Diferenciação induzida de pilhas de M cell-like em monolayers Enteroid ileal derivado da pilha de haste humana

Immunology and Infection
 

Summary

Este protocolo descreve como induzir a diferenciação de pilhas de M em monocamadas ileal derivado da pilha de haste humana e em métodos para avaliar seu desenvolvimento.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

As pilhas de M (microfold) da função do intestino para transportar o antígeno do lúmen apical aos remendos de Peyer e ao própria subjacentes do lamina onde as pilhas imunes residem e contribuem conseqüentemente à imunidade Mucosal no intestino. Uma compreensão completa de como as pilhas de M diferenciam no intestine assim como os mecanismos moleculars da tomada do antígeno por pilhas de M faltam. Isto é porque as pilhas de M são uma população rara das pilhas no intestino e porque in vitro os modelos para pilhas de M não são robustos. A descoberta de um sistema self-renovando da cultura de pilha de haste do intestino, denominado enteroids, forneceu possibilidades novas para cultivar pilhas de M. Os enteroids são vantajosos sobre linhas de pilha cultivadas padrão porque podem ser diferenciados em diversos tipos principais da pilha encontrados no intestine, incluindo pilhas do cálice, pilhas de Paneth, pilhas enteroendócrinas e enterocytes. O citocinas RANKL é essencial no desenvolvimento da pilha de m, e a adição de RANKL e de TNF-α aos meios de cultura promove um subconjunto das pilhas dos enteroids ileal para diferenciar-se em pilhas de m. O seguinte protocolo descreve um método para a diferenciação de pilhas de M em um sistema polarizado epithelial do monoolayer do transwell do intestino usando enteroids ileal humanos. Este método pode ser aplicado ao estudo do desenvolvimento e da função da pilha de M.

Introduction

As pilhas de M (microfold) são as pilhas epithelial intestinais especializadas encontradas primeiramente no epitélio associado do folículo (FAE) do intestino que sobrejacente as regiões lymphoid pequenas denominadas remendos de Peyer1. As pilhas de M têm microvilosidades apical irregular curto e são invaginated profundamente em seu lado basolateral, que permite que as pilhas imunes residam pròxima a seu corpo de pilha2. Esta morfologia original permite que as pilhas de M amostrem o antígeno do lúmen apical do intestine e entregam-na diretamente às pilhas imunes subjacentes2. Desta forma, as células M são importantes para a vigilância imunológica no intestino, mas também podem ser exploradas por patógenos para a entrada na lâmina própria1,2,3,4,5, 6,7.

O estudo das células M tem sido dificultado por vários fatores. Primeiramente, as pilhas de M são encontradas em uma baixa freqüência no rato e no intestino humano8. Em sistemas de células cultivadas, células M semelhantes à célula foram induzidas a diferenciar-se por coculturar uma linha celular de adenocarcinoma polarizado, Caco-2, com linfócitos b de patches do mouse Peyer ou a linha celular linfoma de células b, rios b9,10 . Isso resulta em um subconjunto de células caco-2 que expressam os marcadores de célula M sialyl Lewis um antígeno e UEA-1 no epitélio polarizado9,10. (Esses marcadores também são expressos em células de cálice em tecidos intestinais, portanto, hoje em dia são menos freqüentemente usados como marcadoresdecélulas M definitivos11,12.) Este sistema de células caco-2-M tem sido utilizado para estudar a captação de partículas e a translocação de bactérias13,14. No entanto, as células caco-2 são uma linha celular estabelecida a partir de um grande adenocarcinoma intestinal com o fator de confundimento que diferentes fontes de células caco-2 exibem diferentes fenótipos entre os laboratórios15. Além disso, eles não podem recapitular totalmente os níveis de transcrição das verdadeiras células M, pois não possuem expressão de marcadores de células M atualmente conhecidos GP2 e SpiB16. Conseqüentemente, os modelos adicionais e mais fisiologicamente relevantes da cultura são necessários para poder estudar o desenvolvimento e as funções da pilha de M.

Dentro dos dez anos passados, o campo de sistemas modelo enteroid-derivados do intestino tem progredido ràpida para a frente da descoberta inicial que as pilhas de haste intestinais derivadas da biópsia intestinal humana poderiam Self-propagar e self-Renew na cultura 17 anos de , 18. importante, a remoção da pilha de haste que promove fatores dos meios do crescimento permite que estas culturas da pilha de haste diferenciem nos muitos tipos da pilha encontrados no intestine18. Além disso, o trabalho recente sugere a importância do RANKL-Rank que sinaliza no desenvolvimento da pilha do M no intestine19,20. O receptor RANK é um membro da família de receptores TNF que é expresso em células precursoras epiteliais no intestino19 enquanto RANKL (o ligand do receptor Rank) é liberado por células estromais dos patches de Peyer20. Uma vez que os tipos de células epiteliais presentes nos enteroides ileal não produzem RANKL, a diferenciação das células M em culturas de enteroides ileal pode ser induzida pela adição de RANKL aos meios de cultura21,22. A inclusão de TNFα nos meios de cultura ajuda a apoiar o desenvolvimento de células M em enteroids ileal23. Aqui, nós descrevemos os métodos para induzir a diferenciação de pilhas de M em monocamadas intestinais derivados dos enteroids ileal humanos. Nossos métodos são baseados em parte em modificações dos seguintes protocolos21,22,23.

Protocol

Todos os métodos descritos aqui foram aprovados pelo Tufts University IBC e IRB.

1. induzindo a diferenciação de células M em monolayers derivados de Enteroides ileal humano

Nota: Este protocolo usa enteroids ileal derivados da biópsia humana do tecido. Refira por favor os protocolos publicados para métodos em como crescer e passagem estas pilhas18,24. Os seguintes métodos para o desenvolvimento de monocamadas foram adaptados de Zou et al.24. Métodos para induzir células M em culturas derivadas de enteroides ileal foram adaptados de relatos anteriores21,22,23. Todo o trabalho é realizado em uma capa estéril da cultura do tecido e as incubações estão na capa ou na incubadora da cultura do tecido como indicado. Veja a tabela de materiais necessários para preparar monocamadas enteroid ileal e várias mídias.

  1. Cultivar enteroides ileal por 4-10 dias na matriz extracelular (ECM) (ver tabela de materiais) (Figura 1), dependendo de suas taxas de crescimento intrínsecas, antes da semeadura para transpoços.
  2. Membranas de transpoços de revestimento
    1. Coloque o número desejado de transpoços em uma placa de 24 poços criando um sistema de duas câmaras.
    2. Diluir ECM 25 vezes em soro fisiológico tamponado a frio (PBS) e adicionar 100 μL de solução diluída a frio em cada câmara superior na membrana.
      Nota: O ECM e a solução diluída do ECM devem ser mantidos no gelo até imediatamente antes da adição.
    3. Cubra a placa 24-well com tampa e coloc a placa em uma incubadora da cultura do tecido em 37 ° c para 2 h para permitir a solidificação do ECM na membrana.
    4. Após 2 h, retire a placa da incubadora e coloque em uma capa de cultura de tecido. Usando tweezers estéreis, inverta cada transwell para remover delicadamente a solução restante. Permitir que as membranas para secar no capô com a tampa aberta enquanto as células estão sendo coletadas (etapas 1.3.1-1.3.11).
  3. Dissociando os enteroids ileal em únicas pilhas
    1. Retire a placa de enteroids ileal da incubadora e remova delicadamente os meios de cultura de cada poço pela aspiração do vácuo ou com uma pipeta.
      Nota: Um poço de enteroids ileal que contêm aproximadamente 100 quistos saudáveis é suficiente para semear 1.5-2 poços.
    2. Adicionar 500 μL de gelo frio 0,5 mM ácido etilenodiaminotetracético (EDTA) a cada poço contendo enteroids ileal suspensos em ECM para romper o ECM. Pipeta acima e para baixo vigorosamente com um pipetador P1000 ajustado em 500 μl para quebrar acima do ECM que libera assim enteroids ileal na solução. Para melhorar a dissolução do ECM, após a pipetagem, agitar vigorosamente a placa a 4 ° c durante 30 min.
    3. Colete a solução de cada poço em tubos cônicos de 15 mL.
      Nota: Colete até 10 poços por tubo cônico de 15 mL para a coleção de célula única ideal.
    4. Pellet as células em uma centrífuga em 140 x g e 4 ° c por 5 min. pellet deve ser visível, mas pode ser facilmente desalojada, assim remover lentamente o sobrenadante por aspiração a vácuo ou com uma pipeta.
      Nota: Se estiver preocupado com a perda de pelotas e células, use uma pipeta e salvar o sobrenadante em um tubo separado.
    5. Para digerir ligações de junção apertadas e separar os enteroides ileal em células únicas, ressuscite o pellet em 500 μL de tripsina de temperatura ambiente por cada 5 poços recolhidos na etapa 1.3.3. Usando um P1000, pipeta para cima e para baixo para desagregar os aglomerantes e incubar os tubos em um banho de água de 37 ° c por 5 min ou menos.
      Nota: A otimização é necessária para determinar a quantidade apropriada de tempo necessária para incubar os tubos de modo que as células são quebradas, mas não mais-trypsinized ao ponto que eles morrem. Use o azul de trypan na etapa 1.3.9 para assegurar-se de que as pilhas sejam viáveis após o tratamento do tripsina.
    6. Adicione 1 mL de DMEM/F12 avançado com soro bovino fetal a 10% (FBS) por 500 μL de tripsina para inactivar a tripsina.
    7. Pipeta acima e para baixo com um P1000 ajustado em 500 μL pelo menos 50 vezes de encontro ao lado do tubo cônico para desagregar ainda mais aglomerados restantes em únicas pilhas.
    8. Coloque um filtro de células de 40 μm sobre um 50 mL cônico e adicione 1 mL de DMEM/F12 avançado com 10% de FBS para molhar o filtro da pilha. Pipete a suspensão de uma única célula da cónica de 15 mL para o filtro. Lave o filtro com 1 mL de DMEM/F12 avançado com 10% de FBS.
    9. Transfira as células que passaram pelo filtro da célula do 50 mL cônico em um novo tubo cônico de 15 mL. Durante a etapa de centrifugação 1.3.10, o pellet celular será mais facilmente visto em um tubo cônico de 15 mL. Conte as células usando um Hemocytometer. Use o azul de trypan para verificar se as células ainda estão vivas. Normalmente, > 95% de viabilidade é observada.
    10. Ao contar as células, Centrifugue as células no novo tubo de 15 mL a 400 x g e temperatura ambiente durante 5 min. a pelota da pilha deve ser visível. Retire cuidadosamente o sobrenadante com uma pipeta, salvando novamente o sobrenadante caso a pelota se torne desalojada.
    11. Prepare o meio de crescimento completo modificado25 (mcmgf + Media) suplementado com 10 μm Y-27632. Ressuscitou células peletizadas em 2,5 x 105 células/200 ΜL em MCMGF +. Consulte observações em discussão sobre como otimizar o número de propagação de células.
      Nota: MCMGF + Media é Advanced DMEM/F12 com 75% L-Wnt3a condicionado mídia, 10% R-spondin mídia condicionada, 5% Noggin mídia condicionada, 1x B27 suplemento, 1x N2 suplemento, 1 mM N-acetilcisteína, 50 ng/mL mouse recombinante EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin 10 mM HEPES, 2 mM GlutaMAX, e 1x penicilina/estreptomicina (opcional).
    12. Assegure-se de que as membranas revestidas com ECM preparadas na etapa 1,2 tenham sido totalmente secas, conforme avaliado por olho. Lave a câmara superior com 200 μL de MCMGF +. Adicionar 200 μL de solução celular em cada câmara superior.
    13. Adicionar 700 μL de MCMGF + com 10 μM Y-27632 a cada câmara inferior. Coloc a placa em uma incubadora da cultura do tecido de 37 ° c com 5% CO2.
    14. Após 1 dia de crescimento, retire a mídia da câmara superior e substitua por 200 μL de MCMGF + fresco, para evitar o crescimento de múltiplas camadas de células.
  4. Substituindo o meio
    1. Uma vez que os monocamadas são ~ 80% confluente, geralmente entre dias 1-3 borne-semeando, substitua meios basolateral com meios da diferenciação (DM) para poços de controle (veja a etapa 1.4.2 para mais detalhe) ou com meios da pilha de m para poços da indução da pilha de m (veja a etapa 1.4.3 para mais detalhe). Substitua a mídia na câmara superior com DM para ambas as condições.
      Nota: DM é Advanced DMEM/F12 com 5% Noggin mídia condicionada, 1x B27 suplemento, 1x N2 suplemento, 1 mM N-acetilcisteína, 50 ng/mL mouse recombinante EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES buffer, 2 mM GlutaMAX, e 1x penicilina/estreptomicina (opcional ). Os meios da pilha de M são DM suplementados com 200 ng/mL RANKL e 50 ng/mL TNFα.
    2. Para os poços de controle que não devem conter células M, adicionar 200 μL de DM para a câmara superior e 700 μL DM para a câmara inferior.
    3. Para induzir as células M, adicionar 200 μL de DM para a câmara superior e 700 μL de mídia celular M para a câmara inferior.
    4. Substitua a mídia a cada 2 dias. Para poços de controle, substitua DM nas câmaras superior e inferior. Para poços de células M, substitua DM na câmara superior e mídia de célula M na câmara inferior.
      Nota: Por dia 7 post Cell-semeadura, células M são totalmente induzidas nas monocamada.

2. verificando a diferenciação de células M por qRT-PCR

Nota: Realize o seguinte trabalho em um espaço de banco RNAse-livre estéril. Veja a tabela de materiais para uma lista de materiais preferidos para o qRT-PCR.

  1. Retire a mídia das câmaras superior e inferior e lave a câmara superior 2x suavemente com 300 μL de temperatura ambiente PBS.
  2. Adicionar 300 μL de Trizol a cada câmara superior. Incubar à temperatura ambiente durante 5 min.
    PRECAUÇÃO: use luvas e protecção ocular quando utilizar Trizol para evitar o contacto com a pele, conforme indicado nas instruções do fabricante.
  3. Entretanto, os tubos do microcentrifugador da etiqueta para cada poço e adicionam 700 μL de Trizol a cada tubo.
  4. Colete homogeneate de células pipetando para cima e para baixo 3x suavemente com um P1000 e transfira o conteúdo para o tubo de microcentrífuga correspondente. Vortex para 5 s para misturar.
  5. Mantenha as amostras à temperatura ambiente por um período adicional de 3 min. Em seguida, armazene a-80 ° c por até um mês.
  6. Siga a metodologia padrão do qRT-PCR para o isolamento do RNA, o tratamento de DNase, a transcrição reversa e as reações do qRT-PCR. Refira a lista da primeira demão na tabela de materiais.

3. verificando a diferenciação celular M por imunofluorescência

Nota: Mantenha sempre a câmara inferior da placa preenchida com PBS para que as membranas permaneçam molhadas. Este procedimento é realizado no banco. Consulte tabela de materiais para obter uma lista de materiais preferidos para a imunofluorescência.

  1. Retire a mídia da câmara superior e lave 2x suavemente com 300 μL de temperatura ambiente PBS. Adicionar 100 μL de temperatura ambiente 4% PFA em PBS à câmara superior. Cubra a placa com folha e deixe ficar por 25 min à temperatura ambiente. Remover 4% PFA.
    PRECAUÇÃO: o PFA de 4% deve ser devidamente eliminado como resíduo químico perigoso.
  2. Lave a câmara superior 3x com 300 μL de temperatura ambiente PBS. Neste ponto, as amostras podem permanecer a 4 ° c por até um mês antes da coloração. Uma vez manchada, as amostras devem ser visualizadas dentro de uma semana para imagens de melhor qualidade.
  3. Incubar as monocamadas com 100 μl de 5% de albumina sérica bovina (BSA) dissolvida em PBS por 30 min em escuro à temperatura ambiente para bloquear as monocamada.
  4. Prepare a solução de anticorpos primários GP2 em 1% BSA em PBS em uma diluição de 1:100. Adicionar 100 μL por poço. Mancha por 1 h à temperatura ambiente no escuro. Remova a solução.
    Nota: Não permeabilize as monocamadas antes que a mancha preliminar para GP2 ocorra porque a mancha preliminar óptima da superfície de GP2 de pilhas de M é conseguida sem Permeabilization.
  5. Lave a câmara superior 3x vezes com 300 μL de temperatura ambiente PBS.
  6. Prepare a solução secundária da mancha de IgG cDNAs etiquetado do anti-rato da cabra em 1:200, faloidina em 1:100 e em DAPI em 1% BSA + 0,1% Triton em PBS. Adicionar 100 μL por poço. Mancha por 30 min à temperatura ambiente no escuro.
    Nota: Triton é adicionado à solução secundária da mancha para permeabilize as pilhas durante esta etapa para a mancha apropriada do faloidina.
  7. Lave 3x com 300 μL de PBS.
  8. Coloque uma gota de 5 μL de solução de montagem (tabela de materiais) em um slide de vidro. Retire o poço da placa de 24 poços e inverta. Corte cuidadosamente a membrana do poço usando um bisturi. Coloque a membrana com as células voltadas para cima para a gota de solução de montagem na lâmina de vidro. Adicione 10 μL de solução de montagem na parte superior e central da membrana e coloque uma lamínula na parte superior para selar a membrana entre a corrediça de vidro e a lamínula.
  9. Seque as lâminas à temperatura ambiente no escuro durante 24 h. as lâminas manchadas devem ser visualizadas no microscópio confocal dentro de 1 semana de borne-mancha.

Representative Results

Os enteroids ileal crescidos no ECM são analisados visualmente e pelo qRT-PCR para seus estado de saúde relativo e Estados da diferenciação como um meio do controle de qualidade para culturas enteroid ileal e para o uso nos monolayers. Os enteroids ileal indiferenciados crescidos no ECM parecem desobstruídos e císticos na morfologia, indicando a presença de muitas pilhas de haste (Figura 1a). Ao longo do tempo, os enteroids ileal indiferenciados crescidos em meios de crescimento podem tomar em um phenotype intermediário onde algum parecerá cístico e alguns pareceram opaco (Figura 1b). Freqüentemente, nossas amostras não diferenciadas se assemelham àquelas mostradas na Figura 1b em vez da Figura 1a. Estas culturas intermediárias contêm mais enterócitos terminalmente diferenciados como medido pela expressão do marcador do enterocyte, do isomaltase do sacarase (si), e os enterócitos inoperantes presumivelmente expulsos no lúmen contribuem a sua aparência densa. Os enteroids ileal podem ser usados neste estado intermediário para o desenvolvimento monocamada, mas deve-se manter na mente que a quantidade de pilhas de haste intestinais atuais nas culturas pode ser baixa, e alguns tipos diferenciados da pilha podem estar atuais (por exemplo, veja qRT-PCR níveis em amostras não diferenciadas cultivadas em ECM assemelhando-se à Figura 1b na Figura 2). Para a comparação, os enteroids ileal cultivados com meios da diferenciação no ECM por 5 + dias parecerá uniformemente escurecido e lobular e as culturas com esta morfologia não são bons candidatos para monocamadas de semeadura (Figura 1C).

A expressão de genes de células-tronco e genes de diferenciação celular intestinal pode ser analisada pela qRT-PCR como outro meio para avaliar o estado de saúde dos enteroides ileal cultivados em ECM e suas capacidades de diferenciação, uma vez semeadas como monocamada em transpoços. A expressão de um gene da pilha de haste, de LGR5, de um gene do enterocyte, de si, de um gene da pilha do cálice, de MUC2, e de um gene da pilha do Paneth, lyz, é comparada entre culturas enteroid ileal indiferenciadas crescidas no ECM e em ileal diferenciado monocamadas enteroide na presença ou ausência de RANKL/TNFα (Figura 2). Enquanto os valores podem diferir entre experimentos, a expressão de LGR5 deve diminuir após a diferenciação de monocamada18,26. A expressão LGR5 geralmente não é detectada nas monoladas ileal diferenciadas sem RANKL e TNFα no dia 7. Inversamente, a expressão de marcadores de diferenciação de tipos de células específicas, tais si e MUC2, aumenta após a diferenciação18. A expressão de lyz geralmente diminui após a diferenciação em nossas culturas. Se as culturas de enteroides ileal usadas para fazer monocamada parecem mais como a Figura 1b do que a Figura 1a, os aumentos nos marcadores de diferenciação intestinal podem ser modestos após a diferenciação, pois essas culturas iniciais são heterogêneas em tipos de células intestinais e têm um nível basal mais elevado de si e MUC2. No entanto, a diferenciação em monocamadas ainda ocorre como avaliada pela perda de LGR5 expressão e microscopia (ver abaixo). Além disso, a adição de RANKL e TNFα aos meios de diferenciação reduz a perda da expressão de LGR5 (Figura 2). Paralelamente, a expressão de si e MUC2 é ligeiramente menor do que na condição diferenciada, faltando RANKL e TNFα, embora seus níveis aumentem acima da condição indiferenciada.

A diferenciação da pilha de m nos monocamadas é determinada pelo qRT-PCR e pela imunofluorescência usando dois marcadores específicos da pilha de m que incluem a glicoproteína 2 da superfície da pilha (GP2) e o fator de transcrição spib21. A expressão de GP2 e de spib é upregulated nos monocamadas enteroid-derivados ileal na presença de RANKL e de TNFα e não é detectado em amostras não-RANKL e TNFα tratadas (Figura 3). A expressão desses marcadores também pode ser normalizada para um pedaço de tecido intestinal pequeno22, se disponível. Isto permite que a mudança da dobra destes marcadores da pilha de m seja comparada ao tecido que tem pilhas de m um pouco do que para controlar monocamadas que não têm nenhuma expressão destes marcadores e permite a estandardização entre experiências em um laboratório. As células M também são detectadas pela expressão superficial da GP2 por imunofluorescência (Figura 4). Tipicamente, em uma monocamada confluente, as células de 1 a 5 M são observadas em um determinado campo de microscópio a uma ampliação de 40X nos dias 6 a 8 pós-semeadura em amostras tratadas com RANKL e TNFα (Figura 4a-D). Nenhuma expressão de GP2 é observada nas amostras não tratadas (Figura 4E). A visão ortogonal do plano XZ sobreposta com uma sonda de faloidina mostra estruturas de actina em torno de cada célula e expressão de GP2 na superfície apical de células M (Figura 4F-G). Este modelo recapitula a baixa frequência de células M encontradas no intestino humano1,2,8. Para purificar e isolar células M para um estudo mais aprofundado, as células M podem ser manchadas usando a expressão de superfície GP2 e classificadas usando FACS para células GP2 +.

As células M ligam-se e transportam o antígeno do lúmen intestinal para as células imunes que residem o epitélio2. A IgA secretora produzida no intestino liga-se às bactérias e pode se vincular à superfície apical das células M para facilitar o transporte dos micróbios27,28. Para determinar se as células M desenvolvidas neste modelo são capazes de ligar a IgA, o soro humano IgA é adicionado à câmara superior, permitida a ligação por 1 h, e, em seguida, as monocamadas são preparadas para análise de imunofluorescência. A presença de IgA em pilhas de M é visualizada usando um anticorpo secundário fluor-conjugado que reconheça a corrente pesada do soro humano IgA. As células m tratadas com IgA por 1 h têm IgA ligada à superfície apical (Figura 5a), enquanto as células m em poços de controle que foram tratadas apenas com o anticorpo secundário para IgA não têm sinal detectável (Figura 5b). Além disso, IgA vincula-se especificamente à superfície apical de células M e não é encontrado vinculado a nenhuma célula que falta a mancha de superfície GP2. Além, as pilhas de M têm o actínio denso mais curto caracterìstica em sua superfície apical2. Para analisar a morfologia da pilha de M neste modelo, os monocamadas enteroid-derivados ileal são crescidos por 7 dias e colhidos para a análise da imunofluorescência de F-Actin usando o Phalloidin. As medições da intensidade do pixel de actina são calculadas para as células M e para as células não-M que são diretamente adjacentes a cada célula M usando o software ImageJ (Figura 6a). A intensidade da actina é reduzida nas células GP2 + M neste modelo e uma imagem representativa é mostrada na Figura 6B. No geral, as células M desenvolvidas neste modelo de monocamada derivado de enteroides ileal têm expressão gênica característica, morfologia e algumas funções de células M de pilhas M intestinais humanas, como a ligação à IgA.

Figure 1
Figura 1: morfologia representativa de enteroids ileal humanos no ECM uma semana após a divisão. (A) enteroides ileal indiferenciados e claros e císticos. (B) phenotype intermediário com alguns enteroids ileal císticos e alguns enteroids ileal lobular opacos. (C) enteroids ileal diferenciados e Lobulares de escurecido. Imagens tiradas através da lente de um microscópio óptico de luz em 4x ampliação usando uma câmera iPhone7. Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: expressão relativa de células-tronco e marcadores de diferenciação de enteroides ileal humanos cultivados em ECM ou diferenciados como monocamada. Os enteroids ileal foram crescidos por 7 dias no ECM (indiferenciado) ou crescido e diferenciado como monocamadas sem (diferenciado) ou com RANKL e TNFα (diferenciado + R/T). Culturas enteroides ileal ou monocamadas foram colhidas em Trizol para extração de RNA. A expressão gênica foi determinada por qRT-PCR e é expressa em relação ao GAPDH. Os dados são médios de 3 poços independentes de enteroids ileal ou monocamadas por a circunstância. As barras de erro indicam SEM. ND não é detectada. A significância estatística foi determinada em valores de log-transformados usando ANOVA One-Way com o teste de comparações múltiplas de Dunnett comparando com o não diferenciado. * * p < 0, 1, * * * p < 0, 1 por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: expressão relativa de marcadores específicos da célula M GP2 e spib a partir de monolayers derivados de enteroides ileal humanos. Os monocamadas de enteroid-derivados ileal humanos tratados e não-tratados de RANKL/TNFα foram colhidos em Trizol para a extração do RNA após 7 dias post-semeando. A expressão gênica foi determinada por qRT-PCR e é expressa em relação ao GAPDH. Os dados são médios de 6 monocamadas independentes por condição. As barras de erro indicam SEM. ND não é detectada. Por favor clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: imunofluorescência da expressão de GP2 de superfície em células M em monocamadas derivados de enteroides ileal humano ao longo do tempo. Os monocamadas de enteroid-derivados ileal humanos tratados e não-tratados de RANKL/TNFα foram fixados em 4% PFA e manchados para a imunofluorescência em vários dias indicados borne-semeadura. As imagens foram analisadas por meio do software ImageJ. DAPI = azul; Glicoproteína 2 (GP2) = vermelho. (A-D) Monocamadas tratados RANKL/TNFα em vários dias após a semeadura. (E) monocamada não tratada colhida no dia 7 após a semeadura. (F-G) Plano de XZ ortogonal de monocamadas no dia 7 pós-semeadura sobreposta com sonda de faloidina para F-Actin. Phalloidin = ciano. Por favor clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: IgA liga-se especificamente à superfície apical das células M. Os monocamadas ileal enteroid-derivados humanos de RANKL/TNFα foram crescidos por 7 dias e então (A) tratados com 10 μg do soro humano IgA para 1 h ou (B) mock-tratou com o PBS somente (nenhum controle de IgA). Após 1 h, monocamadas foram lavados 2x em PBS, foram fixados em 4% PFA, costiveness com 0,1% tritonx-100, e manchado para a imunofluorescência. As imagens foram analisadas por meio do software ImageJ e são representativas de 3 experimentos independentes. DAPI = azul; Glicoproteína 2 (GP2) = vermelho; Anticorpo ao soro humano IgA = verde; Phalloidin = ciano. As setas pretas denotam IgA ligada à superfície apical da célula M. Por favor clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6: as células m reduziram a intensidade da actina em comparação com as células não-m adjacentes. Os monocamadas de enteroid-derivados ileal humanos tratados RANKL/TNFα foram crescidos por 7 dias e fixados então em 4% PFA e manchados para a imunofluorescência. (A) usando ImageJ, as células GP2 + M foram delineadas usando a ferramenta de seleção de mão livre e as medições de área e densidade integrada foram realizadas no canal de Phalloidin. A mesma análise foi então concluída para cada célula não-M adjacente que vizinhos a célula M. A densidade integrada bruta foi dividida pela área de cada célula individual para normalização. A densidade/área integrada média foi calculada para cada células não-M adjacentes para cada célula M. As imagens foram analisadas a partir de 3 experimentos independentes; cada ponto é uma célula M ou média de células vizinhas. As barras de erro indicam SD. a significância estatística foi determinada em valores de log-transformados usando um teste t pareado. p = 0, 1 (B) imagem representativa do plano XZ do gráfico em a. as imagens foram analisadas por meio do software ImageJ. DAPI = azul; Glicoproteína 2 (GP2) = vermelho; Phalloidin = ciano. Por favor clique aqui para ver uma versão maior desta figura.

Discussion

Para desenvolver monocamadas que diferenciam-se corretamente nos tipos principais da pilha intestinal e nas pilhas de M, é crítico estar ciente de diversos fatores. Os enteroids ileal devem ser colhidos das culturas do ECM que são indiferenciadas e têm uma proporção elevada de Lgr5 + pilhas de haste. Visualmente, a maioria dos enteroids ileal nas culturas do ECM não deve ser escurecida e multilobular, e a expressão LGR5 deve ser detectada nestas culturas pela análise do qRT-PCR. O controle de qualidade dos meios condicionados é essencial para a propagação de culturas indiferenciadas ao longo do tempo e deve ser preenchido para cada lote de mídia condicionada que é produzida. O controle da qualidade pode ser terminado testando um grupo novo de meios em algumas culturas do ECM e comparando a morfologia dos enteroids ileal a um grupo precedente de meios sobre o curso de uma semana. LGR5 expressão deve permanecer relativamente semelhante nas culturas de enteroides ileal cultivadas no novo lote de mídia em comparação com o lote anterior.

Durante a preparação dos enteroids ileal para semear como monolayers, é importante para pipeta vigorosa a solução da pilha após a incubação com tripsina para quebrar acima os enteroids ileal em únicas pilhas. Os aglomerados de células podem levar à formação de várias camadas quando semeadas para monocamada. Além disso, é essencial determinar empiricamente o número de células necessárias para formar uma monocamada para cada linha enteroide ileal individual que é obtida. Tipicamente, este valor pode variar de 2,5 x 105 – 5,0 x 105 células/bem, mas depende do grau de cístico para enteroids ileal não-císticos em culturas e varia para cada linha enteroide ileal individual. Da experiência, os enteroids ileal crescidos no ECM que parecem menos císticos exigem uma densidade mais elevada da propagação da pilha para conseguir monolayers. É aconselhável lavar a câmara superior após 1 dia de crescimento, introduzindo suavemente a mídia para cima e para baixo 2-3 vezes e substituindo com a mídia de crescimento fresco. Este processo desaloja as células que desembarcaram em cima de outras células, reduzindo a probabilidade de formação multi-camada. Comutando os meios na câmara superior dos meios do crescimento aos meios da pilha de m quando os monocamadas são ~ 80% confluente, que ocorre geralmente no borne-semeadura do dia 2, ajudas conseguem a boa diferenciação da pilha de m. A adição de RANKL/TNFα à câmara superior durante a indução da célula M não leva ao desenvolvimento de um maior número de células M por monocamada e, portanto, pode ser deixada de fora da mídia de câmara superior. As transpoços de tamanhos de poro de variação podem ser usadas neste protocolo sem afetar o desenvolvimento da pilha de M; no entanto, a densidade de semeadura de células deve ser otimizada para aqueles com tamanhos maiores de poros. O colagénio IV pode ser substituído para o ECM como um revestimento da proteína da membrana do porão para transpoços ou placas do poço que podem ser seridos melhor para determinadas aplicações.

Os monocamadas enteroid-derivadas ileal em transwells fornecem um sistema da dois-câmara que permita a criação de superfícies apicais e basolateral definidas tais que os 4-5 tipos diferentes de pilhas intestinais epithelial possam polarizar para expressar marcadores de superfície em cada lado em relação àquele encontrado no intestino. Fatores adicionais podem ser adicionados a ambos os lados, como partículas, agentes infecciosos ou outros tipos de células. No entanto, até à data algumas limitações permanecem. Como descrito, este sistema é um sistema estático que carece de fluxo fisiológico, contrações intestinais e conteúdo intestinal. Além, a arquitetura do villus-Crypt é perdida pela formação de um monolayer liso. Estes sistemas faltam regiões de remendo de Peyer, pilhas imunes, e pilhas stromal. Se a falta de pilhas imunes e stromal que residem pròxima abaixo das pilhas de M afeta as invaginações que não são observadas neste sistema e o outro funcionamento fisiológico é uma área futura importante da investigação. Este protocolo pode ser adaptado a uma placa 96-well ou a um formato da placa do multi-poço. O procedimento para o revestimento da placa 96-well com ECM e semeando com únicas pilhas dos enteroids ileal remanesce o mesmos que para transwells. A titulação da densidade de semeadura de células necessária para a obtenção de monocamadas deve ser feita, mas normalmente varia de 1,0 x 105 – 3,0 x 105 células/poço em um formato de placa de 96 poços. As pilhas de m são induzidas substituindo os meios do crescimento com meios da pilha de m quando os monocamadas são 80% confluentes tipicamente por dias 1-3 dependendo da densidade de propagação da pilha inicial.

Este método de diferenciar as pilhas de M dos enteroids ileal in vitro fornece melhorias significativas sobre o método caco-2. Os enteroids ileal são pilhas preliminares e pelo menos 4-5 tipos epithelial das pilhas estão atuais no sistema. Além disso, as linhagens de enteroides ileal derivadas de diferentes pessoas podem ser estudadas para investigar como a genética ou o estado da doença influenciam o desenvolvimento e o comportamento das células M. A manipulação adicional dos enteroids ileal durante a diferenciação da pilha de M permitirá uma compreensão melhor do desenvolvimento da pilha de M que caracteriza pilhas do precursor da pilha de M. Finalmente, uma vez que os mecanismos moleculares da fagocitose e da transcitose da célula m ainda não são completamente compreendidos3,29, este modelo fornece a oportunidade de estudar e visualizar o antígeno e a captação de partículas por células m.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Este trabalho foi apoiado pelo NIAID U19AI131126 ao Dr. Isberg (Tufts University School of Medicine) e Dr. Kaplan (Tufts University); (JM é líder do projeto 2) e NIAID R21AI128093 para JM. O ACF foi apoiado em parte pela NIAID T32AI007077. O SEB e o MKE foram apoiados pelo NIAID U19AI116497-05. Agradecemos aos membros do laboratório Mecsas, ao laboratório de NG e ao Dr. Isberg na escola de medicina da Universidade Tufts para discussões úteis. A imagem latente confocal foi executada no centro de Tufts para a pesquisa do Neuroscience, p30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics