हुई है.

मोनोलेयर्स में एम सेल विभेदन का निर्धारण क्यूआरटी-पीसीआर और इम्यूनोफ्लोरेसेंस दोनों द्वारा सेल सतह ग्लाइकोप्रोटीन 2 (जीपी2) और ट्रांसक्रिप्शन फैक्टर स्पिब21सहित दो एम सेल विशिष्ट मार्करों का उपयोग करके किया जाता है। जीपी 2 और एसपीआईबी की अभिव्यक्ति को रैंकल और टीएनएफ की उपस्थिति में ileal enteroid-derived monolayers में विनियमित किया जाता है और गैर-रैंकल और टीएनएफ में इलाज किए गए नमूनों में पता नहीं लगाया जाता है (चित्र3)। इन मार्करों की अभिव्यक्ति भी छोटे आंत्र ऊतक के एक टुकड़े को सामान्यीकृत किया जा सकताहै 22, यदि उपलब्ध हो. यह इन एम सेल मार्करों के गुना परिवर्तन की अनुमति देता है ऊतक है कि एम कोशिकाओं के बजाय monolayers कि इन मार्करों की कोई अभिव्यक्ति है और एक प्रयोगशाला में प्रयोगों के बीच मानकीकरण की अनुमति देता है नियंत्रित करने के लिए तुलना की जा करने के लिए. एम कोशिकाओं को भी इम्यूनोफ्लोरेसेंस द्वारा जीपी 2 की सतह अभिव्यक्ति द्वारा पता लगाया जाता है (चित्र 4)। आमतौर पर, एक संप्रवाही मोनोलेयर में, 1 से 5 एम कोशिकाओं को 40X आवर्धन पर दिए गए माइक्रोस्कोप क्षेत्र में दिन 6 से 8 पोस्ट-सीडिंग के नमूने में देखा जाता है, जो RANKL और TNF ] के साथ उपचारित नमूनों में (चित्र 4ए-डी)। अनुपचारित नमूनों में कोई GP2 व्यंजक नहीं देखा जाता है (चित्र 4E) . एक phaloidin जांच के साथ मढ़ा एक्सजेड विमान के लंबकोणीय दृश्य एम कोशिकाओं की शीर्ष सतह पर प्रत्येक सेल और GP2 अभिव्यक्ति के आसपास actin संरचनाओं से पता चलता है (चित्र 4एफ-जी)। यह मॉडल मानव आंत1,2,8में पाई जाने वाली एम कोशिकाओं की निम्न आवृत्ति को पुन: स्वरूपित करता है . शुद्ध और आगे के अध्ययन के लिए एम कोशिकाओं को अलग करने के लिए, एम कोशिकाओं GP2 सतह अभिव्यक्ति का उपयोग कर दाग और GP2 + कोशिकाओं के लिए FACS का उपयोग कर हल किया जा सकता है।

एम कोशिकाएं उपकला2के नीचे रहने वाली प्रतिरक्षा कोशिकाओं को आंतों के लुमेन से एंटीजन को बांधकर ले जाती हैं . आंत में उत्पादित स्रावी आईजीए बैक्टीरिया को बांधता है और रोगाणुओंकेपरिवहन को सुगम बनाने के लिए एम कोशिकाओं की शीर्ष सतह पर बांध सकता है . यह निर्धारित करने के लिए कि क्या इस मॉडल में विकसित एम कोशिकाओं को आईजीए से बांधने में सक्षम हैं, मानव सीरम आईजीए को ऊपरी कक्ष में जोड़ा जाता है, 1 ज के लिए बाध्य करने की अनुमति दी जाती है, और फिर मोनोलेयर्स इम्यूनोफ्लोरेसी विश्लेषण के लिए तैयार किए जाते हैं। एम कोशिकाओं पर IgA की उपस्थिति एक फ्लोर-कंजुटेड माध्यमिक एंटीबॉडी है कि मानव सीरम IgA की भारी श्रृंखला पहचानता का उपयोग कर कल्पना की है. 1 ज के लिए आईजीए के साथ उपचारित एम कोशिकाओं में आईजीए शीर्ष सतह के लिए बाध्य है (चित्र 5क) जबकि नियंत्रण कूपों में एम कोशिकाओं को केवल आईजीए के लिए द्वितीयक एंटीबॉडी के साथ उपचारित किया गया था , जिसमें कोई पता लगाने योग्य संकेत नहीं है (चित्र 5ख) । इसके अलावा, IgA विशेष रूप से एम कोशिकाओं की शीर्ष सतह को बांधता है और GP2 सतह दाग की कमी किसी भी कोशिकाओं के लिए बाध्य नहीं पाया जाता है. इसके अतिरिक्त, एम कोशिकाओं में उनकी शीर्ष सतह2पर विशिष्ट रूप से कम सघन एक्टिन होता है। इस मॉडल में एम सेल आकारिकी का विश्लेषण करने के लिए, ileal enteroid व्युत्पन्न मोनोलेयर्स 7 दिनों के लिए बड़े हो रहे हैं और phaloidin का उपयोग कर एफ-actin के इम्यूनोफ्लोरेस विश्लेषण के लिए काटा जाता है। actin पिक्सेल तीव्रता के मापन एम कोशिकाओं के लिए और गैर-एम कोशिकाओं है कि सीधे ImageJ सॉफ्टवेयर का उपयोग कर प्रत्येक एम सेल के निकट हैं के लिए गणना कर रहे हैं (चित्र 6A) . इस मॉडल में GP2+ M कोशिकाओं पर Actin तीव्रता कम हो जाती है और एक प्रतिनिधि छवि चित्र 6Bमें दर्शाया गया है। कुल मिलाकर, इस ileal enteroid व्युत्पन्न मोनोलेयर मॉडल में विकसित एम कोशिकाओं में विशिष्ट जीन अभिव्यक्ति, आकृति विज्ञान और मानव आंतों एम कोशिकाओं के कुछ एम सेल कार्य होते हैं, जैसे आईजीए के लिए बाध्यकारी।

Figure 1
चित्र 1: ईसीएम एक सप्ताह के बाद विभाजन में मानव ileal enteroids के प्रतिनिधि आकृति विज्ञान. (क) स्पष्ट और सिस्टिक अपृथक्करणीय इलेल एंटॉइड्स। (इ) मध्यवर्ती फीनोटाइप जिसमें कुछ सिस्टिक इलेअल एंटॉइड्स और कुछ अपारदर्शी लोबुलर ऐलेल एंटॉइड्स होते हैं। (ग) गहरा और लोबुलर विभेदित इलेल एंटॉइड्स। छवियाँ 4x आवर्धन पर एक ऑप्टिकल प्रकाश माइक्रोस्कोप के लेंस के माध्यम से लिया एक iPhone7 कैमरा का उपयोग कर. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2: स्टेम सेल की सापेक्ष अभिव्यक्ति और मानव ileal enteroids के भेदभाव मार्करों ECM में बड़े या monolayers के रूप में विभेदित. Ileal enteroids ECM में 7 दिनों के लिए बड़े हो गए थे (अलग) या हो गया और बिना monolayers के रूप में विभेदित (अलग) या RANKL और TNF के साथ (अलग +R/ ILEal enteroid संस्कृतियों या monolayers आरएनए निष्कर्षण के लिए Trizol में काटा गया. जीन अभिव्यक्ति QRT-पीसीआर द्वारा निर्धारित किया गया था और GAPDHके सापेक्ष व्यक्त किया जाता है। डेटा 3 स्वतंत्र कुओं के 3 स्वतंत्र कुओं के औसत है ileal enteroids या शर्त प्रति monolayers. त्रुटि पट्टियाँ SEM. ND का पता नहीं लगाया गया है इंगित करें। सांख्यिकीय महत्व लॉग-रूपांतरण मूल्यों पर निर्धारित किया गया था Dunnett के कई तुलना परीक्षण के साथ एक तरह से ANOVA का उपयोग कर अलग अलग करने के लिए तुलना. * * पी और lt; 0.01, * * * p और lt; 0.001 कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3: एम सेल विशिष्ट मार्करों GP2 और मानव ileal enteroid व्युत्पन्न मोनोलेयर्स से SPIB के सापेक्ष अभिव्यक्ति. RANKL/TNF इलाज और गैर इलाज मानव ileal enteroid व्युत्पन्न मोनोलेयर्स RNA निष्कर्षण के लिए Trizol में काटा गया 7 दिनों के बाद बीज बोने के बाद. जीन अभिव्यक्ति QRT-पीसीआर द्वारा निर्धारित किया गया था और GAPDHके सापेक्ष व्यक्त किया जाता है। डेटा प्रति शर्त 6 स्वतंत्र मोनोलेयर्स का औसत है। त्रुटि पट्टियाँ SEM. ND का पता नहीं लगाया गया है इंगित करें। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 4
चित्र 4: समय के साथ मानव आइलल एंटरॉइड व्युत्पन्न मोनोलेयर्स में एम कोशिकाओं पर सतह जीपी 2 अभिव्यक्ति का इम्यूनोफ्लोरेसेंस। RANKL/TNF इलाज और गैर इलाज मानव ileal enteroid व्युत्पन्न मोनोलेयर्स 4% पीएफए में तय किया गया था और विभिन्न संकेत दिनों के बाद बीज पर इम्यूनोफ्लूओरेंस के लिए दाग. छवियाँ ImageJ सॉफ्टवेयर का उपयोग कर विश्लेषण किया गया. DAPI - ब्लू; ग्लिकोप्रोटीन 2 (GP2) ] लाल. (ए-डी) RANKL/TNF] विभिन्न दिनों के बाद बीज देने पर मोनोलेयरों का इलाज किया। (ई) गैर-उपचारित मोनोलेयर को 7 दिन के बाद की फसल काटा जाता है। (एफ-जी) पहले दिन 7 दिन में मोनोलेयर्स का ऑर्थोगोनल एक्सजेड विमान एफ-एक्टिन के लिए फलालिडिन जांच के साथ मढ़ा गया। फलालॉयडिन ] सियान। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 5
चित्र 5: IgA विशेष रूप से एम कोशिकाओं की शीर्ष सतह के लिए बांधता है. RANKL/TNF] इलाज मानव ileal enteroid व्युत्पन्न मोनोलेयर्स 7 दिनों के लिए बड़े हो गए थे और फिर () 1 एच या (बी) के लिए मानव सीरम IGA के 10 डिग्री ग्राम के साथ इलाज केवल पीबीएस के साथ मजाक का इलाज किया (कोई आईजीए नियंत्रण) . 1 ज के बाद, मोनोलेयर्स पीबीएस में 2x धोया गया, 4% पीएफए में तय किया गया, 0.1% TritonX-100 के साथ permebilized, और इम्यूनोफ्लूरेंस के लिए दाग. छवियाँ ImageJ सॉफ्टवेयर का उपयोग कर विश्लेषण किया गया और 3 स्वतंत्र प्रयोगों के प्रतिनिधि हैं. DAPI - ब्लू; ग्लाइकोप्रोटीन 2 (GP2) ] लाल; मानव सीरम IgA के लिए एंटीबॉडी - ग्रीन; फलालॉयडिन ] सियान। काले तीर एम सेल की शीर्ष सतह के लिए बाध्य IgA को निरूपित करते हैं। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 6
चित्र 6: एम कोशिकाओं ने सन्निकट गैर-एम कोशिकाओं की तुलना में actin तीव्रता को कम कर दिया है। RANKL/TNF इलाज मानव ileal enteroid व्युत्पन्न मोनोलेयर्स 7 दिनों के लिए बड़े हो गए थे और फिर 4% पीएफए में तय किया गया और इम्यूनोफ्लोरेसीकेंस के लिए दाग रहे थे। (ए) ImageJ का उपयोग करते हुए, GP2 + एम कोशिकाओं फ्रीहैंड चयन उपकरण का उपयोग करते हुए और क्षेत्र और एकीकृत घनत्व के माप Phaloidin चैनल में लिया गया था. एक ही विश्लेषण तो प्रत्येक आसन्न गैर एम सेल है कि पड़ोसियों एम सेल के लिए पूरा किया गया था. कच्चे एकीकृत घनत्व को सामान्यीकरण के लिए प्रत्येक व्यक्तिगत सेल के क्षेत्र से विभाजित किया गया था। प्रत्येक एम सेल के लिए प्रत्येक आसन्न गैर-एम कोशिकाओं के लिए औसत एकीकृत घनत्व/क्षेत्र की गणना की गई थी। छवियों 3 स्वतंत्र प्रयोगों से विश्लेषण किया गया; प्रत्येक बिंदु एक एम सेल या पड़ोसी कोशिकाओं का औसत है. SD. सांख्यिकीय महत्व को युग्मित टी परीक्षण का उपयोग करके लॉग-रूपांतरण मानों पर निर्धारित किया गया था, त्रुटि पट्टियाँ इंगित करती हैं. च ] 0.0001 (बी) A. छवियाँ में साजिश से X$ विमान के प्रतिनिधि छवि ImageJ सॉफ्टवेयर का उपयोग कर विश्लेषण किया गया. DAPI - ब्लू; ग्लाइकोप्रोटीन 2 (GP2) ] लाल; फलालॉयडिन ] सियान। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Discussion

मोनोलेयर्स विकसित करने के लिए जो प्रमुख आंत्र कोशिका प्रकार और एम कोशिकाओं में ठीक से अंतर करते हैं, कई कारकों के बारे में पता होना महत्वपूर्ण है। Ileal enteroids ECM संस्कृतियों है कि अलग अलग कर रहे हैं और Lgr5 + स्टेम कोशिकाओं के एक उच्च अनुपात से काटा जाना चाहिए. नेत्रहीन, ECM संस्कृतियों में ileal enteroids के बहुमत अंधेरा और multilobular नहीं होना चाहिए, और LGR5 अभिव्यक्ति QRT-पीसीआर विश्लेषण द्वारा इन संस्कृतियों में पता लगाया जाना चाहिए. वातानुकूलित मीडिया का गुणवत्ता नियंत्रण समय के साथ अलग-अलग संस्कृतियों के प्रचार के लिए आवश्यक है और निर्मित वातानुकूलित मीडिया के प्रत्येक बैच के लिए पूरा किया जाना चाहिए। गुणवत्ता नियंत्रण कुछ ECM संस्कृतियों पर मीडिया के एक नए बैच का परीक्षण और एक सप्ताह के दौरान मीडिया के पिछले बैच के लिए ileal enteroids की आकृति विज्ञान की तुलना द्वारा पूरा किया जा सकता है. LGR5 अभिव्यक्ति पिछले बैच की तुलना में मीडिया के नए बैच में विकसित ileal enteroid संस्कृतियों में अपेक्षाकृत समान रहना चाहिए.

मोनोलेयर्स के रूप में बोने के लिए ileal enteroids की तैयारी के दौरान, एकल कोशिकाओं में ileal enteroids को तोड़ने के लिए trypsin के साथ ऊष्मायन के बाद सेल समाधान को जोरदार रूप से पिपेट करना महत्वपूर्ण है। कोशिका क्लंप मोनोलेयर्स के लिए बीज होने पर बहु-परत गठन का कारण बन सकती है। इसके अलावा, यह अनुभवजन्य प्राप्त किया जाता है कि प्रत्येक व्यक्ति ileal enteroid लाइन के लिए एक मोनोलेयर बनाने के लिए आवश्यक कोशिकाओं की संख्या निर्धारित करने के लिए आवश्यक है। आमतौर पर, यह मान 2.5 x 105 - 5.0 x 105 कोशिकाओं/अच्छी तरह से से रेंज कर सकते हैं, लेकिन संस्कृतियों में गैर सिस्टिक ileal enteroids के लिए सिस्टिक की डिग्री पर निर्भर करता है और प्रत्येक व्यक्ति ileal enteroid लाइन के लिए भिन्न होता है। अनुभव से, ईसीएम में उगाए गए ileal enteroids जो कम सिस्टिक दिखाई देते हैं, मोनोलेयर्स को प्राप्त करने के लिए उच्च कोशिका सीडिंग घनत्व की आवश्यकता होती है। यह सलाह दी जाती है कि विकास के 1 दिन के बाद ऊपरी कक्ष को धीरे से मीडिया को 2-3 बार ऊपर और नीचे पाइप लेट कर और ताजा विकास मीडिया के साथ बदल दें। यह प्रक्रिया उन कोशिकाओं को उखाड़ देती है जो बहु-परत गठन की संभावना को कम करते हुए अन्य कोशिकाओं के शीर्ष पर पहुंच गई हैं। विकास मीडिया से एम सेल मीडिया के लिए ऊपरी कक्ष में मीडिया स्विचिंग जब monolayers $ 80% confluent, जो आम तौर पर दिन 2 के बाद बीजाई में होता है, अच्छा एम सेल भेदभाव को प्राप्त करने में मदद करता है. एम सेल प्रेरण के दौरान ऊपरी कक्ष में RANKL/TNF के अलावा मोनोलेयर प्रति एम कोशिकाओं की एक बड़ी संख्या के विकास के लिए नेतृत्व नहीं करता है और इसलिए ऊपरी कक्ष मीडिया से बाहर छोड़ दिया जा सकता है। एम सेल विकास को प्रभावित किए बिना इस प्रोटोकॉल में अलग-अलग छिद्र आकारों के ट्रांसवेल्स का उपयोग किया जा सकता है; हालांकि, सेल बोने घनत्व बड़ा pores आकार के साथ उन लोगों के लिए अनुकूलित किया जाना चाहिए. कोलेजन चतुर्थ transwells या अच्छी तरह से प्लेटें जो बेहतर कुछ अनुप्रयोगों के लिए अनुकूल हो सकता है के लिए एक तहखाने झिल्ली प्रोटीन कोटिंग के रूप में ECM के लिए प्रतिस्थापित किया जा सकता है.

ट्रांसवेल्स पर इलियाल एंटॉइड व्युत्पन्न मोनोलेयर्स एक दो-कक्ष प्रणाली प्रदान करते हैं जो परिभाषित शीर्ष और बासोटोपार्श्व सतहों के निर्माण के लिए अनुमति देता है ताकि 4-5 विभिन्न प्रकार की उपकला आंतों की कोशिकाओं को प्रत्येक पर सतह मार्करों को व्यक्त करने के लिए polarize कर सकते हैं आंत में पाया गया है कि के सापेक्ष पक्ष. अतिरिक्त कारकों ऐसे कणों, संक्रामक एजेंटों, या अन्य सेल प्रकार के रूप में दोनों ओर जोड़ा जा सकता है. हालांकि, आज तक कुछ सीमाएं बनी हुई हैं। जैसा कि वर्णित है, इस प्रणाली एक स्थिर प्रणाली है कि शारीरिक प्रवाह का अभाव है, आंतों के संकुचन, और आंतों की सामग्री. इसके अलावा, एक फ्लैट मोनोलेयर के गठन से गांव-क्रिप्ट वास्तुकला खो जाती है। इन प्रणालियों Peyer पैच क्षेत्रों की कमी है, प्रतिरक्षा कोशिकाओं, और stromal कोशिकाओं. क्या एम कोशिकाओं के नीचे निकट रहने वाली प्रतिरक्षा और स्ट्रॉमल कोशिकाओं की कमी इस प्रणाली और अन्य शारीरिक कामकाज में नहीं देखी गई invaginations को प्रभावित करती है, जांच का एक महत्वपूर्ण भविष्य क्षेत्र है। इस प्रोटोकॉल एक 96 अच्छी तरह से प्लेट या एक बहु अच्छी तरह से प्लेट प्रारूप के लिए अनुकूलित किया जा सकता है. ईसीएम के साथ 96-वेल प्लेट कोटिंग और ileal enteroids से एकल कोशिकाओं के साथ बोने के लिए प्रक्रिया transwells के लिए के रूप में ही रहता है. मोनोलेयर्स प्राप्त करने के लिए आवश्यक सेल सीडिंग घनत्व का टिट्रेशन किया जाना चाहिए, लेकिन आम तौर पर 1.0 x 105 - 3.0 x 105 कोशिकाओं/अच्छी तरह से एक 96-वेल प्लेट प्रारूप में से पर्वतमाला। एम कोशिकाओं एम सेल मीडिया के साथ विकास मीडिया की जगह जब monolayers 80% confluent आम तौर पर दिन 1-3 प्रारंभिक सेल बोने घनत्व के आधार पर कर रहे हैं द्वारा प्रेरित कर रहे हैं.

इन विट्रो में इलेल एंटोइड्स से एम कोशिकाओं को अलग करने की यह विधि कैको-2 विधि पर महत्वपूर्ण सुधार प्रदान करती है। इलेल एंटॉइड प्राथमिक कोशिकाएं होती हैं और सिस्टम में कम से कम 4-5 उपकला कोशिकाएं प्रकार मौजूद होती हैं। इसके अलावा, विभिन्न लोगों से व्युत्पन्न ileal enteroid लाइनों कैसे आनुवंशिकी या रोग राज्य एम कोशिका विकास और व्यवहार को प्रभावित करने की जांच करने के लिए अध्ययन किया जा सकता है। एम सेल विभेदन के दौरान इलेल एंटरोइड्स का अतिरिक्त हेरफेर एम सेल विकास की बेहतर समझ की अनुमति देगा जिसमें एम सेल अग्रदूत कोशिकाओं की विशेषता शामिल है। अंत में, चूंकि एम सेल फागोसाइटोसिस और ट्रांससाइटोसिस के आणविक तंत्र अभी भी पूरी तरह से समझ में नहीं आ रहे हैं3,29, इस मॉडल का अध्ययन करने और एम कोशिकाओं द्वारा प्रतिजन और कण तेज कल्पना करने का अवसर प्रदान करता है.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

इस काम को NIAID U19AI131126 द्वारा डॉ इसबर्ग (टफ्ट्स यूनिवर्सिटी स्कूल ऑफ मेडिसिन) और डॉ काप्लान (टफ्ट्स विश्वविद्यालय) द्वारा समर्थित किया गया था; (जेएम परियोजना 2 नेता है) और NIAID R21AI128093 जेएम के लिए. ACF भाग में NIAID T32AI007077 द्वारा समर्थित किया गया था. SEB और MKE NIAID U19AI116497-05 द्वारा समर्थित थे. हम उपयोगी विचार विमर्श के लिए Tufts विश्वविद्यालय स्कूल ऑफ मेडिसिन में Mecsas प्रयोगशाला, एनजी प्रयोगशाला, और डॉ Isberg के सदस्यों को धन्यवाद। confocal इमेजिंग तंत्रिका विज्ञान अनुसंधान के लिए Tufts केंद्र में प्रदर्शन किया गया था, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics