Inducerad differentiering av M-Cellliknande celler i humana stamcells-härledda ileal Enteroid Monolayers

Immunology and Infection
 

Summary

Detta protokoll beskriver hur man inducerar differentieringen av M-celler i mänskliga stamcells-härledda ileal enskiktslager och metoder för att bedöma deras utveckling.

Cite this Article

Copy Citation | Download Citations

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (microfold) celler i tarmen funktion för att transportera antigen från apikala lumen till den underliggande Peyer s fläckar och lamina propria där immunceller bor och därmed bidra till slemhinnor immunitet i tarmen. En fullständig förståelse för hur M-celler differentieras i tarmen samt molekylära mekanismer för antigen upptag av M-celler saknas. Detta beror på att M-celler är en sällsynt population av celler i tarmen och eftersom in vitro-modeller för M-celler inte är robusta. Upptäckten av en självförnyande stamcells kultur system i tarmen, benämnd enteroider, har gett nya möjligheter för odling av M-celler. Enteroider är fördelaktiga över standard odlade cellinjer eftersom de kan differentieras i flera stora celltyper som finns i tarmen, inklusive bägaren celler, Paneth celler, enteroendokrina celler och enterocyter. Den cytokin RANKL är viktigt i M cell utveckling, och tillägg av RANKL och TNF-α till kultur Media främjar en delmängd av celler från ileal enteroider att differentiera till M-celler. Följande protokoll beskriver en metod för differentiering av M-celler i en transwell epitelial polariserande enskiktslager system av tarmen med hjälp av mänskliga ileala enteroider. Denna metod kan tillämpas på studiet av M cell utveckling och funktion.

Introduction

M (microfold) celler är specialiserade intestinal epitelceller finns främst i follikeln associerade epitel (FAE) i tarmen överliggande små lymfoida regioner kallas Peyer ' s patchar1. M-celler har korta oregelbundna apikala Mikrovilli och är djupt invaginated på deras basolaterala sidan, vilket gör att immunceller att uppehålla sig nära sin cell kropp2. Denna unika morfologi gör det möjligt för M-celler att ta prov antigen från den apikala lumen i tarmen och leverera den direkt till de underliggande immuncellerna2. På detta sätt, M celler är viktiga för immunförsvaret övervakning i tarmen men kan också utnyttjas av patogener för inträde i lamina propria1,2,3,4,5, 6,7.

Studiet av M-celler har hindrats av flera faktorer. Först, M celler finns på en låg frekvens i musen och mänskliga tarmen8. I odlade celler system, har M cell-liknande celler induceras för att differentiera genom samtidig odling av en polariserad adenokarcinom cellinjer, Caco-2, med antingen b-lymfocyter från mus Peyer s fläckar eller b cell lymfom cell linjen, Raji B9,10 . Detta resulterar i en delmängd av Caco-2 celler som uttrycker M cell markörer Sialyl Lewis ett antigen och UEA-1 i den polariserade epitelet9,10. (Dessa markörer uttrycks också på bägare celler i tarm vävnader, så nuförtiden är mindre ofta används som definitiva M cell markörer11,12.) Detta Caco-2-M cellsystem har använts för att studera partikel upptag och bakterier flyttning13,14. Emellertid, Caco-2 celler är en etablerad cellinjer från en stor intestinal adenocarcinom med den confounding faktor som olika källor av Caco-2 celler visar olika fenotyper bland Labs15. Vidare kan de inte helt recapitulate transkriptionsnivåer av sanna M-celler, eftersom de saknar uttryck för närvarande kända M cell markörer GP2 och SpiB16. Därför behövs ytterligare och mer fysiologiskt relevanta kultur modeller för att kunna studera M-cellernas utveckling och funktioner.

Inom de senaste tio åren har området enteroid-härledda modellsystem i tarmen snabbt gått framåt från den första upptäckten att tarm stamceller som härrör från mänsklig intestinal biopsi kan självpropagera och själv förnya i kulturen 17 , 18. viktigt, avlägsnande av stamceller främja faktorer från tillväxt medier gör att dessa stamceller kulturer att differentiera till de många celltyper som finns i tarmen18. Dessutom, nyligen arbete tyder på vikten av RANKL-Rank signalering i M cell utveckling i tarmen19,20. Den frodiga receptorn är en medlem av TNF familj av receptorer som uttrycks på epitelial prekursorer celler i tarmen19 medan RANKL (den frodiga receptor ligand) släpps av stromacellstumörer celler av Peyer s fläckar20. Eftersom epitelceller typer som finns i ileal enteroider inte producerar RANKL, kan M celldifferentiering i ileal enteroid kulturer induceras genom tillsats av RANKL till kulturen Media21,22. Införande av TNFα i kulturen Media hjälper till att stödja M cell utveckling i ileal enteroider23. Här beskriver vi metoder för att inducera differentiering av M-celler i intestinal enskiktslager härrör från mänskliga ileal enteroider. Våra metoder bygger delvis på ändringar från följande protokoll21,22,23.

Protocol

Alla metoder som beskrivs här har godkänts av Tufts University IBC och IRB.

1. inducera M cell differentiering i mänskliga ileal Enteroid-härledda Monolayers

Anmärkning: Detta protokoll använder ileal enteroider som härrör från mänsklig vävnad biopsi. Se publicerade protokoll för metoder för hur man odlar och passerar dessa celler18,24. Följande metoder för att utveckla enskiktslager har anpassats från ZOU et al.24. Metoder för att inducera M-celler i ileal enteroid-härledda kulturer anpassades från tidigare rapporter21,22,23. Allt arbete utförs i en steril vävnad kultur huva och inkuberingar är i huva eller vävnad kultur inkubator som anges. Se tabell över material som behövs för att förbereda ileal enteroid enskiktslager och olika medier.

  1. Odla ileal enteroider för 4-10 dagar i extracellulära matrix (ECM) (se tabell över material) (figur 1), beroende på deras egen tillväxttakt, innan sådd på transwells.
  2. Beläggning transwell membran
    1. Placera önskat antal transwells i en 24-brunn tallrik skapa ett två-kammarsystem.
    2. Späd ECM 25-faldigt i kall steril fosfatbuffrad saltlösning (PBS) och tillsätt 100 μL kall utspädd lösning i varje övre kammare på membranet.
      Anmärkning: ECM och utspädd ECM-lösning måste hållas på is tills omedelbart före tillägg.
    3. Täck den 24-brunnen plattan med locket och placera plattan i en vävnadsodling inkubator vid 37 ° c för 2 h för att möjliggöra ECM stelning på membranet.
    4. Efter 2 h, ta bort plattan från inkubatorn och placera i en vävnad kultur huva. Använd sterila pincetter, Invertera varje transwell att försiktigt ta bort kvarvarande lösning. Låt membranen lufttorka i huven med locket öppet medan celler samlas in (steg 1.3.1-1.3.11).
  3. Dissociera ileal enteroider i enstaka celler
    1. Ta bort plattan av ileal enteroider från inkubatorn och ta försiktigt bort odlingsmediet från varje brunn med vakuum aspiration eller med en pipett.
      Anmärkning: En brunn av ileal enteroider som innehåller cirka 100 friska cystor är tillräckligt för att utsäde 1.5-2 brunnar.
    2. Tillsätt 500 μL iskall 0,5 mM etylendiamintetraättiksyra (EDTA) till varje brunn som innehåller ileal enteroider suspenderade i ECM för att bryta upp ECM. Pipettera upp och ned kraftigt med en P1000-multikanalspipettor som är inställd på 500 μL för att bryta upp ECM och därmed frigöra ileal enteroider i lösningen. För att förbättra upplösningen av ECM, efter pipettering, skaka plattan kraftigt vid 4 ° c i 30 min.
    3. Samla upp lösningen från varje brunn i 15 mL koniska rör.
      Anmärkning: Samla upp till 10 brunnar per 15 mL koniskt rör för optimal enkel cell uppsamling.
    4. Pelleten cellerna i en centrifug vid 140 x g och 4 ° c i 5 min. pelleten ska vara synlig men kan lätt tas bort, så sakta avlägsna supernatanten genom vakuum aspiration eller med en pipett.
      Anmärkning: Om du är bekymrad över förlust av pellets och celler, Använd en pipett och spara supernatanten i ett separat rör.
    5. Att smälta snäva knutpunkt kopplingar och bryta upp ileal enteroider i enskilda celler, Omsuspendera pelleten i 500 μL av rumstemperatur trypsin per varje 5 brunnar som samlats in i steg 1.3.3. Med hjälp av en P1000, Pipettera upp och ner för att disaggregera klumpar och inkubera rören i ett 37 ° c vattenbad i 5 min eller mindre.
      Anmärkning: Optimering behövs för att bestämma lämplig mängd tid som krävs för att Inkubera rören så att cellerna bryts upp men inte över-trypsinized till den grad att de dör. Använd Trypan Blue i steg 1.3.9 för att säkerställa att cellerna är livskraftiga efter trypsin behandling.
    6. Tillsätt 1 mL avancerad DMEM/F12 med 10% fetalt bovint serum (FBS) per 500 μL trypsin för att inaktivera trypsin.
    7. Pipettera uppåt och nedåt med en P1000 inställd på 500 μL minst 50 gånger mot sidan av det koniska röret för att ytterligare disaggregera kvarvarande klumpar i enstaka celler.
    8. Placera en 40 μm cell SIL över en 50 mL konisk och tillsätt 1 mL avancerad DMEM/F12 med 10% FBS för att blöta cell SIL. Pipettera den enda cellsuspensionen från 15 mL konisk på SIL. Tvätta SIL med 1 mL avancerad DMEM/F12 med 10% FBS.
    9. Överför de celler som gick igenom cellen SIL från 50 mL koniskt till ett nytt 15 mL koniskt rör. Under centrifugeringssteget 1.3.10 blir den cellulära pelleten lättare att se i ett 15 mL koniskt rör. Räkna cellerna med hjälp av en hemocytometer. Använd Trypan Blue för att kontrollera att cellerna fortfarande är vid liv. Typiskt, > 95% lönsamhet observeras.
    10. Samtidigt räkna cellerna, Centrifugera cellerna i den nya 15 mL röret vid 400 x g och rumstemperatur för 5 min. cellpellet bör vara synlig. Ta försiktigt bort supernatanten med en pipett, och spara sedan supernatanten om pelleten blir nedlös.
    11. Förbered modifierad komplett tillväxt Media25 (mcmgf + Media) kompletterat med 10 μm Y-27632. Omsuspendera pelleterade celler vid 2,5 x 105 celler/200 μl i MCMGF +. Se anmärkningar i diskussionen om att optimera cell seedning nummer.
      Anmärkning: MCMGF + media är avancerad DMEM/F12 med 75% L-Wnt3a conditioned media, 10% R-spondin konditionerade media, 5% noggin konditionerade media, 1x B27 tillägg, 1x N2 tillägg, 1 mM N-acetylcystein, 50 ng/mL mus rekombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrin I 10 mM HEPES, 2 mM GlutaMAX och 1x penicillin/streptomycin (tillval).
    12. Säkerställ att de ECM-belagda membranen som bereds i steg 1,2 har torkat helt, enligt bedömning av ögat. Tvätta den övre kammaren med 200 μL MCMGF +. Tillsätt 200 μL cell lösning i varje övre kammare.
    13. Tillsätt 700 μL MCMGF + med 10 μM Y-27632 till varje lägre kammare. Placera plattan i en 37 ° c vävnadskultur inkubator med 5% CO2.
    14. Efter 1 dag av tillväxt, ta bort media från den övre kammaren och ersätta med 200 μL av färska MCMGF +, för att förhindra tillväxt av flera cellskikt.
  4. Byte av medium
    1. När enskiktslager är ~ 80% confluent, vanligtvis mellan dagar 1-3 efter sådd, ersätta basolateral media med differentiering media (DM) för kontroll brunnar (se steg 1.4.2 för mer information) eller med m cell media för m cell induktion brunnar (se steg 1.4.3 för mer information). Byt ut mediet i övre kammaren mot DM för båda förhållandena.
      Anmärkning: DM är avancerad DMEM/F12 med 5% noggin konditionerade media, 1x B27 tillägg, 1x N2 tillägg, 1 mM N-acetylcystein, 50 ng/mL mus rekombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrin I, 10 mM HEPES buffert, 2 mM GlutaMAX, och 1x penicillin/streptomycin (tillval ). M-cellmedia är DM kompletterat med 200 ng/mL RANKL och 50 ng/mL TNFα.
    2. För kontroll brunnar som inte bör innehålla M-celler, tillsätt 200 μL av DM till den övre kammaren och 700 μL DM till botten kammaren.
    3. För att inducera M-celler, tillsätt 200 μL av DM till övre kammaren och 700 μL av M-cellmedia till botten kammaren.
    4. Byt ut mediet var 2: a dag. För kontroll brunnar, Ersätt DM i de övre och nedre kamrarna. För M-cellbrunnar, Ersätt DM i övre kammaren och M cellmedia i nedre kammaren.
      Anmärkning: Vid dag 7 post cell-seeding, M celler är fullt induceras i monolayers.

2. Verifiera M cell differentiering med qRT-PCR

Anmärkning: Utför följande arbete på en steril RNAse fritt bänkutrymme. Se tabell över material för en lista över föredragna material för QRT-PCR.

  1. Ta bort media från övre och undre kammare och tvätta den övre kammaren 2x försiktigt med 300 μL rumstemperatur PBS.
  2. Tillsätt 300 μL TRIzol till varje övre kammare. Inkubera vid rumstemperatur i 5 minuter.
    FÖRSIKTIGHET: Använd handskar och ögonskydd vid användning av TRIzol för att undvika kontakt med huden enligt tillverkarens anvisningar.
  3. Under tiden, etikett mikrocentrifug rör för varje brunn och tillsätt 700 μl TRIzol till varje tub.
  4. Samla in cellhomogenisera genom att Pipettera upp och ner 3x försiktigt med en P1000 och överföra innehållet till motsvarande microcentrifug tub. Vortex för 5 s att blanda.
  5. Förvara proverna i rumstemperatur i ytterligare 3 minuter. Förvara sedan vid-80 ° c i upp till en månad.
  6. Följ vanliga qRT-PCR-metoder för RNA-isolering, DNase-behandling, omvänd Transkription och qRT-PCR-reaktioner. Se primer-listan i tabell över material.

3. kontroll av cell differentiering genom immunofluorescens

Anmärkning: Håll alltid den undre kammaren på plattan fylld med PBS så att membranen förblir våt. Denna procedur utförs på bänken. Se tabell över material för en lista över föredragna material för immunofluorescenser.

  1. Ta bort mediet från den övre kammaren och tvätta 2x försiktigt med 300 μL rumstemperatur PBS. Tillsätt 100 μL rumstemperatur 4% PFA i PBS till övre kammaren. Täck plattan med folie och låt stå i 25 min vid rumstemperatur. Ta bort 4% PFA.
    Försiktighet: 4% PFA bör kasseras på lämpligt sätt som farligt kemiskt avfall.
  2. Tvätta den övre kammaren 3x med 300 μL rumstemperatur PBS. Vid denna punkt kan proverna ligga kvar vid 4 ° c i upp till en månad före färgning. När färgas, prover bör visualiseras inom en vecka för bästa kvalitet bilder.
  3. Inkubera enskiktslager med 100 μl av 5% bovint serumalbumin (BSA) upplöst i PBS för 30 min i mörker vid rumstemperatur för att blockera enskiktslager.
  4. Bered GP2 Primary antikropps lösning i 1% BSA i PBS vid en utspädning av 1:100. Tillsätt 100 μL per brunn. Fläcken i 1 h vid rumstemperatur i mörker. Ta bort lösningen.
    Anmärkning: Permeabilisera inte enskiktslager innan primär fläcken för GP2 uppstår eftersom optimal primär GP2 ytfärgning av M-celler uppnås utan permeabilisering.
  5. Tvätta den övre kammaren 3x gånger med 300 μL rumstemperatur PBS.
  6. Förbered sekundär fläck lösning av Fluorescent taggade Goat anti-mus IgG på 1:200, phalloidin på 1:100 och DAPI i 1% BSA + 0,1% Triton i PBS. Tillsätt 100 μL per brunn. Fläcken i 30 min vid rumstemperatur i mörker.
    Anmärkning: Triton tillsätts den sekundära fläcken lösning för att permeabilize cellerna under detta steg för korrekt phalloidin fläck.
  7. Tvätta 3x med 300 μL PBS.
  8. Placera en 5 μL droppe monteringslösning (tabell över material) på en glas rutschbana. Ta bort brunnen från 24 väl plattan och Invertera. Försiktigt skära membranet från brunnen med hjälp av en skalpell. Placera membranet med cellerna vänd uppåt på droppet av monterings lösningen på glas bilden. Tillsätt 10 μL monteringslösning på toppen och mitten av membranet och placera en täckglas ovanpå för att täta membranet mellan glas rutschbana och täckslip.
  9. Torka av glasen vid rumstemperatur i mörker för 24 h. färgade bilder bör visualiseras på konfokalmikroskop inom 1 vecka efter färgning.

Representative Results

Ileal enteroider som odlas i ECM analyseras visuellt och qRT-PCR för deras relativa hälsostatus och differentiering stater som ett sätt att kvalitetskontroll för ileal enteroid kulturer och för användning i monolayers. Odifferentierade ileal enteroider som odlas i ECM verkar klar och cystisk i morfologi, vilket indikerar närvaron av många stamceller (figur 1a). Över tid, odifferentierade ileal enteroider odlas i tillväxt medier kan ta på en mellanliggande fenotyp där vissa kommer att visas cystisk och vissa verkar ogenomskinlig (figur 1b). Ofta liknar våra odifferentierade prover de som visas i figur 1b i stället för figur 1a. Dessa mellanliggande kulturer innehåller mer obotligt differentierade enterocyter mätt med uttrycket av enterocyte markör, eller sukras isomaltas (SI), och förmodligen extruderade döda enterocyter i lumen bidra till deras täta utseende. Ileal enteroider kan användas i detta mellanliggande tillstånd för enskiktslager utveckling, men det måste hållas i åtanke att mängden intestinala stamceller som finns i kulturerna kan vara låg, och vissa differentierade celltyper kan förekomma (till exempel, se QRT-PCR nivåer i odifferentierade prover som odlas i ECM och som liknar figur 1b i figur 2). För jämförelse, ileal enteroider odlade med differentiering media i ECM för 5 + dagar kommer att visas jämnt mörklagt och lobulär och kulturer med denna morfologi är inte bra kandidater för seedning enskiktslager (figur 1c).

Uttryck av stamceller gener och gener av intestinal celldifferentiering kan analyseras av QRT-PCR som ett annat sätt att bedöma hälsostatus ileal enteroider odlas i ECM och deras differentiering kapacitet en gång seedade som enskiktslager på transwells. Uttrycket av en stamcells-gen, LGR5, en enterocyte gen, si, en bägare cell gen, MUC2, och en Paneth cell gen, LyZ, jämförs mellan odifferentierade ileal enteroid kulturer odlas i ECM och differentierade ileal enteroid enskiktslager i närvaro eller frånvaro av RANKL/TNFα (figur 2). Medan värdena kan skilja sig mellan experiment, bör uttrycket av LGR5 minska efter differentiering av enskiktslager18,26. LGR5 -uttrycket upptäcks vanligtvis inte i de differentierade ileal enskiktslager utan RANKL och TNFα vid dag 7. Omvänt, uttryck av markörer för differentiering av specifika celltyper, såsom si och MUC2, öka efter differentiering18. Uttryck av LyZ minskar generellt efter differentiering i våra kulturer. Om ileal enteroid kulturer som används för att göra enskiktslager ser mer ut som figur 1b än figur 1a, ökningar i tarm differentiering markörer kan vara blygsam efter differentiering eftersom dessa inledande kulturer är heterogena i tarm cells typer och har en högre basal nivå av si och MUC2. Emellertid, differentiering i enskiktslager förekommer fortfarande som bedöms av förlust av LGR5 uttryck och mikroskopi (se nedan). Dessutom minskar tillägg av RANKL och TNFα till differentierings mediet förlusten av LGR5 Expression (figur 2). I parallell är uttryckt av si och MUC2 något lägre än i det åtskilda villkora sakna RANKL och TNFα, även om deras jämnar förhöjning ovanför det odifferentierade villkorar.

M celldifferentiering i enskiktslager bestäms både av QRT-PCR och immunofluorescens med hjälp av två M-cellspecifika markörer inklusive cellytan glykoprotein 2 (GP2) och transkriptionsfaktorn spib21. Uttrycket av GP2 och spib är uppreglerad i ileal enteroid-härledda enskiktslager i närvaro av RANKL och TNFα och upptäcks inte hos icke-RANKL-och TNFα-behandlade prover (figur 3). Uttrycket av dessa markörer kan också normaliseras till en bit av små tarm vävnad22, om det finns. Detta tillåter Fold förändring av dessa m cell markörer som skall jämföras med vävnad som har M celler i stället för att kontrollera enskiktslager som inte har något uttryck för dessa markörer och tillåter standardisering mellan experiment i ett labb. M-celler detekteras också genom att ytan uttrycks av GP2 genom immunofluorescens (figur 4). Typiskt, i en konflytande monolayer, 1 till 5 M celler observeras i ett givet mikroskopfält vid 40X förstoring av dag 6 till 8 efter sådd i prover behandlade med RANKL och TNFα (figur 4a-D). Inget GP2-uttryck syns i de obehandlade proverna (figur 4E). Den rätvinkliga syn på XZ planet överlagt med en phalloidin sond visar aktin strukturer kring varje cell och GP2 uttryck på den apikala ytan av M-celler (figur 4F-G). Denna modell recapitulates den låga frekvensen av M-celler som finns i den mänskliga tarmen1,2,8. För att rena och isolera M-celler för vidare studier kan M-celler färgas med hjälp av GP2-ytans uttryck och sorteras med hjälp av FACS för GP2 +-celler.

M-celler binder till och transporterar antigen från tarm lumen till immunceller som är bosatta under epitelet2. Sekretoriska iga produceras i tarmen binder till bakterier och kan binda till den apikala ytan av M-celler för att underlätta transporten av mikroberna27,28. För att avgöra om de M-celler som utvecklats i denna modell kan binda till iga, humanserum iga tillsätts till övre kammaren, tillåtet att binda för 1 h, och sedan enskiktslager är beredda för immunofluorescensanalys. Närvaron av IgA på M-celler visualiseras med hjälp av en fluor-konjugerad sekundär antikropp som erkänner den tunga kedjan av humant serum IgA. M-celler behandlade med IgA i 1 h har IgA bunden till den apikala ytan (figur 5a), medan m-celler i kontrollbrunnar som endast behandlades med den sekundära antikroppen till iga inte har någon detekterbar signal (Figur 5b). Ytterligare, IgA specifikt binder till den apikala ytan av M-celler och inte hittas bunden till några celler som saknar GP2 yta fläck. Dessutom har M-celler karakteristiskt kortare tät aktin på sin apikala yta2. För att analysera M-cellmorfologi i denna modell odlas ileal enteroid-härledda enskiktslager för 7 dagar och skördas för immunofluorescensanalys av F-Actin med phalloidin. Mätningar av aktin-pixelintensitet beräknas för m-celler och för icke-m-celler som ligger i direkt anslutning till varje m-cell med imagej-programvara (figur 6a). Actin-intensiteten reduceras på GP2 + M-celler i denna modell och en representativ bild visas i figur 6b. Sammantaget, de M-celler som utvecklats i denna ileal enteroid-härledda enskiktslager modell har karakteristiska genuttryck, morfologi och vissa M cellfunktioner av mänskliga intestinala M-celler, såsom bindning till IgA.

Figure 1
Figur 1: representativ morfologi av humana ileal enteroider i ECM en vecka efter uppdelningen. (A) tydliga och cystisk odifferentierade ileal enteroider. (B) mellanliggande fenotyp med vissa cystisk ileal enteroider och vissa ogenomskinliga lobulär ileal enteroider. (C) mörkare och lobulär differentierade ileal enteroider. Bilder tagna genom linsen på ett optiskt ljusmikroskop vid 4x förstoring med hjälp av en iPhone7 kamera. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: relativ uttryck för stamcells-och differentierings markörer för humana ileal enteroider som odlas i ECM eller differentieras som monolayers. Ileal enteroider odlades för 7 dagar i ECM (odifferentierad) eller fullvuxet och åtskilt som enskiktslager utan (åtskilt) eller med RANKL och TNFα (åtskilt + R/T). Ileal enteroid kulturer eller enskiktslager skördades i TRIzol för RNA-extraktion. Genuttryck bestämdes av qRT-PCR och uttrycks i förhållande till GAPDH. Data är genomsnittet av 3 oberoende brunnar av ileal enteroider eller enskiktslager per villkora. Felstaplarna indikerar att SEM. ND inte upptäcks. Statistisk signifikans fastställdes på log-omvandlade värden med enkelriktad ANOVA med Dunnetts multipla jämförelser test jämföra med odifferentierade. * * p < 0,01, * * * p < 0,001 vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: relativ uttryck för M-cellspecifika markörer GP2 och spib från humana ileal enteroid-härledda monolayers. RANKL/TNFα-behandlad och icke-behandlad Human ileal enteroid-härledda enskiktslager skördades i TRIzol för RNA-extraktion efter 7 dagar efter sådd. Genuttryck bestämdes av qRT-PCR och uttrycks i förhållande till GAPDH. Data är i genomsnitt 6 oberoende enskiktslager per tillstånd. Felstaplarna indikerar att SEM. ND inte upptäcks. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: immunofluorescens av ytan GP2 uttryck på M-celler i humana ileal enteroid-härledda enskiktslager över tiden. RANKL/TNFα behandlade och icke-behandlade humana ileal enteroid-härledda enskiktslager fastställdes i 4% PFA och färgas för immunofluorescens på olika indikerade dagar efter sådd. Bilder analyserades med ImageJ-programvara. DAPI = blå; Glykoprotein 2 (GP2) = röd. (a-D) RANKL/TNFα behandlade enskiktslager vid olika dagar efter sådd. E obehandlat enskiktslager skördat vid dag 7 efter sådd. (F-G) Ortogonalt XZ-plan för enskiktslager dag 7 efter sådd med phalloidin sond för F-Actin. Phalloidin = Cyan. Vänligen klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: iga binder specifikt till den apikala ytan av M-celler. RANKL/TNFα-behandlade humana ileal enteroid-härledda enskiktslager odlades i 7 dagar och därefter (a) behandlade med 10 μg humant serum IgA för 1 h eller (B) mock-behandlad med PBS endast (ingen iga-kontroll). Efter 1 h, enskiktslager tvättades 2x i PBS, var fast i 4% PFA, permeabilized med 0,1% tritonx-100, och färgas för immunofluorescens. Bilderna analyserades med ImageJ Software och är representativa för 3 oberoende experiment. DAPI = blå; Glykoprotein 2 (GP2) = röd; Antikropp mot humant serum IgA = grön; Phalloidin = Cyan. Svarta pilar betecknar IgA bunden till apikala ytan av M-cell. Vänligen klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: M-celler har reducerad aktin-intensitet jämfört med angränsande icke-m-celler. RANKL/TNFα-behandlad Human ileal enteroid-härledda enskiktslager odlades i 7 dagar och fastställdes sedan i 4% PFA och färgas för immunofluorescensen. (A) med hjälp av imagej, var GP2 + M celler som beskrivs med hjälp av FreeHand markeringsverktyget och mätningar av området och integrerad densitet togs i Phalloidin kanal. Samma analys slutfördes sedan för varje angränsande icke-M-cell som grannar M-cellen. Den råa integrerade densiteten delades av området för varje enskild cell för normalisering. Den genomsnittliga integrerade densiteten/arean beräknades för varje angränsande icke-M-celler för varje M-cell. Bilder analyserades från 3 oberoende experiment; varje punkt är en M-cell eller genomsnittet av angränsande celler. Felstaplar indikerar SD. statistisk signifikans bestämdes på log-transformerade värden med hjälp av ett parat t-test. p = 0,0001 (B) representativ bild av XZ-plan från tomt i A. bilder analyserades med imagej-programvara. DAPI = blå; Glykoprotein 2 (GP2) = röd; Phalloidin = Cyan. Vänligen klicka här för att se en större version av denna siffra.

Discussion

För att utveckla enskiktslager som skiljer sig ordentligt i de stora tarm celltyper och M-celler, är det viktigt att vara medveten om flera faktorer. Ileal enteroider måste skördas från ECM kulturer som är odifferentierade och har en hög andel av Lgr5 + stamceller. Visuellt, de flesta av ileal enteroider i ECM kulturer bör inte förmörkas och multilobular, och LGR5 uttryck bör upptäckas i dessa kulturer genom QRT-PCR-analys. Kvalitetskontroll av konditionerade medier är avgörande för spridningen av odifferentierade kulturer över tid och måste slutföras för varje parti av konditionerade medier som produceras. Kvalitetskontroll kan slutföras genom att testa ett nytt parti av media på vissa ECM kulturer och jämföra morfologin av ileal enteroider till en tidigare omgång av media under loppet av en vecka. LGR5 uttrycket bör förbli relativt lika i ileal enteroid kulturer odlas i den nya omgången av media jämfört med föregående parti.

Under beredning av ileal enteroider för sådd som monolayers, det är viktigt att kraftfullt Pipettera cell lösningen efter inkubering med trypsin att bryta upp ileal enteroider i enskilda celler. Cell klumpar kan leda till flera skikt bildas när seedade för monolayers. Dessutom är det viktigt att empiriskt bestämma antalet celler som krävs för att bilda en enskiktslager för varje enskild ileal enteroid linje som erhålls. Typiskt, detta värde kan variera från 2,5 x 105 – 5,0 x 105 celler/väl men beror på graden av cystisk till icke-cystisk ileal enteroider i kulturer och varierar för varje enskild ileal enteroid linje. Från erfarenhet, ileal enteroider odlas i ECM som verkar mindre cystisk kräver högre cell seedning densitet för att uppnå monolayers. Det är tillrådligt att tvätta övre kammaren efter 1 dag av tillväxt genom att försiktigt Pipettera Media upp och ner 2-3 gånger och ersätta med färska tillväxtmedia. Denna process rubbar celler som har landat ovanpå andra celler minska sannolikheten för flera skikt bildas. Byta media i övre kammaren från tillväxtmedia till M cellmedia när enskiktslager är ~ 80% confluent, som vanligtvis sker vid dag 2 efter sådd, hjälper till att uppnå god M celldifferentiering. Tillsats av RANKL/TNFα till övre kammaren under m cell induktion leder inte till utveckling av ett större antal M-celler per enskiktslager och kan därför lämnas utanför det övre kammar mediet. Transwells av varierande porstorlek kan användas i detta protokoll utan att påverka utvecklingen av M-celler; cell sådd tätheten måste dock optimeras för dem med större porstorlek. Kollagen IV kan ersätta ECM som en basalmembran protein beläggning för transwells eller bra tallrikar som kan vara bättre lämpade för vissa tillämpningar.

Ileal enteroid-härledda enskiktslager på transwells ger ett två-kammarsystem som gör det möjligt att skapa definierade apikala och basolaterala ytor så att 4-5 olika typer av epitelial tarmceller kan polarisera att uttrycka ytan markörer på varje sida i förhållande till den som finns i tarmen. Ytterligare faktorer kan läggas till på vardera sidan, till exempel partiklar, smittämnen eller andra celltyper. Men hittills vissa begränsningar kvarstår. Som beskrivits, detta system är ett statiskt system som saknar fysiologiskt flöde, tarm sammandragningar, och tarminnehåll. Dessutom är villus-crypt arkitektur förlorad genom bildandet av en platt monolayer. Dessa system saknar Peyers patch regioner, immunceller och stromaceller. Huruvida bristen på immunceller och stromaceller är nära under M-celler påverkar de invaginationer som inte observeras i detta system och annan fysiologisk funktion är ett viktigt framtida område för utredning. Detta protokoll kan anpassas till en 96-brunn plattan eller en multi-well plåtformat. Förfarandet för beläggning av 96-brunn plattan med ECM och sådd med enstaka celler från ileal enteroider förblir densamma som för transwells. Titrering av den cell sådd densitet som krävs för att få enskiktslager måste göras, men vanligtvis varierar från 1,0 x 105 – 3,0 x 105 celler/brunn i en 96-väl tallrik format. M celler induceras genom att ersätta tillväxt medier med m cell media när enskiktslager är 80% konfluenta typiskt av dagar 1-3 beroende på initial cell sådd densitet.

Denna metod för att differentiera M-celler från ileal enteroider in vitro ger signifikanta förbättringar jämfört med Caco-2-metoden. Ileal enteroider är primära celler och minst 4-5 epitelceller typer finns i systemet. Dessutom kan ileal enteroid linjer som härrör från olika personer studeras för att undersöka hur genetik eller sjukdomstillstånd inflytande M cell utveckling och beteende. Ytterligare manipulation av ileal enteroider under M celldifferentiering kommer att möjliggöra en bättre förståelse av M cell utveckling inklusive karakterisera M cell prekursorer celler. Slutligen, eftersom de molekylära mekanismerna i m cell fagocytos och transcytosis är fortfarande inte helt förstått3,29, denna modell ger möjlighet att studera och visualisera antigen och partikel upptag av m-celler.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Detta arbete stöddes av NIAID U19AI131126 till Dr isberg (Tufts University School of Medicine) och Dr Kaplan (Tufts University); (JM är projekt 2 ledare) och NIAID R21AI128093 till JM. ACF stöddes delvis av NIAID T32AI007077. SEB och MKE stöddes av NIAID U19AI116497-05. Vi tackar medlemmarna i Mecsas Lab, ng Lab och Dr isberg vid Tufts University School of Medicine för nyttiga diskussioner. Den konfokala Imaging utfördes på Tufts Center for neurovetenskap Research, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics