인간 줄기 세포 유래 Ileal 장용 단층에서 M 세포 유사 세포의 분화 유도

Immunology and Infection
 

Summary

이 프로토콜은 인간 줄기 세포 유래 장전 단층 및 그들의 발달을 평가하는 방법에서 M 세포의 분화를 유도하는 방법을 기술한다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (마이크로 폴드) 장의 세포는 면역 세포가 상주하고 따라서 장의 점막 면역에 기여 기본 Peyer의 패치와 라미나 프로피아에 정점 루멘에서 항원을 수송하는 기능. M 세포가 장에서 어떻게 분화하는지, 그리고 M 세포에 의한 항원 섭취의 분자 메커니즘에 대한 완전한 이해가 부족합니다. 이것은 M 세포가 창자에 있는 세포의 희소한 인구이고 M 세포를 위한 시험관 내 모형이 튼튼하지 않기 때문에 입니다. 장의 자기 갱신 줄기 세포 배양 시스템의 발견, 엔터노이드라고, M 세포를 배양하기위한 새로운 가능성을 제공하고있다. 엔테로이드는 고독세포, 판세포, 엔테엔도크린 세포 및 장세포를 포함한 여러 주요 세포 유형으로 분화될 수 있기 때문에 표준 배양 세포주에 비해 유리하다. 사이토카인 RANKL은 M 세포 개발에 필수적이며, 배양 배지에 RANKL 및 TNF-α를 첨가하면 장색장세포로부터 세포의 서브세트를 촉진하여 M 세포로 분화한다. 이하의 프로토콜은 인간 장전균을 이용한 장의 트랜스웰 상피 편광 단층 시스템에서 M 세포의 분화를 위한 방법을 설명한다. 이 방법은 M 세포 개발 및 기능의 연구에 적용될 수 있다.

Introduction

M(microfold) 세포는 Peyer의 패치1이라고 불리는 작은 림프성 영역의 여포 관련 상피(FAE)에서 주로 발견되는 장상피세포입니다. M 세포는 짧은 불규칙한 정점 microvilli가 있고 면역 세포가 그들의 세포 체에 밀접하게 상주하는 것을 허용하는 그들의 basolateral 측에 깊이 질착됩니다2. 이 독특한 형태는 M 세포가 장의 정점 루멘에서 항원을 샘플링하고 기본 면역세포 2에 직접 전달 할 수 있게합니다. 이런 식으로, M 세포는 장에서 면역 감시를 위해 중요하지만 또한 라미나 프로피아 1, 2,3,4,5에진입을위한 병원체에 의해 이용될 수 있습니다. 6,7.

M 세포의 연구는 여러 가지 요인에 의해 방해되었습니다. 첫째, M 세포는 마우스와 인간 장에서 낮은 주파수에서발견된다 8. 배양 된 세포 시스템에서, M 세포 와 같은 세포는 마우스 Peyer의 패치 또는 B 세포 림프종 세포 주에서 B 림프구, 라지 B9,10중 하나를 편광 선암 세포 주, Caco-2를 공동 배양하여 분화하도록 유도되었습니다. . 이는 편광상피9,10에서M 세포 마커 시릴 루이스 A 항원 및 UEA-1을 발현하는 카코-2 세포의 서브세트를 초래한다. (이 마커는 또한 장 조직에서 잔 세포에 발현됩니다, 그래서 요즘은 결정적인 M 세포 마커로 보다 적게 빈번히 사용됩니다11,12.) 이 Caco-2-M 세포 시스템은 입자 섭취량 과 박테리아 전좌13,14를연구하는 데 사용되어 왔다. 그러나, Caco-2 세포는 카코-2 세포의 상이한 공급원이 실험실사이에서 상이한 표현형을 나타내는 혼란스러운 인자를 가진 대장 선암으로부터 확립된 세포주(15)이다. 또한, 그들은 현재 알려진 M 세포 마커 GP2 및 SpiB16의발현이 부족하기 때문에 진정한 M 세포의 전사 수준을 완전히 재현하지 못할 수 있다. 따라서, M 세포 발달 및 기능을 연구할 수 있도록 추가적으로 더 생리학적으로 관련된 배양 모델이 필요하다.

지난 10 년 이내에, 장의 장 유래 모델 시스템의 필드는 급속하게 인간의 장 생검에서 파생 된 장 줄기 세포가 자기 전파 및 배양에서 자기 갱신 할 수 있다는 초기 발견에서 앞으로 진행하고있다 17세 , 18.중요한 것은, 성장 배지로부터 줄기세포 촉진 인자를 제거함으로써 이들 줄기세포 배양이장18에서발견되는 많은 세포 유형으로 분화할 수 있게 한다. 더욱이, 최근 연구는 소장19,20에서M 세포 발달에서 RANKL-RANK 신호의 중요성을 시사한다. RANK 수용체는 소장(19)에서 상피 전구세포상에서 발현되는 수용체의 TNF 패밀리의 구성원이며 RANKL(RANK 수용체 리간드)은 Peyer's패치(20)의기질 세포에 의해 방출된다. 장액장내 세포 유형이 RANKL을 생성하지 않기 때문에, M 세포 분화는 장전장 내 장내 배양물에서 RANKL을 배양배지(21,22)에첨가함으로써 유도될 수 있다. 배양 배지에 TNFα를 포함시키는 것은 장골 장수(23)에서 M 세포 발달을 지원하는 데 도움이 된다. 여기서, 우리는 인간 장폐색 장용체에서 유래된 장 단층에서 M 세포의 분화를 유도하는 방법을 기술한다. 우리의 방법은 다음 프로토콜21,22,23의수정에 부분적으로 기초한다.

Protocol

여기에 설명된 모든 방법은 터프츠 대학교 IBC 및 IRB에 의해 승인되었습니다.

1. 인간 Ileal 장용체 유래 단층에서 M 세포 분화를 유도

참고: 이 프로토콜은 인간 조직 생검에서 파생된 장색장성 체를 사용합니다. 이러한 세포를 성장 및 통과하는 방법에 대한 게시 된 프로토콜을 참조하십시오18,24. 단층 을 개발하기위한 다음과 같은 방법은 Zou 등 에서 적응되었다24. 장전성 장용성 유래 배양에서 M 세포를 유도하는 방법은 이전 보고서21,22,23으로부터적응되었다. 모든 작업은 멸균 조직 배양 후드에서 수행되고 배양은 지시된 바와 같이 후드 또는 조직 배양 인큐베이터에 있다. 장색 장색 단층 및 다양한 매체를 준비하는 데 필요한 재료 표를 참조하십시오.

  1. 세포외 매트릭스 (ECM)에서 4-10 일 동안 장전 장신구를 성장 (재료 1 참조) (그림1),트랜스 웰에 시드하기 전에 자신의 본질적인 성장 속도에 따라.
  2. 코팅 트랜스웰 멤브레인
    1. 24웰 플레이트에 원하는 수의 트랜스웰을 배치하여 2챔버 시스템을 만듭니다.
    2. 차가운 멸균 인산 완충 식염수 (PBS)에서 ECM 25 배를 희석하고 각 상부 챔버에 100 μL의 차가운 희석 용액을 멤브레인에 추가하십시오.
      참고: ECM 및 희석 된 ECM 용액은 첨가 직전까지 얼음에 보관해야합니다.
    3. 뚜껑으로 24 웰 플레이트를 덮고 막에 ECM 응고를 허용하기 위해 37 °C에서 조직 배양 인큐베이터에 플레이트를 놓습니다.
    4. 2 시간 후, 인큐베이터에서 플레이트를 제거하고 조직 배양 후드에 놓습니다. 멸균 핀셋을 사용하여 각 트랜스웰을 반전하여 남은 용액을 부드럽게 제거합니다. 세포가 수집되는 동안 뚜껑이 열리는 후드에서 멤브레인을 에어 드라이할 수 있도록 하십시오(단계 1.3.1- 1.3.11).
  3. 장전장세포를 단일 세포로 해리
    1. 인큐베이터에서 장색 장용의 플레이트를 제거하고 진공 흡인 또는 파이펫으로 각각의 웰로부터 배양 매체를 부드럽게 제거합니다.
      참고: 약 100 개의 건강한 낭종을 포함하는 장골 장신구 중 하나는 1.5-2 웰을 뿌리기에 충분합니다.
    2. ECM에 매달린 장색 장신구를 함유하는 각 우물에 얼음 차가운 0.5 mM 0.5 mM 에틸렌디아미네테트라아세트산(EDTA)의 500 μL을 첨가하여 ECM을 분해한다. 500 μL로 설정된 P1000 파이펫을 사용하여 활발하게 파이펫을 만들어 ECM을 분해하여 ileal 장용체를 용액으로 방출합니다. ECM의 용해를 개선하기 위해 파이펫팅 후 플레이트를 4 °C에서 30 분 동안 힘차게 흔들어 줍니다.
    3. 15 mL 원엽 튜브로 각 우물에서 용액을 수집합니다.
      참고: 최적의 단일 셀 수집을 위해 15 mL 원추형 튜브당 최대 10개의 웰을 수집합니다.
    4. 펠렛 140 x g 및 4 °C에서 원심 분리기에 세포를 5 분 동안 볼 수 있어야하지만 쉽게 빠질 수 있으므로 진공 흡인 또는 파이펫으로 상류자를 천천히 제거하십시오.
      참고: 펠릿과 세포의 손실이 우려되는 경우, 파이펫을 사용하고 상급자를 별도의 튜브에 저장하십시오.
    5. 단단한 접합 결합을 소화하고 장색 장신을 단일 세포로 분해하려면 1.3.3 단계에서 수집 된 5 개의 우물 당 500 μL의 실온 트립신에서 펠릿을 다시 일시 중단하십시오. P1000을 사용하여, 피펫을 위아래로 하여 덩어리를 분해하고 튜브를 37°C 수조에서 5분 이하로 배양한다.
      참고: 최적화는 세포가 분해되지만 그들이 죽는 지점에 지나치게 trypsinized되지 않도록 튜브를 배양하는 데 필요한 적절한 시간을 결정하는 데 필요합니다. 1.3.9 단계에서 Trypan blue를 사용하여 트립신 치료 후 세포가 실행 가능한지 확인하십시오.
    6. 트립신을 비활성화하기 위해 트립신 500 μL당 10% 태아 소 세럼(FBS)으로 고급 DMEM/F12 1 mL을 추가합니다.
    7. P1000을 500 μL로 설정한 피펫을 원추형 튜브 측면에 대해 최소 50회 이상 설정하여 남은 덩어리를 단일 세포로 분해합니다.
    8. 50 mL 원엽 위에 40 μm 세포 스트레이너를 놓고 10 % FBS로 고급 DMEM / F12 1 mL을 추가하여 세포 스트레이너를 적십니다. 15 mL 원엽에서 단일 세포 현탁액을 스트레이너상에 피펫. 10 % FBS로 고급 DMEM / F12의 1 mL로 여과기를 씻으하십시오.
    9. 50 mL 원엽에서 세포 스트레이너를 통과한 세포를 새로운 15 mL 원엽 튜브로 옮김을 전달합니다. 원심분리 단계 1.3.10 동안, 세포 펠렛은 15 mL 원엽 관에서 더 쉽게 볼 수 있을 것이다. 혈세포계를 사용하여 세포를 계산합니다. Trypan 파란색을 사용하여 셀이 아직 살아 있는지 확인합니다. 전형적으로,>95% 생존성이 관찰된다.
    10. 세포를 계산하는 동안, 새로운 15 mL 튜브에서 세포를 400 x g및 실온에서 5 분 동안 세포 펠릿이 보일 수 있습니다. 조심스럽게 페펫으로 상류를 제거하고 펠릿이 빠질 경우를 대비하여 상류자를 다시 저장하십시오.
    11. 10 μM Y-27632로 보충된 수정된 완전 성장 매체(MCMGF+ 미디어)를 준비한다. MCMGF+에서 2.5 x 105 세포/200 μL에서 펠릿 세포를 다시 일시 중단하십시오. 셀 시드 번호 최적화에 대한 설명참조
      참고: MCMGF+ 미디어는 75% L-Wnt3a 컨디셔닝 된 미디어를 갖춘 고급 DMEM / F12이며, 10% R-spondin 컨디셔닝 매체, 5% 노긴 컨디셔닝 미디어, 1x B27 보충제, 1mM N-아세틸시스테인, 50 ng/mL 마우스 재조합 EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES, 2 mM 글루타맥스, 1 x 페니실린 / 스트렙토 마이신 (선택 사항).
    12. 1.2단계에서 제조된 ECM 코팅 멤브레인이 눈으로 평가한 대로 완전히 건조되었는지 확인하십시오. MCMGF+의 200 μL로 상부 챔버를 세척하십시오. 각 상부 챔버에 200 μL의 셀 용액을 넣습니다.
    13. 각 하부 챔버에 10 μM Y-27632로 MCMGF+의 700 μL을 추가합니다. 플레이트를 5% CO2로 37°C 조직 배양인큐베이터에 놓는다.
    14. 성장 1 일 후, 상부 챔버에서 매체를 제거하고 여러 세포 층의 성장을 방지하기 위해 신선한 MCMGF +의 200 μL로 교체하십시오.
  4. 매체 교체
    1. 단층이 ~ 80% 동시성, 보통 일 1-3 포스트 시드 사이에, 제어 웰을 위한 분화 매체(DM)로 basolateral media를 대체(자세한 내용은 단계 1.4.2 참조) 또는 M 세포 유도 웰에 대한 M 셀 미디어(자세한 내용은 1.4.3 단계 참조). 상부 챔버의 미디어를 두 조건 모두 DM으로 교체하십시오.
      참고: DM은 5% 노긴 컨디셔닝 된 미디어를 갖춘 고급 DMEM / F12이며, 1x B27 보충제, 1x N2 보충제, 1 mM N-아세틸시스테인, 50 ng/mL 마우스 재조합 EGF, 500 nM A-8301, 10 nM [Leu15]-가스트린 I, 10 mM HEPES 버퍼, 2 mM 글루타맥스, 1x 페니실린/스트렙토마이신(옵션) ). M 세포 매체는 200 ng/mL RANKL 및 50 ng/mL TNFα로 보충된 DM이다.
    2. M 세포를 포함하지 않아야 하는 제어 웰의 경우, 상부 챔버에 200 μL의 DM을 추가하고 하단 챔버에 700 μL DM을 추가합니다.
    3. M 세포를 유도하기 위해, 상부 챔버에 200 μL의 DM을 추가하고 700 μL의 M 세포 매를 바닥 챔버에 추가한다.
    4. 2일마다 미디어를 교체합니다. 제어 웰의 경우 상부 및 하부 챔버의 DM을 교체하십시오. M 셀 웰의 경우, 상부 챔버의 DM을 교체하고 하부 챔버의 M 셀 미디어를 교체합니다.
      참고: 7일째까지 세포-파종 후, M 세포는 단층에서 완전히 유도된다.

2. qRT-PCR로 M 셀 분화 검증

참고: 멸균 RNAE없는 벤치 공간에서 다음 작업을 수행하십시오. qRT-PCR에 대한 기본 재료 목록은 재료 표를 참조하십시오.

  1. 상부 및 하부 챔버에서 매체를 제거하고 상온 PBS의 300 μL로 상부 챔버를 2x 부드럽게 세척하십시오.
  2. 각 상부 챔버에 300 μL의 Trizol을 추가합니다. 실온에서 5분 동안 배양합니다.
    주의: 제조업체의 지침에 명시된 대로 피부와의 접촉을 피하기 위해 Trizol을 사용할 때는 장갑과 눈 보호 를 착용하십시오.
  3. 한편, 각 우물에 대한 미세 원심 분리튜브를 라벨하고 각 튜브에 700 μL의 Trizol을 추가합니다.
  4. P1000으로 3배 부드럽게 위아래로 파이펫팅하여 세포 균질화를 수집하고 내용물들을 해당 미세원심지 튜브로 옮긴다. 5 ss용 소용돌이를 섞습니다.
  5. 샘플을 추가로 3분 동안 실온에서 보관하십시오. 그런 다음 -80 °C에서 최대 1 개월 동안 보관하십시오.
  6. RNA 격리, DNase 처리, 역전사 및 qRT-PCR 반응을 위한 표준 qRT-PCR 방법론을 따르십시오. 재료 표의프라이머 목록을 참조하십시오.

3. 면역형광에 의한 M 세포 분화 검증

참고: 멤브레인이 젖은 상태로 유지되도록 항상 플레이트의 하부 챔버를 PBS로 채워 두십시오. 이 절차는 벤치에서 수행됩니다. 면역 형광에 대한 선호 물질 목록은 재료 표를 참조하십시오.

  1. 상부 챔버에서 매체를 제거하고 실온 PBS 300 μL로 2x 부드럽게 세척하십시오. 상부 챔버에 PBS에 실온 4% PFA 100 μL을 추가합니다. 호일로 접시를 덮고 실온에서 25 분 동안 방치하십시오. 4% PFA를 제거합니다.
    주의: 4% PFA는 유해 화학 폐기물로 적절히 폐기되어야 합니다.
  2. 상온 PBS의 300 μL로 상부 챔버를 3x 세척합니다. 이 시점에서, 샘플은 염색하기 전에 최대 한 달 동안 4 °C에서 남아있을 수 있습니다. 얼룩이 나면 최상의 이미지를 위해 1주일 이내에 샘플을 시각화해야 합니다.
  3. 단층을 100 μL의 5% 소 혈청 알부민(BSA)으로 배양하여 PBS에 30분 동안 단층을 차단한다.
  4. 1:100의 희석에서 PBS에서 1% BSA에서 GP2 1차 항체 용액을 준비한다. 웰 당 100 μL을 추가합니다. 어둠 속에서 실온에서 1 시간 동안 얼룩을 지않습니다. 용액을 제거합니다.
    참고: M 세포의 최적 1 차 GP2 표면 염색이 투과없이 달성되기 때문에 GP2에 대한 1 차 얼룩이 발생하기 전에 단층을 투과하지 마십시오.
  5. 상온 PBS의 300 μL로 상부 챔버를 3배 세척합니다.
  6. 형광 태그 염소 안티 마우스 IgG의 이차 얼룩 용액을 준비 1:200, 1:100에서 파할로이드 와 DAPI 에 1% BSA + 0.1% PBS트리톤. 웰 당 100 μL을 추가합니다. 어둠 속에서 실온에서 30 분 동안 얼룩.
    참고: 트리톤은 적절한 남근성 얼룩에 대한 이 단계 동안 세포를 투과화하기 위해 이차 얼룩 용액에 첨가된다.
  7. 300 μL PBS로 3x 세척하십시오.
  8. 유리 슬라이드에 5 μL의 마운팅 용액(재료 표)을 놓습니다. 24 웰 플레이트에서 웰을 제거하고 반전. 메스를 사용하여 잘 막을 조심스럽게 잘라냅니다. 셀이 유리 슬라이드에 장착 용액의 물방울을 위로 향하게하여 멤브레인을 놓습니다. 멤브레인의 상단과 중앙에 10 μL의 장착 용액을 추가하고 상단에 커버 슬립을 배치하여 유리 슬라이드와 커버 슬립 사이의 멤브레인을 밀봉합니다.
  9. 24 시간 동안 어둠 속에서 실온에서 슬라이드를 건조. 스테인드 슬라이드는 1 주 후 염색 이내에 공초점 현미경으로 시각화되어야한다.

Representative Results

ECM에서 자란 Ileal 장신구는 상대적 건강 상태 및 분화 상태에 대한 qRT-PCR을 전자 장내 장내 배양에 대한 품질 관리 수단으로 분석하고 단층에서 사용합니다. ECM에서 성장한 미분화 장액 장신구는 형태학에서 명확하고 낭포성으로나타나며, 많은 줄기 세포의 존재를 나타낸다(도 1A). 시간이 지남에 따라, 성장 매체에서 성장하는 미분화 ileal 장신구는 몇몇낭성 및 몇몇이 불투명하게 나타나는 중간 표현형에 걸릴 수 있습니다 (그림1B). 종종 미분화 샘플은 그림1A가 아닌 그림 1B에 표시된 샘플과 유사합니다. 이러한 중간 배양체는 장세포 마커, 수크라제 이소말타제(SI)의 발현에 의해 측정된 바와 같이 더 말단화된 장세포체를 포함하고, 아마도 루멘에서 압출된 죽은 장세포는 그들의 조밀한 외관에 기여한다. Ileal 엔테로이드는 단층 발달을 위해 이 중간 상태에서 사용될 수 있습니다, 그러나 배양에 존재하는 장 줄기 세포의 양이 낮을 지도 모르다는 것을 명심해야 하고, 몇몇 분화한 세포 모형은 나타날 지도 모릅니다 (예를 들면, qRT-PCR를 참조하십시오) 그림2에서 그림 1B와 유사한 ECM에서 자란 미분화 샘플의 수준입니다. 비교를 위해, 5+ 일 동안 ECM에서 분화 배지로 배양된 장색 장핵은 균일하게 어두워지고 소엽 및 이러한 형태를가진 배양체는 단층 시드에 대한 좋은 후보가 아니다(도 1C).

줄기 세포 유전자 및 장세포 분화유전자의 발현은 eCM에서 자란 장색장의 건강 상태를 평가하기 위한 또 다른 수단으로 qRT-PCR에 의해 분석될 수 있으며, 이들의 분화 능력은 한때 트랜스웰에 단층으로 시드되었다. 줄기세포 유전자, LGR5,장세포 유전자, SI,잔세포 유전자, MUC2,및 파네스 세포 유전자, LYZ의발현은 ECM에서 자란 미분화 장전장성 배양과 분화된 장색장골 배양사 간에 비교된다. RANKL/TNFα의 존재 또는 부재 중엔자단층(그림 2). 값은 실험 간에 다를 수 있지만, LGR5의 발현은 단층18,26의분화 후 감소한다. LGR5 발현은 일반적으로 7일째까지 RANKL 및 TNFα가 없는 분화 된 장색 단층에서 검출되지 않는다. 반대로, SIMUC2와 같은 특정 세포 유형의 분화 마커의 발현은 분화 후증가한다(18). LYZ의 표현은 일반적으로 우리의 문화에서 분화 후 감소. 단층을 만들기 위해 사용되는 장색 장내 배양이 그림1A보다 그림 1B보다 더 비슷하게 보이면, 이러한 초기 배양이 이질적이기 때문에 장 분화 마커의 증가는 적당할 수 있습니다. 장 세포 모형및 SI와 MUC2의더 높은 기초 수준이 있습니다. 그러나, 단층에서 분화는 LGR5 발현 및 현미경 검사법의 손실에 의해 평가된 것과 같이 아직도 생깁니다 (아래 참조). 더욱이, 차별화 매체에 RANKL 및 TNFα를 첨가하면 LGR5 발현의 손실을 감소시킨다(도 2). 병행하여, SIMUC2의 발현은 그들의 수준이 미분화 조건 이상으로 증가하지만 RANKL 및 TNFα가 결여된 분화 된 조건보다 약간 낮다.

단층에서의 M 세포 분화는 세포 표면 당단백질 2(GP2) 및 전사 인자 SpiB21을포함하는 2개의 M 세포 특이적 마커를 사용하여 qRT-PCR 및 면역형광에 의해 모두 결정된다. GP2SPIB의 발현은 RANKL 및 TNFα의 존재 시 장색 유래 단층에서 업조절되고 비RANKL 및 TNFα처리된 샘플에서 검출되지 않는다(도 3). 이들 마커의 발현은 또한 작은 장조직(22)의조각으로 정규화될 수 있다. 이것은 이 마커의 아무 표현도 없고 1개의 실험실에 있는 실험 사이 표준화를 허용하는 단층을 통제하기 보다는 오히려 M 세포가 있는 조직에 비교되는 이 M 세포 마커의 배 변경을 허용합니다. M 세포는 또한 면역형광에 의한 GP2의 표면발현에 의해 검출된다(도 4). 전형적으로, 동시 단층에서, 1~5M 세포는 RANKL 및 TNFα로 처리된 샘플에서 6~8일까지 40배 배율로 주어진 현미경 분야에서 관찰된다(도4A-D). 치료되지 않은 샘플에서 GP2 발현이 보이지 않는다(도4E). 파할로이드 프로브와 겹쳐진 XZ 평면의 직교 뷰는 M 세포의 정점 표면에 각 세포 및 GP2 발현을 둘러싸는 액틴 구조를 나타낸다(도4F-G). 이 모델은 인간 장 1,2,8에서발견되는 M 세포의 저주파를 다시 설명합니다. 추가 연구를 위해 M 세포를 정화하고 분리하기 위해, M 세포는 GP2 표면 발현을 사용하여 염색되고 GP2+ 세포에 대한 FACS를 사용하여 분류될 수 있다.

M 세포는 장 내루멘으로부터 상피2아래에 있는 면역 세포로 항원을 결합하고 수송한다. 장에서 생산된 IgA는 세균에 결합하고 M 세포의 정점 표면에 결합하여 미생물의 수송을 용이하게 할 수있다(27,28). 이 모델에서 개발된 M 세포가 IgA에 결합할 수 있는지 를 결정하기 위해, 인간 혈청 IgA가 상부 챔버에 첨가되고, 1 시간 동안 결합할 수 있게 된 다음, 단층은 면역형광 분석을 위해 제조된다. M 세포에 IgA의 존재는 인간 혈청 IgA의 무거운 사슬을 인식하는 형광 공액 이차 항체를 사용하여 가시화됩니다. IgA로 처리된 M 세포는 1시간 동안 이가정 표면에 결합된 IgA(도5A)를가지는 반면, IgA에 대한 이차 항체로만 처리된 제어 웰의 M 세포는 검출 가능한 신호가 없다(도5B). 또한, IgA는 M 세포의 정점 표면에 특이적으로 결합하고 GP2 표면 얼룩이 결여된 임의의 세포에 결합되어 발견되지 않는다. 또한, M 세포는 그들의 정점 표면에 특징적으로더 짧은 조밀한 actin이 2. 이 모델에서 M 세포 형태를 분석하기 위해, 장색 장체 유래 단층은 7일 동안 재배되고 파할로이드를 이용한 F-액틴의 면역형광 분석을 위해 수확된다. 액틴 픽셀 강도의 측정은 ImageJ 소프트웨어를 사용하여 각 M 셀에 직접 인접한M 셀 및 비M 셀에 대해 계산됩니다(그림 6A). 액틴 강도는 이 모델에서 GP2+ M 세포에서 감소되고 대표적인 이미지는 도 6B에도시되어 있다. 전반적으로, 이러한 장색장 유래 단층 모델에서 개발된 M 세포는 IgA에 결합하는 것과 같은 인간 장M 세포의 특징적인 유전자 발현, 형태 및 일부 M 세포 기능을 갖는다.

Figure 1
그림 1: ECM에서 인간 장골 장용체의 대표적인 형태는 1주일 후 분할. (A) 명확하고 낭포성 미분화 장색장제. (B) 일부 낭포성 장골 장신구 및 일부 불투명 한 소엽 장색 장신구와 중간 표현형. (C) 어둡고 소엽 차별화 된 장신구. iPhone7 카메라를 사용하여 광학 광 현미경의 렌즈를 통해 4배 배율로 촬영한 이미지. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
도 2: ECM에서 성장하거나 단층으로 분화된 인간 장골 장신구의 줄기 세포 및 분화 마커의 상대적 발현. Ileal 엔테로이드는 ECM(미차별화) 또는 (차별화) 또는 RANKL 및 TNFα(차별화된 +R/T)를 가진 단층으로서 성장및 분화하여 7일 동안 성장하였다. 일체형 장체 배양체 또는 단층체는 RNA 추출을 위한 트리졸에서 수확되었다. 유전자 발현은 qRT-PCR에 의해 결정되었고 GAPDH에비해 발현된다. 데이터는 조건당 3개의 독립적인 웰 또는 단층의 평균입니다. 오류 막대는 SEM. ND가 감지되지 않음을 나타냅니다. 통계적 유의는 Dunnett의 다중 비교 테스트와 미분화 비교를 이용한 단방향 ANOVA를 사용하여 로그 변환 값에 대해 결정되었습니다. ** p < 0.01, *** p & 0.001 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
도 3: 인간 장골 장수 유래 단층으로부터의 M 세포 특이적 마커 GP2SPIB의 상대발현. RANKL/TNFα 처리 및 비처리된 인간 장색 장신구 유래 단층은 7일 후 파종 후 RNA 추출을 위한 Trizol에서 수확하였다. 유전자 발현은 qRT-PCR에 의해 결정되었고 GAPDH에비해 발현된다. 데이터는 조건당 평균 6개의 독립적인 단층입니다. 오류 막대는 SEM. ND가 감지되지 않음을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
도 4: 시간이 지남에 따라 인간 장골 장수 장수 유래 단층에서 M 세포상에서 표면 GP2 발현의 면역형광. RANKL/TNFα 처리 및 비처리된 인간 장색 장상 유래 단층은 4% PFA에 고정되었고, 다양한 지시된 일 후 시드에 면역형광을 위해 염색하였다. 이미지는 ImageJ 소프트웨어를 사용하여 분석되었습니다. DAPI = 파란색; 당단백질 2 (GP2) = 적색. (A-D) RANKL/TNFα는 다양한 날의 파종 후 단층을 처리하였다. (E) 7일째에 수확된 비처리 단층후 시드. (F-G) 7일째에 단층의 직교 XZ 평면F-액틴에 대한 파할로이드 프로브와 오버레이 된 사후 시드. 파할로이드 = 시안. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 5
도 5: IgA는 M 세포의 정점 표면에 특이적으로 결합한다. RANKL/TNFα 처리된 인간 장색 장신구 유래 단층은 7일 동안 성장한 다음 (A) 10 μg의 인간 혈청 IgA를 1시간 동안 또는 (B) PBS로 만 처리하였다(IgA 대조군 없음). 1시간 후, 단층은 PBS에서 2x 세척하고, 4% PFA에 고정시키고, 0.1% 트리톤X-100으로 투과하고, 면역형광을 위해 염색하였다. 이미지는 ImageJ 소프트웨어를 사용하여 분석되었으며 3개의 독립적인 실험을 대표합니다. DAPI = 파란색; 당단백질 2 (GP2) = 적색; 인간 혈청 IgA에 대한 항체 = 그린; 파할로이드 = 시안. 검은 색 화살표는 M 셀의 정점 표면에 바인딩된 IgA를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 6
도 6: M 세포는 인접한 비-M 세포에 비해 액틴 강도를 감소시이다. RANKL/TNFα 처리된 인간 장색 장상 유래 단층은 7일 동안 성장한 다음 4% PFA에 고정시키고 면역형광을 위해 염색하였다. (a) ImageJ를 사용하여, GP2+ M 세포는 프리핸드 선택 도구를 사용하여 개략화되었고 면적 및 통합 밀도의 측정은 Phalloidin 채널에서 취하였다. 그런 다음 M 셀과 인접한 각 비-M 셀에 대해 동일한 분석을 완료했습니다. 원시 통합 밀도는 정규화를 위해 각 개별 셀의 영역으로 나누었습니다. 평균 통합 밀도/면적은 각 M 셀에 대해 인접한 각 비M 셀에 대해 계산되었습니다. 이미지는 3개의 독립적인 실험으로부터 분석되었다; 각 점은 M 셀 또는 인접 셀의 평균입니다. 오류 막대는 SD. 통계적 유의가 쌍을 이루는 t 테스트를 사용하여 로그 변환 된 값에서 결정되었음을 나타냅니다. p = 0.0001 (B) A. 이미지의 플롯에서 XZ 평면의 대표 이미지는 ImageJ 소프트웨어를 사용하여 분석하였다. DAPI = 파란색; 당단백질 2 (GP2) = 적색; 파할로이드 = 시안. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Discussion

주요 장 세포 유형과 M 세포로 제대로 분화하는 단층을 개발하려면 여러 가지 요인을 인식하는 것이 중요합니다. Ileal 장신구는 미분화되고 Lgr5+ 줄기 세포의 높은 비율을 가진 ECM 배양물에서 수확되어야 합니다. 시각적으로, ECM 배양내의 장색장체의 대다수는 어둡게 하고 다동체가 되어서는 안 되며, LGR5 발현은 qRT-PCR 분석에 의해 이러한 배양물에서 검출되어야 한다. 컨디셔닝 된 매체의 품질 관리는 시간이 지남에 따라 미분화 배양물의 전파에 필수적이며 생산되는 컨디셔닝 된 미디어의 각 배치에 대해 완료되어야합니다. 일부 ECM 배양물에서 새로운 배지 배치를 테스트하고 장전장장내체의 형태를 일주일 동안 의 이전 미디어 배치와 비교하여 품질 관리를 완료할 수 있습니다. LGR5 발현은 이전 배치에 비해 새로운 배지 배치에서 성장한 장색 장색 배양에서 상대적으로 유사하게 유지되어야 한다.

단층으로 파종을 위한 장색 장용체를 제조하는 동안, 트립신과 함께 배양 후 세포 용액을 활발하게 피펫하여 장골 장신구를 단일 세포로 분해하는 것이 중요하다. 세포 덩어리는 단층을 위해 시드될 때 다층 형성으로 이끌어 낼 수 있습니다. 또한, 수득되는 각각의 개별 장골 장신구 라인에 대해 단층을 형성하는 데 필요한 셀의 수를 경험적으로 결정하는 것이 필수적이다. 전형적으로, 이 값은 2.5 x 10 5에서 구역 수색할 수 있습니다 – 5.0 x 105 세포/well/well 그러나 배양에 있는 비 낭포성 장골 장용에 낭포의 정도에 따라 달라지고 각 개별 장골 장용선에 대해 변화합니다. 경험에서, 덜 낭포성 나타나는 ECM에서 자란 장색 장체는 단층을 달성하기 위하여 더 높은 세포 종자 조밀도를 요구합니다. 성장 1 일 후 상부 챔버를 부드럽게 2-3 회 위아래로 파이프하고 신선한 성장 매체로 교체하여 상부 챔버를 세척하는 것이 좋습니다. 이 프로세스는 다층 형성의 가능성을 감소시키는 그밖 세포의 위에 착륙한 세포를 박탈합니다. 단층이 ~80% 동시성일 때 성장 매체에서 M 세포 매체로 상부 챔버내의 매체를 전환하면, 보통 2일째 에 발생하는 사후 시드, 좋은 M 세포 분화를 달성하는 데 도움이 된다. M 세포 유도 동안 상부 챔버에 RANKL/TNFα를 첨가하면 단층당 더 많은 수의 M 세포의 발달을 유도하지 않으므로 상부 챔버 매체에서 제외될 수 있다. 다양한 기공 크기의 트랜스웰은 M 세포 발달에 영향을 미치지 않고 이 프로토콜에서 사용될 수 있습니다. 그러나, 세포 파종 밀도는 더 큰 공극 크기를 가진 사람들을 위해 최적화되어야 합니다. 콜라겐 IV는 특정 용도에 더 적합할 수 있는 트랜스웰 또는 웰 플레이트의 지하 막 단백질 코팅으로 ECM을 대체할 수 있습니다.

트랜스웰에 Ileal 장용 유래 단층은 4-5 가지 유형의 상피 장 세포가 각각표면 마커를 발현하도록 편광 할 수 있도록 정의 된 정점 및 바소 측표면의 생성을 허용하는 2 챔버 시스템을 제공합니다. 장에서 발견되는 것과 관련이 있습니다. 추가 요인은 입자, 전염하는 에이전트, 또는 그밖 세포 모형과 같은 어느 쪽에 추가될 수 있습니다. 그러나 현재까지 몇 가지 제한 사항이 남아 있습니다. 설명한 바와 같이,이 시스템은 생리적 흐름, 장 수축 및 장 내용이 부족한 정적 시스템입니다. 또한, 빌루스 토굴 아키텍처는 평면 단층의 형성에 의해 손실된다. 이 시스템은 Peyer의 패치 지구, 면역 세포 및 기질 세포가 부족합니다. M 세포 의 밑에 밀접하게 거주하는 면역과 기질 세포의 부족이 이 체계및 그밖 생리적인 작용에서 관찰되지 않는 질의에 영향을 미치는지 여부는 조사의 중요한 미래 지역입니다. 이 프로토콜은 96웰 플레이트 또는 멀티 웰 플레이트 형식으로 조정할 수 있습니다. ECM으로 96 웰 플레이트를 코팅하고 장골 장신구에서 단일 세포로 파종하는 절차는 트랜스웰과 동일하게 유지됩니다. 단층을 얻기 위하여 요구된 세포 파종 조밀도의 적정은 행해져야 합니다, 그러나 전형적으로 96 웰 격판덮개 형식에 있는 1.0 x 105 - 3.0 x 105 세포/잘 범위. M 세포는 초기 세포 파종 밀도에 따라 단층이 80% 동시일 때 성장 매체를 M 세포 매체로 대체함으로써 전형적으로 1-3일까지 동시적으로 결합된다.

시험관 내 장색장장으로부터 M 세포를 분화시키는 이 방법은 Caco-2 방법에 비해 상당한 개선을 제공한다. 장골 장색제는 1차 세포이고 적어도 4-5개의 상피 세포 유형은 시스템에 존재한다. 또한, 상이한 사람으로부터 유래된 장색장선은 유전학 또는 질병 상태가 M 세포 발달 및 행동에 어떤 영향을 미치는지 조사하기 위해 연구될 수 있다. M 세포 분화 동안 장색장세포의 추가 조작은 M 세포 전구세포를 특성화하는 것을 포함하는 M 세포 발달에 대한 더 나은 이해를 가능하게 할 것이다. 마지막으로, M 세포 식균증 및 백질 세포증의 분자 메커니즘이 아직완전히 이해되지 않기 때문에 3,29,이 모델은 M 세포에 의한 항원 및 입자 섭취를 연구하고 시각화 할 수있는 기회를 제공합니다.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

이 작품은 박사 이스버그에 NIAID U19AI131126에 의해 지원되었다 (의학의 터프츠 대학) 박사 카플란 (터프츠 대학); (JM은 프로젝트 2 리더) 및 NIAID R21AI128093에서 JM으로. ACF는 NIAID T32AI007077에 의해 부분적으로 지원되었습니다. SEB와 MKE는 NIAID U19AI116497-05에 의해 지원되었습니다. 우리는 유용한 토론을 위한 Tufts 대학 의과 대학에 Mecsas 실험실, Ng 실험실 및 박사 이스버그의 일원에게 감사합니다. 공초점 화상 진찰은 신경과학 연구를 위한 Tufts 센터, P30 NS047243에서 수행되었습니다.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics