Индуцированная дифференциация M-клеточных клеток в стволовой клетке человека производные Ileal Enteroid Monolayers

Immunology and Infection
 

Summary

Этот протокол описывает, как вызвать дифференциацию M-клеток в стволовых клетках человека полученных илеальных монослойных и методов для оценки их развития.

Cite this Article

Copy Citation | Download Citations

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (микросклад) клетки кишечника функционируют для транспортировки антигена из апикального проема в основные патчи Пейера и ламинальные проприии, где находятся иммунные клетки, и, следовательно, способствуют слизистой оболочке иммунитета в кишечнике. Полное понимание того, как M клетки дифференцировать в кишечнике, а также молекулярные механизмы поглощения антигена M клеток не хватает. Это потому, что M клетки являются редкой популяции клеток в кишечнике и потому, что в пробирке модели для M клеток не являются надежными. Открытие самообновляющейся системы культуры стволовых клеток кишечника, называемой энтероидами, дало новые возможности для культивирования Клеток М. Энтероиды являются выгодными по сравнению со стандартными культивированными клеточными линиями, потому что они могут быть дифференцированы на несколько основных типов клеток, найденных в кишечнике, включая клетки кубок, клетки Панета, энтероэндокринные клетки и энтероциты. Цитокин RANKL имеет важное значение в развитии M клеток, и добавление RANKL и TNF-я в культурные носители способствует подмножество клеток из илеальных энтероидов дифференцироваться в M-клетки. Следующий протокол описывает метод дифференциации M-клеток в трансвелле эпителиальной поляризованной монослойной системы кишечника с использованием человеческих илеаловых энтероидов. Этот метод может быть применен к изучению развития и функции M-клеток.

Introduction

M (микросклад) клетки специализированные кишечные эпителиальные клетки, найденные в основном в фолликуле связанных эпителия (FAE) кишечника над тонкими лимфоидными регионами называется Peyer патчи1. M клетки имеют короткие нерегулярные атикальные микровилли и глубоко invaginated на их базолутеральной стороне, которая позволяет иммунные клетки, чтобы проживать близко к их клеточному телу2. Эта уникальная морфология позволяет M-клеткам образец антигена из аптического просвета кишечника и доставить его непосредственно в основные иммунные клетки2. Таким образом, M клетки важны для иммунного наблюдения в кишечнике, но также могут быть использованы патогенами для входа в ламины propria1,2,3,4,5, 6,7.

Изучение M-клеток было затруднено несколькими факторами. Во-первых, M клетки находятся на низкой частоте в мыши и кишечнике человека8. В культурных клеточных системах, M-клеточные клетки были индуцированы, чтобы дифференцировать путем совместного культивирования поляризованной линии клеток аденокарциномы, Caco-2, либо с лимфоцитами B из патчей мыши Пейер или линии клеток В-клеток, Raji B9,10 . Это приводит к подмножество клеток Caco-2, которые выражают маркеры M-клеток Sialyl Lewis Антиген и UEA-1 в поляризованном эпителии9,10. (Эти маркеры также выражены на клетках кубок в кишечных тканях, поэтому в настоящее время реже используются в качестве окончательных маркеров M-клеток11,12.) Эта клеточная система Caco-2-M была использована для изучения поглощения частиц и транслокации бактерий13,14. Тем не менее, клетки Како-2 являются установленной клеточной линии от большой кишечной аденокарциномы с смешанным фактором, что различные источники клеток Caco-2 отображают различные фенотипы среди лабораторий15. Кроме того, они не могут полностью резюмировать уровни транскрипции истинных клеток M, так как им не хватает выражения известных в настоящее время маркеров M-клеток GP2 и SpiB16. Поэтому для изучения развития и функций клеток М необходимы дополнительные и более физиологически значимые модели культуры.

В течение последних десяти лет, поле enteroid полученных типовых систем кишечника быстро продвигается вперед от первоначального открытия, что кишечные стволовые клетки, полученные из кишечной биопсии человека может самопропагандировать и самообновления в культуре 17 Лет , 18. Важно, удаление факторов содействия стволовых клеток из средств роста позволяет этим культурам стволовых клеток дифференцироваться во многих типах клеток, найденных в кишечнике18. Кроме того, последние работы свидетельствуют о важности RANKL-RANK сигнализации в развитии M клеток в кишечнике19,20. Рецептор RANK является членом семейства Рецепторов TNF, который выражается на эпителиальных клетках-предшественниках в кишечнике19, в то время как RANKL (лиганд рецепторов RANK) высвобождается стромальными клетками патчей Пейера20. Так как эпителиальные типы клеток, присутствующие в ileal enteroids не производят RANKL, M-клеточная дифференциация в илеальных энтероидных культурах может быть вызвана добавлением RANKL в культуру сми21,22. Включение TNF в культурные медиа-медиа помогает поддерживать развитие M клеток в ileal enteroids23. Здесь мы описываем методы индуцирования дифференциации M-клеток в кишечных монослойах, полученных из человеческих илеальных энтероидов. Наши методы частично основаны на модификациях из следующих протоколов21,22,23.

Protocol

Все методы, описанные здесь, были одобрены МКБ Университета Тафтса и IRB.

1. Индуцирование M-клеточной дифференциации в монослойах, полученных из человека, илеоидных

ПРИМЕЧАНИЕ: Этот протокол использует илеал-энтероиды, полученные из биопсии тканей человека. Пожалуйста, обратитесь к опубликованным протоколам для методов о том, как расти и прохождения этих ячеек18,24. Следующие методы для разработки монослой были адаптированы из Зоу и др.24. Методы индуцирования M-клеток в культурах, полученных из илеила, были адаптированы из предыдущих отчетов21,22,23. Все работы выполняются в стерильной ткани культуры капюшони и инкубации находятся в капюшоне или ткани культуры инкубатора, как указано. Смотрите Таблица материалов, необходимых для подготовки илеал enteroid монослойных и различных средств массовой информации.

  1. Выращивайте илеальные энтериды в течение 4-10 дней во внеклеточной матрице (ECM) (см. ТаблицаМатериалов) (рисунок1),в зависимости от их внутренних темпов роста, прежде чем посеять на трансвеллы.
  2. Покрытие трансвелл мембран
    1. Поместите желаемое количество трансвелл в 24-ну хорошую пластину, создав двухкамерную систему.
    2. Разбавить ECM 25 раз в холодном стерильном фосфатно-буферном солей (PBS) и добавить 100 л холодного разбавленного раствора в каждой верхней камере на мембрану.
      ПРИМЕЧАНИЕ: ECM и разбавленный eCM раствор должны храниться на льду до непосредственного добавления.
    3. Обложка 24-хорошая пластина с крышкой и поместите пластину в инкубатор культуры ткани на 37 градусов по Цельсию в течение 2 ч, чтобы позволить ECM затвердевания на мембране.
    4. Через 2 ч снимите тарелку с инкубатора и поместите в капюшон культуры тканей. Используя стерильные пинцеты, инвертировать каждый трансвелл, чтобы аккуратно удалить оставшийся раствор. Разрешить мембраны к airdry в капоте с крышкой открытой в то время как клетки собираются (Шаги 1.3.1- 1.3.11).
  3. Диссоциирование илеаловых ветроидов на одиночные клетки
    1. Удалите пластину илеал-энтероидов из инкубатора и аккуратно удалите культуры носителей из каждого колодца путем вакуумной аспирации или с помощью пипетки.
      ПРИМЕЧАНИЕ: Одного колодца илеальных энтероидов, содержащего около 100 здоровых кист, достаточно для семени 1,5-2 скважины.
    2. Добавьте 500 л ледяного холода 0,5 мм этиленедиаминететраацетической кислоты (ЭДТА) к каждому колодцу, содержащему илеал-энтероиды, взвешенные в ECM, чтобы разбить ECM. Пипетка вверх и вниз энергично с P1000 пипетки установлен на 500 зл, чтобы разбить ECM тем самым выпуская илеал enteroids в раствор. Для улучшения растворения ECM, после пипетки, встряхните пластину энергично при 4 градусах по Цельсию в течение 30 мин.
    3. Соберите раствор из каждой скважины в конические трубки по 15 мл.
      ПРИМЕЧАНИЕ: Соберите до 10 скважин на коническую трубку 15 мл для оптимальной коллекции одноклеточных.
    4. Пеллетклетки в центрифуге при 140 х г и 4 кв кв в течение 5 мин. Пелле должен быть виден, но может быть легко выбит, поэтому медленно удалить супернатант вакуумной аспирации или с пипеткой.
      ПРИМЕЧАНИЕ: Если беспокоит потеря гранул и клеток, используйте пипетку и сохранить супернатант в отдельной трубке.
    5. Чтобы переварить тесные связи соединения и разбить ileal enteroids на одиночные клетки, resuspend гранулы в 500 л комнатной температуры трипсина на каждые 5 скважин, собранных в шаге 1.3.3. Используя P1000, пипетка вверх и вниз, чтобы дезагрегировать сгустки и инкубировать трубки в водяной бане 37 градусов по Цельсию в течение 5 минут или меньше.
      ПРИМЕЧАНИЕ: Оптимизация необходима для определения соответствующего количества времени, необходимого для инкубации труб, так что клетки разбиты, но не чрезмерно трипсинизированы до такой степени, что они умирают. Используйте трипан синий в шаге 1.3.9, чтобы убедиться, что клетки являются жизнеспособными после лечения трипсина.
    6. Добавьте 1 мл Расширенный DMEM/F12 с 10% фетальной сыворотки крупного рогатого скота (FBS) на 500 л трипсина, чтобы инактивировать трипсин.
    7. Пипетка вверх и вниз с P1000 набор на 500 Л л по крайней мере 50 раз против стороны конической трубки для дальнейшего дезагрегировать оставшиеся сгустки в одиночные клетки.
    8. Поместите 40 мкм ячейки ситечко на 50 мл конического и добавить 1 мл Расширенный DMEM / F12 с 10% FBS для мокрой ячейки ситечко. Pipette одноклеточной подвески от 15 мл конической на ситечко. Вымойте ситечко с 1 мл Расширенный DMEM / F12 с 10% FBS.
    9. Перенесите клетки, которые прошли через клеточный ситечко из конической 50 мл в новую коническую трубку 15 мл. Во время шага центрифугации 1.3.10 клеточные гранулы будут более легко видны в конической трубке 15 мл. Подсчитайте клетки с помощью гемоцитометра. Используйте синий Трипан, чтобы убедиться, что клетки все еще живы. Как правило, наблюдается жизнеспособность .
    10. При подсчете клеток, центрифуга клетки в новой трубке 15 мл при 400 х г и комнатной температуре в течение 5 мин. Клеточная гранула должна быть видна. Тщательно удалите супернатант с пипеткой, снова сохраняя супернатант в случае, если гранулы выбили.
    11. Подготовьте модифицированные средства полного роста25 (MCMGF) дополнены 10 мкм Y-27632. Приостанавливайте пеллетные клетки на уровне 2,5 х 105 ячеек/200 Л в MCMGF. Смотрите замечания в дискуссии об оптимизации числа посева клеток.
      ПРИМЕЧАНИЕ: MCMGF- СМИ Передовые DMEM/F12 с 75% L-Wnt3a условных носителей, 10% R-спондин условных средств массовой информации, 5% Noggin условных средств массовой информации, 1x B27 Дополнение, 1x N2 Дополнение, 1 мМ N-ацетилцистеин, 50 нг /мл мыши рекомбинантный EGF, 500 нМ A-8301, 10 нМ "Leu15"-Gastrin I, 10 мМ HEPES, 2 мМ GlutaMAX, и 1x пенициллин / стрептомицин (по желанию).
    12. Убедитесь, что мембраны с покрытием ECM, подготовленные в шаге 1.2, полностью высохли, как оценивается глазом. Вымойте верхнюю камеру 200 л MCMGF. Добавьте 200 л клеточного раствора в каждую верхнюю палату.
    13. Добавьте 700 л MCMGF с 10 мкм Y-27632 в каждую нижнюю палату. Поместите пластину в инкубатор культуры тканей 37 градусов с 5% CO2.
    14. После 1 дня роста, удалить средства массовой информации из верхней камеры и заменить на 200 л свежих MCMGF, чтобы предотвратить рост нескольких слоев клеток.
  4. Замена среды
    1. После того, как монослой ы 80% слияния, как правило, между днями 1-3 после посева, заменить basolateral средств массовой информации с дифференциацией средств (DM) для контроля скважин (см. шаг 1.4.2 для более подробной информации) или с M-клеток средств массовой информации для M ячейки индукционной скважин (см. шаг 1.4.3 для более подробной информации). Замените носители в верхней палате DM для обоих условий.
      ПРИМЕЧАНИЕ: DM является Расширенный DMEM / F12 с 5% Noggin условных средств массовой информации, 1x B27 Дополнение, 1x N2 Дополнение, 1 мМ N-ацетилцистеин, 50 нг/мл мыши рекомбинантный EGF, 500 нм M A-8301, 10 нМ (Leu15)-Gastrin I, 10 мМ HEPES буфер, 2 мМ GlutaMAX, и 1x Пенициллин/Streptomy optional (Streptomy ). M-клеточные носители DM дополнены 200 нг/мл RANKL и 50 нг/мл TNF.
    2. Для контрольных скважин, которые не должны содержать M-клетки, добавьте 200 Л Л DM в верхнюю камеру и 700 ЛЛ ДМ в нижнюю камеру.
    3. Чтобы вызвать M-клетки, добавьте 200 л DM в верхнюю камеру и 700 л М-клеточных носителей в нижнюю камеру.
    4. Заменяйте носители каждые 2 дня. Для управления скважинами замените DM в верхней и нижней палатах. Для скважин M-клеток замените DM в верхней камере и M-клеточные носители в нижней палате.
      ПРИМЕЧАНИЕ: К дню 7 пост-клеток посева, M клетки полностью индуцированных в монослойных.

2. Проверка m-дифференциации клеток qRT-PCR

ПРИМЕЧАНИЕ: Выполните следующую работу на стерильной БЕЗРНС скамейке. Ознакомьтесь с таблицей материалов для списка предпочтительных материалов для qRT-PCR.

  1. Удалите средства массовой информации из верхней и нижней камер и мыть верхнюю камеру 2x осторожно с 300 злицу комнатной температуры PBS.
  2. Добавьте 300 кЛ trizol к каждой верхней камере. Инкубировать при комнатной температуре 5 мин.
    ВНИМАНИЕ: Носите перчатки и защиту глаз при использовании Trizol, чтобы избежать контакта с кожей, как указано в инструкциях производителя.
  3. Между тем, этикетка микроцентрифуговых труб для каждой скважины и добавить 700 Зл Тизола к каждой трубе.
  4. Соберите клетку гомената путем pipetting вверх и вниз 3x мягко с P1000 и передать содержимое в соответствующую микроцентрифугую трубку. Вихрь для 5 с, чтобы смешать.
  5. Держите образцы при комнатной температуре еще 3 мин. Затем храните при -80 градусах по Цельсию до одного месяца.
  6. Следуйте стандартной методологии qRT-PCR для изоляции РНК, лечения DNase, обратной транскрипции и qRT-PCR реакций. Ссылайтесь на список грунтовок в таблице материалов.

3. Проверка M-клеточной дифференциации с помощью иммунофлуоресценции

ПРИМЕЧАНИЕ: Всегда держите нижнюю палату пластины заполнены PBS так, что мембраны остаются влажными. Эта процедура проводится на скамейке запасных. См Таблица материалов для списка предпочтительных материалов для иммунофлуоресценции.

  1. Удалите средства массовой информации из верхней камеры и мыть 2x осторожно с 300 злител комнатной температуры PBS. Добавьте в верхнюю камеру 100 qL комнатной температуры 4% PFA в PBS. Накройте тарелку фольгой и дайте постоять 25 мин при комнатной температуре. Удалите 4% PFA.
    ВНИМАНИЕ: 4% ПФА должны быть надлежащим образом утилизированы в качестве опасных химических отходов.
  2. Вымойте верхнюю камеру 3x с 300 зл комнатной температуры PBS. На этом этапе образцы могут оставаться при 4 градусах Цельсия в течение месяца до окрашивания. После того, как окрашенные, образцы должны быть визуализированы в течение недели для лучшего качества изображений.
  3. Инкубировать монослой со 100 зл и 5% крупного рогатого скота сыворотки Альбумин (BSA) растворяется в PBS в течение 30 минут в темноте при комнатной температуре, чтобы блокировать монослой.
  4. Подготовка GP2 первичного антитела раствор в 1% BSA в PBS при разбавлении 1:100. Добавьте 100 л на колодец. Пятно на 1 ч при комнатной температуре в темноте. Удалите раствор.
    ПРИМЕЧАНИЕ: Не пронизайте монослой до первичного пятна для GP2 происходит потому, что оптимальное первичное окрашивание поверхности GP2 M-клеток достигается без пронизы.
  5. Вымойте верхнюю камеру 3 раза с 300 зл комнатной температуры PBS.
  6. Подготовка вторичного пятно в растворе флуоресцентно помечены коза анти-мышь IgG в 1:200, фаллоидин в 1:100 и DAPI в 1% BSA ' 0,1% тритон в PBS. Добавьте 100 л на колодец. Пятно в течение 30 минут при комнатной температуре в темноте.
    ПРИМЕЧАНИЕ: Тритон добавляется к вторичному раствору пятна, чтобы проницать клетки во время этого шага для надлежащего пятна фаллоидина.
  7. Вымойте 3x с 300 Л Л PBS.
  8. Поместите на стеклянную горку каплю монтажного раствора на 5 л л (Таблицаматериалов. Удалите колодец из 24 хорошо пластины и инвертировать. Аккуратно вырежьте мембрану из колодца с помощью скальпеля. Поместите мембрану с клетками, обращенными на каплю монтажного раствора на стеклянной горке. Добавьте 10 зликатмонтажного раствора на верхнюю и центральную мембрану и поместите крышку сверху, чтобы запечатать мембрану между стеклянной горкой и крышкой.
  9. Сухие горки при комнатной температуре в темноте в течение 24 ч. Окрашенные слайды должны быть визуализированы на конфокальном микроскопе в течение 1 недели после окрашивания.

Representative Results

Ileal enteroids, выращенные в ECM, анализируются визуально и qRT-PCR для их относительного состояния здоровья и дифференциации как средства контроля качества для илеальных энтероидных культур и для использования в монослойных. Недифференцированные илеалэнтоиды, выращенные в ECM, кажутся прозрачными и кистозными в морфологии, что указывает на наличие многих стволовых клеток(рисунок 1A). Со временем, недифференцированные ileal enteroids, выращенные в средствах роста может взять на промежуточный фенотип, где некоторые будут появляться кистозные, а некоторые появляются непрозрачные (Рисунок 1B). Часто наши недифференцированные образцы напоминают те, которые показаны на рисунке 1B, а не на рисунке 1A. Эти промежуточные культуры содержат более неизлечимо дифференцированные энтероциты, измеряемые выражением маркера энтероцита, sucrase isomaltase (SI), и предположительно экструдированные мертвые энтероциты в просвете способствуют их плотному внешнему виду. Ileal enteroids могут быть использованы в этом промежуточном состоянии для развития монослой, но следует иметь в виду, что количество кишечных стволовых клеток, присутствующих в культурах, может быть низким, и некоторые дифференцированные типы клеток могут присутствовать (например, см. qRT-PCR уровни в недифференцированных образцах, выращенных в ECM, напоминающих рисунок 1B на рисунке 2). Для сравнения, ileal enteroids культивируется с дифференциацией средств массовой информации в ECM в течение 5 дней появится равномерно потемнело и лобкулярных и культур с этой морфологии не являются хорошими кандидатами для посева монослойных(рисунок 1C).

Выражение генов стволовых клеток и генов дифференциации кишечных клеток может быть проанализировано qRT-PCR как еще одно средство оценки состояния здоровья илеаловых энтероидов, выращенных в ECM, и их возможностей дифференциации, когда-то посеянных в качестве монослойных на трансвеллах. Выражение гена стволовых клеток, LGR5, ген энтероцита, SI, ген клетки кубок, MUC2, и ген клетки Paneth, LY ,сравнивается между недифференцированными илеал энтероидных культур, выращенных в ECM и дифференцированных илеал энтероидные монослои при наличии или отсутствии РАНКЛ/ТНФЗ(рисунок 2). Хотя значения могут отличаться между экспериментами, выражение LGR5 должно уменьшаться после дифференциации монослоев18,26. Выражение LGR5 обычно не обнаруживается в дифференцированных монослойных илебезмых без RANKL и TNF' на 7-й день. И наоборот, выражение маркеров дифференциации конкретных типов клеток, таких как SI и MUC2, увеличивается после дифференциации18. Выражение ЛИЗ обычно уменьшается после дифференциации в наших культурах. Если илеал энтероидных культур, используемых для принятия монослоев больше похожи на Рисунок 1B, чем Рисунок 1A, увеличение кишечной дифференциации маркеров может быть скромным после дифференциации, потому что эти первоначальные культуры неоднородны в типы кишечных клеток и имеют более высокий базальный уровень СИ и MUC2. Однако дифференциация в монослойных слоях по-прежнему происходит по оценке потери экспрессии LGR5 и микроскопии (см. ниже). Кроме того, добавление RANKL и TNF в медиадифференциацию уменьшает потерю экспрессии LGR5 (рисунок 2). Параллельно, выражение SI и MUC2 немного ниже, чем в дифференцированном состоянии, не хватает RANKL и TNF, хотя их уровни увеличиваются выше недифференцированного состояния.

Дифференциация M клеток в монослойах определяется как qRT-PCR и иммунофлуоресценции с использованием двух M клеток конкретных маркеров, включая гликопротеин поверхности клетки 2 (GP2) и транскрипционный фактор SpiB21. Выражение GP2 и SPIB регулируется в илеал-энтероидных монослойных в присутствии РАНКЛ и ТНФЗ и не обнаруживается в обработанных образцах, не входящих в РАНКЛ и ТНФЗ (Рисунок 3). Выражение этих маркеров также может быть нормализована до куска тонкой ткани кишечника22, если таковые имеются. Это позволяет сделать изменение этих маркеров M-клеток, сравнимых с тканью, которая имеет M-клетки, а не для контроля монослойных, которые не имеют выражения этих маркеров и позволяет стандартизировать между экспериментами в одной лаборатории. M клетки также обнаруживаются поверхностное выражение GP2 иммунофлуоресценции(рисунок 4). Как правило, в сопливой монослой, от 1 до 5 М клетки наблюдаются в данном поле микроскопа на 40X увеличение дней с 6 по 8 после посева в образцах, обработанных с RANKL и TNF (Рисунок 4A-D). В необработанных образцах(рисунок 4E)не видно выражения GP2. Ортогональное представление плоскости X', наложенной фаллоидиным зондом, показывает структуры актина, окружающие каждую клетку, и выражение GP2 на апиктической поверхности m-клеток(рисунок 4F-G). Эта модель резюмирует низкую частоту M клеток,найденных в кишечнике человека 1,2,8. Для очистки и изоляции m-клеток для дальнейшего изучения, M-клетки могут быть окрашены с помощью экспрессии поверхности GP2 и отсортированы с помощью FACS для клеток GP2.

M-клетки связываются и транспортируют антиген из просвета кишечника в иммунные клетки, проживающие под эпителием2. Секретор igA производится в кишечнике связывается с бактериями и может связываться с актической поверхности M клеток для облегчения транспортировки микробов27,28. Чтобы определить, способны ли M-клетки, разработанные в этой модели, связываться с IgA, в верхнюю камеру добавляется сыворотка человека IgA, разрешенная для связывания в течение 1 ч, после чего монослои готовятся к иммунофлуоресценционному анализу. Присутствие IgA на M-клетках визуализировано с помощью флюора-конъюгированного вторичного антитела, которое распознает тяжелую цепь человеческой сыворотки IgA. M клетки, обработанные IgA в течение 1 ч имеют IgA связаны с афикальной поверхности (Рисунок 5A), в то время как M клетки в контрольных скважин, которые были обработаны только с вторичным антителом IgA не имеют обнаруживаемого сигнала (Рисунок5B). Кроме того, IgA специально связывается с актической поверхностью M-клеток и не обнаруживается связанным с любыми клетками, не имеющими поверхностного пятна GP2. Кроме того, M-клетки имеют характерно более короткий плотный актин на их апической поверхности2. Для анализа морфологии M-клеток в этой модели, илеал энтероид полученных монослой выращивается в течение 7 дней и собирают для иммунофлуоресценции анализа F-актина с использованием фаллоидина. Измерения интенсивности пикселей актина рассчитываются для M-клеток и для не-M-клеток, которые непосредственно примыкают к каждой ячейке M с помощью программного обеспечения ImageJ(рисунок 6A). Интенсивность действия снижается на клетках GP2'M в этой модели, а репрезентативное изображение отображается на рисунке 6B. В целом, M-клетки, разработанные в этой модели монослойного монослойного микроэлемента, полученных из илеоловых, имеют характерную экспрессию генов, морфологию и некоторые функции Клеток М человека, такие как связывание с IgA.

Figure 1
Рисунок 1: Представитель морфологии человека илеал энтероидов в ECM одну неделю после расщепления. (A) Ясные и кистозные недифференцированные илеалвейные энтериды. (B) Промежуточный фенотип с некоторыми кистозными илеаловых энтероидов и некоторые непрозрачные лобкулярных илеаловых enteroids. (C) Потемнело и лобкулярной дифференцированных илеаловых enteroids. Изображения, сделанные через объектив оптического светового микроскопа при 4x увеличении с помощью камеры iPhone7. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Относительное выражение стволовых клеток и маркеры дифференциации человеческих илеаловых энтероидов, выращенных в ECM или дифференцированных как монослои. Ileal enteroids были выращены в течение 7 дней в ECM (недифференцированные) или выросли и дифференцированы как монослои без (дифференцированный) или с RANKL и TNF (Дифференцированный R/T). Илеал энтероидных культур или монослой были собраны в Trizol для извлечения РНК. Выражение гена было определено qRT-PCR и выражается относительно GAPDH. Данные в среднем 3 независимых скважины илеал-энтероидов или монослой ных спойлов на одно состояние. Ошибки баров показывают SEM. ND не обнаружен. Статистическая значимость определялась на значениях, преобразованных в журнале, с помощью односторонней ANOVA с тестом несколько сравнений Даннетта по сравнению с недифференцированным. Р-л; 0,01, п.л.; 0,001 Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Относительное выражение M-клеточных специфических маркеров GP2 и SPIB от человеческих илеаловых энтероидных монослойов. РАНКЛ/ТНФЗ, обработанные и необработанные человеческими илеалами, были собраны в Тризоле для извлечения РНК после 7 дней после посева. Выражение гена было определено qRT-PCR и выражается относительно GAPDH. Данные в среднем 6 независимых монослойных на состояние. Ошибки баров показывают SEM. ND не обнаружен. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Иммунофлуоресценция поверхностного экспрессии GP2 на M-клетках в человеческих илеаловых энтероидных монослойах с течением времени. RANKL/TNF' обработанные и необработанные человеческие илеидные энтероидные монослои были зафиксированы в 4% ПФА и окрашены для иммунофлуоресценции в различные указанные дни после посева. Изображения были проанализированы с помощью программного обеспечения ImageJ. DAPI - Синий; Гликопротеин 2 (GP2) - красный. (A-D) РАНКЛ/ТНФЗ лечили монослой в разные дни после посева. (E) Необработанный монослой, собранный в день 7 после посева. (F-G) Ортогональный ХЗ плоскости монослойных на 7 день после посева накладывается с фаллоидиина зонд для F-актина. Фаллоидин и циан. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: IgA связывается специально с актической поверхностью m-клеток. RANKL/ TNF'-обработанные человека илеол-выведенных монослойов были выращены в течение 7 дней, а затем (A) лечение с 10 мкг человеческой сыворотки IgA в течение 1 ч или ( B ) макет-обработанных с PBS только (Нет IgA управления). После 1 ч, монослой были промыты 2x в PBS, были зафиксированы в 4% PFA, permeabilized с 0.1% TritonX-100, и окрашенные для иммунофлюоресценции. Изображения были проанализированы с помощью программного обеспечения Image J и являются репрезентативными для 3 независимых экспериментов. DAPI - Синий; Гликопротеин 2 (GP2) - красный; Антитела к человеческой сыворотке IgA и зеленый; Фаллоидин и циан. Черные стрелки обозначают IgA, привязанную к актической поверхности M-клетки. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 6
Рисунок 6: M клетки снизили интенсивность актина по сравнению с соседними не-M клеток. RANKL/TNF'-обработанные человека илеол-выведенных монослойов были выращены в течение 7 дней, а затем фиксированной в 4% ПФА и были окрашены для иммунофлуоресценции. (A) Использование ImageJ, GP2 "M клетки были изложены с помощью freehand выбор инструмент и измерения области и комплексной плотности были приняты в канале Phalloidin. Затем был завершен тот же анализ для каждой соседней ячейки, не являющейся M-ячейкой, которая соседствует с ячейкой M. Сырье Интегрированная плотность была разделена на площадь каждой отдельной ячейки для нормализации. Средняя интегрированная плотность/область была рассчитана для каждой прилегающей ячейки, не относясь к M для каждой ячейки M. Изображения были проанализированы из 3 независимых экспериментов; каждая точка m ячейки или среднего соседних ячеек. Бары ошибок указывают на SD. Статистическая значимость была определена на значениях, преобразованных журналом, с помощью теста Paired t. р 0.0001 (B) Представитель изображение самолета X' из сюжета в A. Images были проанализированы с помощью программного обеспечения ImageJ. DAPI - Синий; Гликопротеин 2 (GP2) - красный; Фаллоидин и циан. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Discussion

Для разработки монослойных, которые правильно дифференцируются в основные типы клеток кишечника и M-клеток, очень важно быть в курсе нескольких факторов. Ileal enteroids должны быть собраны из ECM культур, которые являются недифференцированными и имеют высокую долю lgr5 "стволовых клеток. Визуально, большинство ileal enteroids в культурах ECM не должны быть затемнены и многолобулярны, и выражение LGR5 должно быть обнаружено в этих культурах с помощью анализа qRT-PCR. Контроль качества условных носителей имеет важное значение для распространения недифференцированных культур с течением времени и должен быть завершен для каждой партии условных носителей, которые производятся. Контроль качества может быть завершен путем тестирования новой партии носителей на некоторых культурах ECM и сравнения морфологии илеал-энтероидов с предыдущей партией носителей в течение недели. Выражение LGR5 должно оставаться относительно похожим в илеалэнтерных культур, выращенных в новой партии носителей по сравнению с предыдущей партии.

При подготовке илеальных энтероидов для посева в качестве монослойных, важно энергично пипетку клеточного раствора после инкубации с трипсином, чтобы разбить ileal enteroids на одиночные клетки. Клеточные комки могут привести к многослойной образованию при посеве для монослойных. Кроме того, важно эмпирически определить количество клеток, необходимых для формирования монослой для каждого отдельного ileal enteroid линии, которая получена. Как правило, это значение может варьироваться от 2,5 х 105 - 5,0 х 105 клеток / хорошо, но зависит от степени кистозных до некистовых илеаловых enteroids в культурах и варьируется для каждого отдельного ileal enteroid линии. Из опыта, ileal enteroids, выращенных в ECM, которые появляются менее кистозные требуют более высокой плотности посева клеток для достижения монослойных. Целесообразно помыть верхнюю камеру после 1 дня роста, аккуратно пайпетируя средства массовой информации вверх и вниз в 2-3 раза и заменив свежими средствами роста. Этот процесс вытесняет клетки, которые приземлились на другие клетки, уменьшая вероятность многослойного образования. Переключение средств массовой информации в верхней палате от роста средств массовой информации для M-клеток средств массовой информации, когда монослой в 80% сливов, которые обычно происходят в день 2 после посева, помогает достичь хорошей дифференциации M ячейки. Добавление RANKL/TNF в верхнюю камеру во время индукции M-клеток не приводит к развитию большего числа M-клеток на монослой и, следовательно, может быть исключено из среды верхней камеры. Трансвеллы различных размеров пор могут быть использованы в этом протоколе, не влияя на развитие M ячейки; однако, плотность посева клеток должна быть оптимизирована для тех, кто с большими размерами пор. Коллаген IV может быть заменен на ECM в качестве подвального мембранного протеинового покрытия для трансвелл или хорошо пластин, которые могут быть лучше подходят для некоторых приложений.

Илеал-энтероид-производные монослой на трансуэллах обеспечивают двухкамерную систему, которая позволяет создавать определенные апикальные и базолатеральные поверхности таким образом, что 4-5 различных типов эпителиальных клеток кишечника могут поляризовать, чтобы выразить поверхностные маркеры на каждом стороны по отношению к тому, что находится в кишечнике. К любой стороне могут быть добавлены дополнительные факторы, такие как частицы, инфекционные агенты или другие типы клеток. Однако на сегодняшний день некоторые ограничения остаются. Как описано, эта система является статическая система, которая не хватает физиологического потока, кишечных сокращений, и содержимое кишечника. Кроме того, архитектура виллуса-крипта теряется в результате образования плоского монослойа. Эти системы не имеют патч регионов Пейер, иммунные клетки, и стромальные клетки. Ли отсутствие иммунных и стромальных клеток, проживающих тесно под M клеток влияет на вагинации, которые не наблюдаются в этой системе и других физиологических функционирования является важной будущей области исследования. Этот протокол может быть адаптирован к 96-ну хорошо пластины или многоколодцв формат пластины. Процедура покрытия 96-ну хорошей пластины ECM и посева с одиночными клетками из илеальных энтероидов остается такой же, как и для трансвелл. Титрация плотности посева клетки, необходимых для получения монослойных должно быть сделано, но, как правило, колеблется от 1,0 х 105 - 3,0 х 105 клеток / хорошо в 96-колодец формата пластины. M клетки индуцируются путем замены роста средств массовой информации с М ячейки средств массовой информации, когда монослой 80% слияния, как правило, в дни 1-3 в зависимости от первоначальной плотности посева клеток.

Этот метод дифференциирования M-клеток от илеальных энтеридов in vitro обеспечивает значительные улучшения по сравнению с методом Caco-2. Ileal enteroids являются первичными клетками и по крайней мере 4-5 типов эпителиальных клеток присутствуют в системе. Кроме того, ileal enteroid линий, полученных от разных людей могут быть изучены, чтобы исследовать, как генетика или состояние болезни влияние Развития и поведения Клеток M. Дополнительные манипуляции илеал-энтероидов во время дифференциации M ячейки позволит лучше понять развитие M ячейки в том числе характеристики M клеток-прекурсоров. Наконец, поскольку молекулярные механизмы фagoцитоза ИКТитозаИ. до сих пор не до конца поняты 3,29,эта модель дает возможность изучить и визуализировать поглощение антигена и частиц M-клетками.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Эта работа была поддержана НИАИД U19AI131126 д-ру Исбергу (Медицинская школа Туфтского университета) и д-ром Капланом (Университет Тафтса); (JM является лидером проекта 2) и NIAID R21AI128093 в JM. ACF была частично поддержана NIAID T32AI007077. SEB и MKE были поддержаны NIAID U19AI116497-05. Мы благодарим сотрудников лаборатории Mecsas, лаборатории Ng и доктора Исберга из Медицинской школы Университета Тафтса за полезные обсуждения. Конфокальная визуализация была выполнена в Центре неврологии Тафтса, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics