Indusert differensiering av M Cell-lignende celler i Human Stem Cell-avledet ileal Enteroid Monolagere

Immunology and Infection
 

Summary

Denne protokollen beskriver hvordan å indusere differensiering av M celler i humant stilk cellen-avledet ileal monolagere og metoder for å vurdere deres utvikling.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Fasciano, A. C., Blutt, S. E., Estes, M. K., Mecsas, J. Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers. J. Vis. Exp. (149), e59894, doi:10.3791/59894 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

M (microfold) cellene i tarmen funksjonen til å transportere antigen fra apikale lumen til den underliggende Peyer ' s patcher og lamina propria hvor immunceller bor og derfor bidra til slimhinne immunitet i tarmen. En fullstendig forståelse av hvordan M celler skille i tarmen samt molekylære mekanismer av antigen opptak av M celler mangler. Dette er fordi M-celler er en sjelden populasjon av celler i tarmen og fordi in vitro-modeller for M-celler ikke er robuste. Oppdagelsen av en selv-fornyelse stilk cellen kultur system av tarmen, kalt enteroids, har gitt nye muligheter for dyrking M celler. Enteroids er fordelaktig over standard kultivert cellelinjer fordi de kan skilles i flere store celletyper funnet i tarmen, inkludert begeret celler, Paneth celler, enteroendocrine celler og enterocytes. Den cytokin RANKL er viktig i M celle utvikling, og tillegg av RANKL og TNF-α til kultur medier fremmer en undergruppe av celler fra ileal enteroids å differensiere til M celler. Følgende protokoll beskriver en metode for differensiering av M-celler i et transwell epitel polarisert monolag system av tarmen ved hjelp av menneskelig ileal enteroids. Denne metoden kan brukes til studiet av M celle utvikling og funksjon.

Introduction

M (microfold) celler er spesialisert intestinal epitelceller finnes hovedsakelig i hårsekken tilhørende epitel (FAE) av tarmen overliggende små lymfoide regioner kalt Peyer ' s patcher1. M celler har korte uregelmessige apikale microvilli og er dypt invaginated på deres basolateral side, som gjør at immunceller til å ligge tett til sin celle kropp2. Denne unike morfologi gjør at M-celler kan prøve antigen fra apikale lumen i tarmen og levere den direkte til de underliggende immun cellene2. På denne måten er M celler viktig for immun overvåkning i tarmen, men kan også utnyttes av patogener for inntreden i lamina propria1,2,3,4,5, 6,7.

Studiet av M celler har blitt hindret av flere faktorer. Først M celler er funnet på en lav frekvens i musen og menneskelige tarmen8. I kulturperler celler systemer, M celle-lignende celler har blitt overtalt til å differensiere av co-dyrking en polarisert adenokarsinom cellelinje, caco-2, med enten B-lymfocytter fra mus Peyer ' s patcher eller B celle lymfom cellelinje, Raji b9,10 . Dette resulterer i et delsett av caco-2 celler som uttrykker M celle markører Sialyl Lewis et antigen og UEA-1 i polarisert epitel9,10. (Disse markørene er også uttrykt på begeret celler i intestinal vev, så i dag er mindre hyppig brukt som definitive M celle markører11,12.) Dette caco-2-M celle systemet har blitt brukt til å studere partikkel opptak og bakterier translokasjon13,14. Men caco-2 celler er en etablert cellelinje fra en stor intestinal adenokarsinom med forvirrende faktor som ulike kilder til caco-2 celler vise forskjellige fenotyper blant Labs15. Videre kan de ikke fullt ut recapitulate den transkripsjon nivåer av sanne M celler, som de mangler uttrykk for tiden kjent M celle markører GP2 og SpiB16. Derfor er det behov for flere og flere fysiologisk relevante kultur modeller for å kunne studere M celle utvikling og funksjoner.

Innen de siste ti årene har feltet av enteroid-avledet modellsystemer av tarmen raskt blitt framover fra den første oppdagelsen at tarm stamceller avledet fra menneskelige intestinal biopsi kan selv-spre og selv-fornye i kultur 17 i , 18. viktigere, fjerning av stilk cellen fremme faktorer fra vekst mediene gjør at disse Stamcelle kulturer å differensiere i mange celletyper funnet i tarmen18. Videre antyder nyere arbeid viktigheten av RANKL-rang signalering i M celle utvikling i tarmen19,20. RANG reseptoren er medlem av TNF-familien av reseptorer som uttrykkes på epitel forløper celler i tarmen19 mens RANKL (The Rank reseptor ligand) er utgitt av stromal celler av Peyer ' s patcher20. Siden epitel celletyper tilstede i ileal enteroids ikke produserer RANKL, M celle differensiering i ileal enteroid kulturer kan bli indusert ved tilsetning av RANKL til kultur Media21,22. Inkludering av TNFα i kultur mediene bidrar til å støtte M celle utvikling i ileal enteroids23. Her beskriver vi metodene for å indusere differensiering av M-celler i intestinal monolagere avledet fra humant ileal enteroids. Våre metoder er delvis basert på modifikasjoner fra følgende protokoller21,22,23.

Protocol

Alle metodene som er beskrevet her er godkjent av Tufts University IBC og IRB.

1. inducing M celle differensiering i Human ileal Enteroid-avledet Monolagere

Merk: Denne protokollen bruker ileal enteroids avledet fra menneskelig vevs biopsi. Vennligst henvis til publiserte protokoller for metoder for hvordan å vokse og passasje disse cellene18,24. Følgende metoder for å utvikle monolagere ble tilpasset fra Zou et al.24. Metoder for å indusere M celler i ileal enteroid-avledede kulturer ble tilpasset fra tidligere rapporter21,22,23. Alt arbeid er utført i en steril vev kultur hette og incubations er i hette eller vev kultur inkubator som indikert. Se tabell over nødvendige materialer for å forberede ileal enteroid monolagere og ulike medier.

  1. Grow ileal enteroids for 4-10 dager i ekstracellulære matrise (ECM) (se tabell over materialer) (figur 1), avhengig av deres iboende vekstrater, før seeding på transwells.
  2. Coating transwell membraner
    1. Plasser ønsket antall transwells i en 24-brønn plate skape et to-kammer system.
    2. Fortynne ECM 25-fold i kaldt sterile fosfat-bufret saltvann (PBS) og tilsett 100 μL av kald fortynnet oppløsning i hver øvre kammer på membranen.
      Merk: ECM og fortynnet ECM-løsning må oppbevares på is til like før tillegg.
    3. Dekk den 24-brønn plate med lokk og Plasser platen i en vev kultur inkubator ved 37 ° c for 2 h å tillate ECM herding på membranen.
    4. Etter 2 h, fjerne platen fra inkubator og plass i en vev kultur hette. Bruk steril pinsett til å invertere hver transwell for å fjerne gjenværende oppløsning forsiktig. La membraner airdry i hette med lokket åpent mens cellene samles (trinn 1.3.1-1.3.11).
  3. Dissociating ileal enteroids i enkeltceller
    1. Fjern plate av ileal enteroids fra inkubator og forsiktig fjerne kultur Media fra hver brønn ved vakuum aspirasjon eller med en pipette.
      Merk: En brønn av ileal enteroids inneholder ca 100 sunne cyster er tilstrekkelig til frø 1.5-2 brønner.
    2. Tilsett 500 μL av iskald 0,5 mM ethylenediaminetetraacetic syre (EDTA) til hver brønn som inneholder ileal enteroids suspendert i ECM for å bryte opp ECM. Pipetter opp og ned kraftig med en P1000 pipettehjelper satt til 500 μL for å bryte opp ECM og dermed slippe ileal enteroids inn i løsningen. For å forbedre oppløsningen av ECM, etter pipettering, rist platen kraftig ved 4 ° c i 30 minutter.
    3. Samle løsningen fra hver brønn i 15 mL koniske rør.
      Merk: Samle opp til 10 brønner per 15 mL konisk slange for optimal enkelt celle samling.
    4. Pellet cellene i en sentrifuge ved 140 x g og 4 ° c i 5 min. pellet skal være synlig, men kan lett bli forskyves, så sakte fjerne supernatanten ved vakuum aspirasjon eller med en pipette.
      Merk: Hvis det er bekymret for tap av pellet og celler, bruk en pipette og lagre supernatanten i et eget rør.
    5. For å fordøye tette veikryss koblinger og bryte opp ileal enteroids i enkeltceller, resuspend pellet i 500 μL av romtemperatur Trypsin per hver 5 brønner samlet i trinn 1.3.3. Ved hjelp av en P1000, pipette opp og ned for å disaggregate klumper og ruge rørene i en 37 ° c vannbad i 5 minutter eller mindre.
      Merk: Optimalisering er nødvendig for å bestemme riktig mengde tid som kreves for å ruge rørene slik at cellene er brutt opp, men ikke over-trypsinized til det punktet at de dør. Bruk Trypan blå i trinn 1.3.9 for å sikre at cellene er levedyktige etter Trypsin behandling.
    6. Tilsett 1 mL Advanced DMEM/F12 med 10% Foster storfe serum (FBS) per 500 μL av Trypsin for å deaktivere Trypsin.
    7. Pipetter opp og ned med en P1000 satt til 500 μL minst 50 ganger mot siden av det koniske røret til ytterligere disaggregate gjenværende klumper i enkeltceller.
    8. Plasser en celle sil 40 μm over en 50 mL konisk og tilsett 1 mL Advanced DMEM/F12 med 10% FBS for å fukte celle sil. Pipetter den enkle celle suspensjonen fra 15 mL konisk på sil. Vask sil med 1 mL avansert DMEM/F12 med 10% FBS.
    9. Overfør cellene som gikk gjennom celle sil fra 50 mL koniske til en ny 15 mL konisk slange. Under sentrifugering trinn 1.3.10, vil Cellular pellet bli lettere sett i en 15 mL konisk rør. Tell cellene ved hjelp av en hemocytometer. Bruk Trypan blå for å bekrefte at cellene fortsatt er i live. Vanligvis er > 95% levedyktighet observert.
    10. Mens du teller cellene, sentrifuger cellene i den nye 15 mL rør ved 400 x g og romtemperatur i 5 min. Cell pellet bør være synlig. Fjern forsiktig supernatanten med en pipette, og lagre supernatanten på nytt i tilfelle pellet blir forskyves.
    11. Forbered endret komplett vekst Media25 (MCMGF + Media) supplert med 10 μM Y-27632. Resuspend pelleted celler på 2,5 x 105 celler/200 ΜL i MCMGF +. Se bemerkninger i diskusjonen om optimalisering av celle seeding tall.
      Merk: MCMGF + Media er avansert DMEM/F12 med 75% L-Wnt3a Media, 10% R-spondin betinget Media, 5% noggin betinget Media, 1x B27 supplement, 1x N2 supplement, 1 mM N-acetylcysteine, 50 ng/mL mus rekombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrin jeg, 10 mM HEPES, 2 mM GlutaMAX og 1x penicillin/Streptomycin (valgfritt).
    12. Sørg for at ECM-belagte membraner som er klargjort i trinn 1,2, har tørket helt, som vurderes av øyet. Vask det øvre kammeret med 200 μL av MCMGF +. Tilsett 200 μL av celle løsning i hver øvre kammer.
    13. Tilsett 700 μL av MCMGF + med 10 μM Y-27632 til hvert nedre kammer. Plasser platen i en 37 ° c vev kultur inkubator med 5% CO2.
    14. Etter 1 dag med vekst, Fjern mediene fra øvre kammer og Erstatt med 200 μL av frisk MCMGF +, for å hindre vekst av flere celle lag.
  4. Skifte medium
    1. En gang monolagere er ~ 80% confluent, vanligvis imellom dager 1-3 stolpe-seeding, ombytte basolateral Media med differensiering Media (DM) for administrere brønner (se steg 1.4.2 for flere detaljen) eller med M cellen Media for M cellen induksjon brønner (se steg 1.4.3 om mere detaljen). Bytt ut Media i øvre kammer med DM for begge forholdene.
      Merk: DM er avansert DMEM/F12 med 5% noggin-conditioned Media, 1x B27 supplement, 1x N2 supplement, 1 mM N-acetylcysteine, 50 ng/mL mus rekombinant EGF, 500 nM A-8301, 10 nM [Leu15]-gastrin jeg, 10 mM HEPES buffer, 2 mM GlutaMAX, og 1x penicillin/Streptomycin (valgfritt ). M celle Media er DM supplert med 200 ng/mL RANKL og 50 ng/mL TNFα.
    2. For kontroll brønner som ikke skal inneholde M-celler, tilsett 200 μL av DM til det øvre kammeret og 700 μL DM til bunnen kammeret.
    3. For å indusere M-celler, tilsett 200 μL av DM til det øvre kammeret og 700 μL av M celle medier til bunn kammeret.
    4. Ombytte mediet enhver 2 dager. For kontroll brønner, erstatte DM i øvre og nedre kamre. For M celle brønner, Erstatt DM i det øvre kammeret og M celle Media i nedre kammeret.
      Merk: Etter dag 7 innlegg celle-seeding, M celler er fullt indusert i monolagere.

2. verifiserer M Cell differensiering av qRT-PCR

Merk: Utfør følgende arbeid på en steril RNAse-ledig benkplass. Se tabell over materialer for en liste over foretrukne materialer for QRT-PCR.

  1. Fjern mediene fra øvre og nedre kamre og vask det øvre kammeret 2x forsiktig med 300 μL av romtemperatur PBS.
  2. Tilsett 300 μL av Trizol i hver øvre kammer. Ruge ved romtemperatur i 5 min.
    FORSIKTIG: Bruk hansker og vernebriller når du bruker Trizol for å unngå kontakt med huden som angitt i produsentens anvisninger.
  3. I mellomtiden, etiketten mikrosentrifugen rør for hver brønn og tilsett 700 μL av Trizol til hvert rør.
  4. Samle celle homogenate ved pipettering opp og ned 3x forsiktig med en P1000 og overføre innholdet i tilsvarende mikrosentrifugen tube. Vortex for 5 s å blande.
  5. Oppbevar prøvene ved romtemperatur i ytterligere 3 min. Oppbevar ved-80 ° c i opptil en måned.
  6. Følg standard qRT-PCR metodikk for RNA isolasjon, DNase behandling, Reverse transkripsjon og qRT-PCR reaksjoner. Se primer listen i tabell over materialer.

3. verifiserer M Cell differensiering av Immunofluorescence

Merk: Hold alltid nedre kammer av platen fylt med PBS slik at membraner forblir våte. Denne prosedyren er utført på benken. Se tabell over materialer for en liste over foretrukne materialer for immunofluorescence.

  1. Fjern mediene fra øvre kammer og vask 2x forsiktig med 300 μL av romtemperatur PBS. Tilsett 100 μL av romtemperatur 4% PFA i PBS til øvre kammer. Dekkplaten med folie og la stå i 25 min ved romtemperatur. Fjern 4% PFA.
    Forsiktig: 4% PFA skal avhendes som farlig kjemisk avfall.
  2. Vask øvre kammer 3x med 300 μL av romtemperatur PBS. På dette stadiet kan prøvene forbli ved 4 ° c i inntil en måned før farging. Når beiset, bør prøvene være visualisere innen en uke for best kvalitet bilder.
  3. Ruge monolagere med 100 μL av 5% storfe serum albumin (BSA) oppløst i PBS i 30 min i mørket ved romtemperatur for å blokkere monolagere.
  4. Forbered GP2 primære antistoff løsning i 1% BSA i PBS ved en fortynning av 1:100. Tilsett 100 μL per brønn. Stain for 1 t ved romtemperatur i mørket. Fjern løsningen.
    Merk: Ikke permeabilize monolagere før primær flekken for GP2 oppstår fordi optimal primære GP2 overflaten farging av M celler oppnås uten permeabilization.
  5. Vask øvre kammer 3x ganger med 300 μL av romtemperatur PBS.
  6. Forbered sekundær flekk løsning av fluorescensmerkete merket geit anti-mus IgG på 1:200, phalloidin på 1:100 og DAPI i 1% BSA + 0,1% Triton i PBS. Tilsett 100 μL per brønn. Stain i 30 minutter ved romtemperatur i mørket.
    Merk: Triton er addert å det sekundær flekk løsning å permeabilize cellene i løpet av denne steg for lated phalloidin flekk.
  7. Vask 3x med 300 μL PBS.
  8. Plasser en 5 μL dråpe monteringsløsning (tabell over materialer) på et glass lysbilde. Fjern brønnen fra 24 brønn platen og Inverter. Skjær membranen forsiktig fra brønnen ved hjelp av en skalpell. Plasser membranen med cellene vendt opp på dråpe monterings løsningen på glassplaten. Tilsett 10 μL monteringsløsning på toppen og midten av membranen og Plasser en dekkglass på toppen for å forsegle membranen mellom glass skyve-og dekkglass.
  9. Tørk lysbildene ved romtemperatur i mørket i 24 h. fargede lysbilder bør være på konfokalmikroskopi mikroskop innen 1 uke etter farging.

Representative Results

Ileal enteroids vokst i ECM analyseres visuelt og av qRT-PCR for deres relative helsetilstand og differensiering stater som et middel for kvalitetskontroll for ileal enteroid kulturer og for bruk i monolagere. Udifferensierte ileal enteroids vokst i ECM vises klar og cystisk i morfologi, noe som indikerer tilstedeværelsen av mange stamceller (figur 1a). Over tid, udifferensierte ileal enteroids vokst i vekst Media kan ta på en mellomliggende fenotype hvor noen vil vises cystisk og noen synes ugjennomsiktig (figur 1B). Ofte ligner våre udifferensierte prøver på de som er vist i figur 1B i stedet for figur 1a. Disse mellomliggende kulturer inneholder mer uhelbredelig differensiert enterocytes målt ved uttrykk for enterocyte markør, sucrase isomaltase (SI), og antagelig ekstrudert døde enterocytes i lumen bidra til deres tette utseende. Ileal enteroids kan brukes i denne mellomliggende tilstand for monolag utvikling, men det må holdes i bakhodet at mengden av intestinal stamceller til stede i kulturer kan være lav, og noen differensiert celletyper kan være til stede (for eksempel se qRT-PCR nivåer i udifferensierte prøver dyrket i ECM ligner figur 1B i figur 2). Til sammenligning, ileal enteroids kultivert med differensiering Media i ECM for 5 + dager vises jevnt formørket og lobular og kulturer med denne morfologi er ikke gode kandidater for seeding monolagere (figur 1C).

Uttrykk for Stamcelle gener og gener av intestinal celle differensiering kan analyseres av qRT-PCR som et annet middel for å vurdere helsetilstanden til ileal enteroids dyrket i ECM og deres differensiering evner en gang seeded som monolagere på transwells. Uttrykket av en stilk cellen gen, LGR5, an enterocyte genet, si, et beger celle gen, MUC2, og en Paneth celle Gene, LYZ, er SAMMENLIGNET mellom udifferensierte ileal enteroid kulturer vokst i ECM og differensiert ileal enteroid monolagere i nærvær eller fravær av RANKL/TNFα (figur 2). Mens verdiene kan variere mellom eksperimenter, bør uttrykk for LGR5 reduseres etter differensiering av monolagere18,26. LGR5 -uttrykket oppdages vanligvis ikke i de atskilte ileal MONOLAGERE uten RANKL og TNFα etter dag 7. Omvendt, uttrykk for markører for differensiering av bestemte celletyper, for eksempel si og MUC2, øke etter differensiering18. Uttrykk for LYZ avtar vanligvis etter differensiering i våre kulturer. Hvis ileal enteroid kulturer som brukes for å lage monolagere ser mer ut som figur 1B enn figur 1a, øker i intestinal differensiering markører kan være beskjeden etter differensiering fordi disse første kulturene er heterogen i intestinal celletyper og har en høyere basal nivå av si og MUC2. Imidlertid oppstår differensiering i monolagere fortsatt som vurdert av tap av LGR5 uttrykk og mikroskopi (se nedenfor). Videre tillegg av RANKL og TNFα til differensiering Media reduserer tapet av LGR5 uttrykk (figur 2). Parallelt uttrykk for si og MUC2 er noe lavere enn i differensiert tilstand mangler RANKL og TNFα selv om deres nivåer øker over udifferensierte tilstand.

M celle differensiering i monolagere bestemmes både av qRT-PCR og immunofluorescence bruker to M celle spesifikke markører inkludert celle overflate glykoprotein 2 (GP2) og transkripsjon faktor SpiB21. Uttrykket av GP2 og SPIB er upregulated i ileal enteroid-avledet monolagere i nærvær av RANKL og TNFα og er ikke PÅVIST i ikke-RANKL og TNFα behandlede prøver (Figur 3). Uttrykk for disse markørene kan også bli normalisert til et stykke tynn tarm vev22, hvis tilgjengelig. Dette tillater fold endring av disse M celle markører å bli sammenlignet med vev som har M celler i stedet for å kontrollere monolagere som ikke har noen uttrykk for disse markørene og tillater standardisering mellom eksperimenter i en Lab. M-celler blir også oppdaget av overflate uttrykk av GP2 ved immunofluorescence (Figur 4). Vanligvis, i en confluent monolag, 1 til 5 M celler er observert i et gitt mikroskop felt ved 40X forstørrelse av dager 6 til 8 etter seeding i prøver behandlet med RANKL og TNFα (Figur 4a-D). Det er ikke sett noen GP2-uttrykk i de ubehandlede prøvene (figur 4e). Den ortogonale visningen av XZ-flyet overlappet med en phalloidin-sonde viser utgangen strukturer rundt hver celle og GP2-uttrykk på den apikale overflaten til M-cellene (Figur 4F-G). Denne modellen viser den lave frekvensen av M celler funnet i menneskets tarmen1,2,8. For å rense og isolere M-celler for videre studier, kan M-celler bli flekkete ved hjelp av GP2 overflate uttrykk og sorteres ved hjelp av FACS for GP2 + celler.

M celler binder til og transportere antigen fra intestinal lumen til immunceller bosatt under epitel2. Sekretoriske IgA produsert i tarmen binder seg til bakterier og kan binde seg til den apikale overflaten av M celler for å lette transport av mikrober27,28. For å finne ut om M-cellene utviklet i denne modellen er i stand til å binde til IgA, er humant serum IgA lagt til øvre kammer, lov til å binde for 1 time, og deretter monolagere er forberedt på immunofluorescence analyse. Tilstedeværelsen av IgA på M celler er visualisere ved hjelp av en fluor-bøyd sekundært antistoff som anerkjenner den tunge kjeden av humant serum IgA. M-celler behandlet med IgA for 1 h har IgA bundet til den apikale overflaten (figur 5a), mens M-celler i kontroll brønner som bare ble behandlet med sekundær antistoff mot IgA, ikke har noe synlig signal (figur 5B). Videre, IgA spesielt binder seg til apikale overflaten av M-celler og er ikke funnet bundet til noen celler mangler GP2 overflaten flekken. I tillegg har M celler karakteristisk kortere tett utgangen på deres apikale overflate2. For å analysere M celle morfologi i denne modellen, ileal enteroid-avledet monolagere dyrkes i 7 dager og høstes for immunofluorescence analyse av F-utgangen bruker phalloidin. Målinger av utgangen piksel intensitet beregnes for M-celler og for ikke-M-celler som er direkte tilstøtende til hver M-celle ved hjelp av ImageJ-programvaren (figur 6a). Utgangen intensitet er redusert på GP2 + M celler i denne modellen og et representativt bilde er vist i figur 6b. Totalt har M-cellene som er utviklet i denne ileal enteroid monolag modellen karakteristiske genuttrykk, morfologi og noen M-celle funksjoner av humant tarm M-celler, slik som binding til IgA.

Figure 1
Figur 1: representativ morfologi av humant ileal enteroids i ECM en ukes etter splitting. (A) klar og cystisk udifferensierte ileal enteroids. (B) Intermediate fenotype med noen cystisk ileal enteroids og noen ugjennomsiktig lobular ileal enteroids. (C) formørket og lobular differensiert ileal enteroids. Bilder tatt gjennom linsen på en optisk lys mikroskop ved 4X forstørrelse ved hjelp av et iPhone7 kamera. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: relativ uttrykk for Stamcelle og differensiering markører for menneskelig ileal enteroids vokst i ECM eller differensiert som monolagere. Ileal enteroids ble dyrket i 7 dager i ECM (udifferensierte) eller vokst og differensiert som monolagere uten (differensiert) eller med RANKL og TNFα (differensiert + R/T). Ileal enteroid kulturer eller monolagere ble høstet i Trizol for RNA-ekstraksjon. Genuttrykket ble bestemt av qRT-PCR og uttrykkes i forhold til GAPDH. Data er gjennomsnittet av 3 uavhengige brønner av ileal enteroids eller monolagere per betingelse. Feilfelt indikerer at SEM. ND ikke oppdages. Statistisk betydning ble bestemt på log-transformert verdier ved hjelp av enveis ANOVA med Dunnett ' s flere sammenligninger test sammenligne med udifferensierte. * * p < 0,01, * * * p < 0,001 Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: relativ uttrykk for M-celle spesifikke markører GP2 og SPIB fra humant ileal enteroid-avledet monolagere. RANKL/TNFα behandlet og ikke-behandlet Human ileal enteroid-avledet monolagere ble høstet i Trizol for RNA utvinning etter 7 dager etter seeding. Genuttrykket ble bestemt av qRT-PCR og uttrykkes i forhold til GAPDH. Data er gjennomsnittet av 6 uavhengige monolagere per betingelse. Feilfelt indikerer at SEM. ND ikke oppdages. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: IMMUNOFLUORESCENCE GP2-uttrykk på M-celler i humant ileal enteroid monolagere over tid. RANKL/TNFα behandlet og ikke-behandlet menneskelige ileal enteroid-avledet monolagere ble løst i 4% PFA og beiset for immunofluorescence på ulike indikerte dager etter seeding. Bildene ble analysert ved hjelp av ImageJ programvare. DAPI = blå; Glykoprotein 2 (GP2) = rød. (A-D) RANKL/TNFα behandlet monolagere på ulike dager etter seeding. (E) ikke-behandlet monolag høstet på dag 7 post-seeding. (F-G) Ortogonale XZ fly av monolagere på dag 7 post-seeding kledde med phalloidin sonde for F-utgangen. Phalloidin = cyan. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Iga binder seg spesielt til den apikale overflaten av M-celler. RANKL/TNFα-behandlet humant ileal enteroid-avledet monolagere ble dyrket i 7 dager og deretter (A) behandlet med 10 mikrogram humant serum IgA for 1 t eller (B) MOCK-behandlet med PBS bare (no IgA kontroll). Etter 1 time ble monolagere vasket 2x i PBS, ble løst i 4% PFA, permeabilized med 0,1% TritonX-100, og beiset for immunofluorescence. Bildene ble analysert ved hjelp av ImageJ programvare og er representative for 3 uavhengige eksperimenter. DAPI = blå; Glykoprotein 2 (GP2) = rød; Antistoff mot humant serum IgA = grønn; Phalloidin = cyan. Sorte piler betegner IgA som er bundet til apikale overflate. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: M-cellene har redusert utgangen intensitet sammenlignet med tilstøtende ikke-M-celler. RANKL/TNFα-behandlet menneskelig ileal enteroid-avledet monolagere ble dyrket i 7 dager og deretter fast i 4% PFA og ble beiset for immunofluorescence. (A) ved hjelp av IMAGEJ ble GP2 + M-celler skissert ved hjelp av verktøyet for fri hånds markering og målinger av areal og integrert tetthet ble tatt i Phalloidin-kanalen. Den samme analysen ble deretter fullført for hver tilstøtende ikke-M-celle som naboer M-cellen. Den rå integrerte tettheten ble delt av arealet av hver enkelt celle for normalisering. Den gjennomsnittlige integrerte tettheten/området ble beregnet for hver tilstøtende ikke-M-celler for hver M-celle. Bildene ble analysert fra 3 uavhengige eksperimenter; hvert punkt er en M-celle eller gjennomsnittet av nærliggende celler. Feilfelt angir SD. statistisk betydning ble bestemt på log-transformert verdier ved hjelp av en parvis t test. p = 0,0001 (B) representativt bilde av XZ Plane fra plot in A. bilder ble analysert ved hjelp av ImageJ programvare. DAPI = blå; Glykoprotein 2 (GP2) = rød; Phalloidin = cyan. Vennligst klikk her for å se en større versjon av dette tallet.

Discussion

For å utvikle monolagere som skiller seg skikkelig inn i de store tarm celle typene og M-cellene, er det avgjørende å være klar over flere faktorer. Ileal enteroids må høstes fra ECM-kulturer som er udifferensierte og har en høy andel av Lgr5 + stamceller. Visuelt bør flertallet av de ileal enteroids i ECM-kulturene ikke bli formørket og multilobular, og LGR5 uttrykk bør oppdages i disse kulturene av QRT-PCR analyse. Kvalitetskontroll av conditioned Media er viktig for utbredelsen av udifferensierte kulturer over tid og må fullføres for hver gruppe med conditioned Media som produseres. Kvalitetskontroll kan gjennomføres ved å teste en ny gruppe med medier på noen ECM-kulturer og sammenligne morfologi av ileal enteroids til et tidligere parti med medier i løpet av en uke. LGR5 Expression bør være relativt lik i ileal enteroid kulturer dyrket i den nye gruppen av medier i forhold til forrige batch.

Under utarbeidelse av ileal enteroids for seeding som monolagere, er det viktig å kraftig pipette cellen løsningen etter inkubasjons med Trypsin å bryte opp ileal enteroids i enkeltceller. Celle klumper kan føre til multi-lags formasjon når seeded for monolagere. I tillegg er det viktig å empirisk bestemme antall celler som kreves for å danne en monolag for hver enkelt ileal enteroid linje som er innhentet. Vanligvis kan denne verdien variere fra 2,5 x 105 -5,0 x 105 celler/brønn, men avhenger av graden av cystisk til ikke-cystisk ileal enteroids i kulturer og varierer for hver enkelt ileal enteroid linje. Av erfaring, ileal enteroids vokst i ECM som vises mindre cystisk krever høyere celle seeding tetthet for å oppnå monolagere. Det anbefales å vaske øvre kammeret etter 1 dag med vekst ved forsiktig pipettering Media opp og ned 2-3 ganger og erstatte med frisk vekst Media. Denne prosessen løsner celler som har landet på toppen av andre celler redusere sannsynligheten for multi-lags formasjon. Bytte av media i det øvre kammeret fra vekst Media til M celle Media når monolagere er ~ 80% confluent, som vanligvis oppstår på dag 2 post-seeding, bidrar til å oppnå god M celle differensiering. Tilsetting av RANKL/TNFα til øvre kammer under M celle induksjon ikke fører til utvikling av et større antall M celler per monolag og derfor kan stå ut av det øvre kammer Media. Transwells av varierende pore størrelser kan brukes i denne protokollen uten å påvirke M celle utvikling; imidlertid må celle seeding tetthet optimaliseres for de med større pore størrelser. Kollagen IV kan erstatte ECM som en kjeller membran protein belegg for transwells eller brønn plater som kan være bedre egnet for visse applikasjoner.

Ileal enteroid-avledet monolagere på transwells gi en to-kammer system som gjør det mulig for etablering av definerte apikale og basolateral overflater slik at 4-5 ulike typer epitel intestinal celler kan polariserer å uttrykke overflaten markører på hver side i forhold til som finnes i tarmen. Flere faktorer kan legges til på begge sider, for eksempel partikler, smittsomme midler eller andre celletyper. Men hittil noen begrensninger gjenstår. Som beskrevet, er dette systemet et statisk system som mangler fysiologisk flyt, intestinal sammentrekninger, og intestinal innhold. I tillegg er villus-krypten tapt ved dannelsen av en flat monolag. Disse systemene mangler Peyer ' s patch regioner, immunceller, og stromal celler. Om mangelen på immun-og stromal celler som ligger tett under M-cellene påvirker invaginations som ikke er observert i dette systemet og andre fysiologiske funksjoner, er et viktig fremtidig område for etterforskning. Denne protokollen kan tilpasses en 96-brønn plate eller en multi-brønn plateformat. Prosedyren for belegg på 96-brønn plate med ECM og seeding med enkeltceller fra ileal enteroids forblir den samme som for transwells. Titrering av celle seeding tettheten som kreves for å få monolagere må gjøres, men vanligvis spenner fra 1,0 x 105 -3,0 x 105 celler/brønn i en 96-brønn plateformat. M-celler er indusert ved å erstatte vekst mediene med M celle Media når monolagere er 80% confluent vanligvis av dager 1-3 avhengig av første celle seeding tetthet.

Denne metoden for å skille M-celler fra ileal enteroids in vitro gir betydelige forbedringer i forhold til caco-2-metoden. De ileal enteroids er primære celler og minst 4-5 epitelceller typer er til stede i systemet. I tillegg kan ileal enteroid linjer avledet fra forskjellige personer bli studert for å undersøke hvordan genetikk eller sykdom tilstand påvirke M celle utvikling og atferd. Ytterligere manipulasjon av ileal enteroids under M celle differensiering vil gi en bedre forståelse av M celle utvikling inkludert karakteriserer M celle forløper celler. Til slutt, siden den molekylære mekanismer av M celle fagocytose og transcytosis er fortsatt ikke helt forstått3,29, denne modellen gir mulighet til å studere og visualisere antigen og partikkel opptak av M celler.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Dette arbeidet ble støttet av NIAID U19AI131126 til Dr. is berg (Tufts University School of Medicine) og Dr. Kaplan (Tufts University); (JM er prosjekt 2 leder) og NIAID R21AI128093 til JM. ACF ble støttet delvis av NIAID T32AI007077. SEB og MKE ble støttet av NIAID U19AI116497-05. Vi takker medlemmer av Mecsas Lab, ng Lab, og Dr. is berg ved Tufts University School of Medicine for nyttige diskusjoner. Konfokalmikroskopi bildebehandling ble utført ved Tufts Center for nevrovitenskap Research, P30 NS047243.

Materials

Name Company Catalog Number Comments
[Leu15]-Gastrin I Sigma-Aldrich G9145 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 10 µM
Final Concentration: 10 nM
0.5 M EDTA Invitrogen 15575020 For breaking up ECM
Solvent: PBS
Stock Concentration: 0.5 M
Final Concentration: 0.5 mM
40 µm cell strainer Corning 352340 For excluding clumps from single cells
Solvent:
Stock Concentration:
Final Concentration:
A-8301 Sigma-Aldrich SML0788-5MG MCMGF+ and DM ingredient
Solvent: DMSO
Stock Concentration: 500 µM
Final Concentration: 500 nM
Advanced DMEM/F12 Invitrogen 12634-028 MCMGF+ and DM Basal medium
Solvent:
Stock Concentration:
Final Concentration:
Alexa Fluor 594 goat anti-mouse IgG Thermo Fisher A-11005 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Alexa Fluor 647 Phalloidin Invitrogen A22287 Optional secondary stain for F-actin
Solvent:
Stock Concentration:
Final Concentration: 1:100
B27 Supplement Invitrogen 17504-044 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 50x
Final Concentration: 1x
Bovine Serum Albumin Chem-Impex 00535 5% for blocking solution
Solvent: PBS
Stock Concentration:
Final Concentration: 0.01
Chloroform Fisher Scientific C298-500 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Circle coverslips Thomas Scientific 1157B50 For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
DAPI (4′,6-diamidino-2-phenylindole) Thermo Fisher 62247 For secondary stain
Solvent: PBS
Stock Concentration: 100x
Final Concentration: 1x
DEPC Treated RNAse free H2O Fisher Scientific BP561-1 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
DNA Removal Kit Invitrogen AM1906 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Ethyl Alcohol, 200 proof Sigma Aldrich EX0276-4 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Feather Scalpels VWR 100499-580 For cutting membrane from transwells
Solvent:
Stock Concentration:
Final Concentration:
Fetal Bovine Serum (FBS) Gibco 26140079 For inactivating trypsin
Solvent: Advanced DMEM/F12
Stock Concentration: 1
Final Concentration: 0.1
Glass slides Mercedes Scientific MER 7200/90/WH For mounting membrane on glass slide
Solvent:
Stock Concentration:
Final Concentration:
GlutaMAX Invitrogen 35050-061 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 200 mM
Final Concentration: 2 mM
GP2 Antibody MBL International D277-3 Surface stain for M cells
Solvent:
Stock Concentration:
Final Concentration: 1:100
HEPES Invitrogen 15630-080 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 1 M
Final Concentration: 10 mM
Human Serum IgA Lee BioSolutions 340-12-1 For functional analysis of M cells
Solvent: PBS
Stock Concentration: 1 mg/mL
Final Concentration: 10 µg
L-Wnt3a conditioned media Cell line from ATCC CRL-2647 Refer to ATCC Product Sheet for L Wnt­3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient
Solvent:
Stock Concentration:
Final Concentration: 75% in MCMGF+
0% in DM
Matrigel, GFR, phenol free Corning 356231 Extracellular Matrix (ECM)
Solvent:
Stock Concentration:
Final Concentration:
Mouse recombinant EGF Invitrogen PMG8043 MCMGF+ and DM ingredient
Solvent: PBS
Stock Concentration: 50 µg/mL
Final Concentration: 50 ng/mL
N2 Supplement Invitrogen 17502-048 MCMGF+ and DM ingredient
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
N-acetylcysteine Sigma-Aldrich A9165-5G MCMGF+ and DM ingredient
Solvent: H2O
Stock Concentration: 500 mM
Final Concentration: 1 mM
Noggin conditioned media Cell line gift from Dr. Gijs van den Brink (University of Amsterdam) Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient
Solvent:
Stock Concentration:
Final Concentration: 5% in MCMGF+
5% in DM
Paraformaldehyde (PFA) MP Biomedicals 2199983 For fixing monolayers
Solvent: PBS
Stock Concentration: 0.16
Final Concentration: 0.04
PBS, -Mg, -Ca Corning MT21040CV Solvent for 0.5 mM EDTA
Solvent:
Stock Concentration:
Final Concentration:
Penicillin/Streptomycin Invitrogen 15140-122 Optional ingredient of MCMGF+ and DM
Solvent:
Stock Concentration: 100x
Final Concentration: 1x
Prolong Gold Invitrogen P36930 Antifade mounting solution
Solvent:
Stock Concentration:
Final Concentration:
Qiagen RNeasy Kit Qiagen 74106 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
Recombinant human RANKL Peprotech 310-01 Used to induce M cells
Solvent: H2O
Stock Concentration: 0.1 mg/mL
Final Concentration: 200 ng/mL
Recombinant murine TNFa Peprotech 315-01A Used to induce M cells
Solvent: H2O
Stock Concentration: 5 mg/mL
Final Concentration: 50 ng/mL
R-spondin conditioned media Cell line from Trevigen 3710-001-01 Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient
Solvent:
Stock Concentration:
Final Concentration: 10% in MCMGF+
0% in DM
Secondary anti-human IgA antibody Jackson Immuno Research 109-545-011 For secondary stain
Solvent:
Stock Concentration:
Final Concentration: 1:200
Super Script IV Reverse Transcriptase Thermo Fisher 18091200 For conversion of RNA to DNA
Solvent:
Stock Concentration:
Final Concentration:
Transwell inserts, 24 well-sized Greiner Bio-One 662641 0.4 µm pore size
Solvent:
Stock Concentration:
Final Concentration:
TritonX-100 Sigma-Aldrich T8787 Not required during GP2 primary stain
Solvent: 1% BSA
Stock Concentration:
Final Concentration: 0.001
TRIzol Invitrogen 15596018 For RNA isolation
Solvent:
Stock Concentration:
Final Concentration:
TrypLE Express Invitrogen 12605010 Trypsin for breaking up enteroids into single cells
Solvent:
Stock Concentration:
Final Concentration:
Y-27632 Sigma-Aldrich Y-0503 MCMGF+ ingredient on day 0
Solvent: H2O
Stock Concentration: 5 mM
Final Concentration: 10 µM
GAPDH forward primer CATGAGAAGTATGACAACAGCCT
GAPDH reverse primer AGTCCTTCCACGATACCAAAGT
GP2 forward primer CAATGTGCCTACCCACTGGA
GP2 reverse primer ATGGCACCCACATACAGCAC
LYZ forward primer CGCTACTGGTGTAATGATGG
LYZ reverse primer TTTGCACAAGCTACAGCATC
MUC2 forward primer ATGCCCTTGCGTCCATAACA
MUC2 reverse primer AGGAGCAGTGTCCGTCAAAG
SI forward primer TCCAGCTACTACTCGTGTGAC
SI reverse primer CCCTCTGTTGGGAATTGTTCTG
SPIB forward primer CAGCAGCCGCTTTTAGCCAC
SPIB reverse primer GCATATGCCGGGGGAACC
LGR5 forward primer TCAGTCAGCTGCTCCCGAAT
LGR5 reverse primer CGTTTCCCGCAAGACGTAAC

DOWNLOAD MATERIALS LIST

References

  1. Kraehenbuhl, J. P., Neutra, M. R. Epithelial M cells: differentiation and function. Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).
  2. Neutra, M. R., Frey, A., Kraehenbuhl, J. P. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86, (3), 345-348 (1996).
  3. Nakamura, Y., Kimura, S., Hase, K. M. cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance. Inflammation and Regeneration. 38, 15 (2018).
  4. Clark, M. A., Hirst, B. H., Jepson, M. A. M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells. Infection and Immunity. 66, (3), 1237-1243 (1998).
  5. Jensen, V. B., Harty, J. T., Jones, B. D. Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches. Infection and Immunity. 66, (8), 3758-3766 (1998).
  6. Jones, B. D., Ghori, N., Falkow, S. Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of Experimental Medicine. 180, (1), 15-23 (1994).
  7. Marra, A., Isberg, R. R. Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium. Infection and Immunity. 65, (8), 3412-3421 (1997).
  8. Ohno, H. Intestinal M cells. Journal of Biochemistry. 159, (2), 151-160 (2016).
  9. Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria. Science. 277, (5328), 949-952 (1997).
  10. Gullberg, E., et al. Expression of specific markers and particle transport in a new human intestinal M-cell model. Biochemical and Biophysical Research Communications. 279, (3), 808-813 (2000).
  11. Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. Human intestinal M cells display the sialyl Lewis A antigen. Infection and Immunity. 67, (2), 946-953 (1999).
  12. Jang, M. H., et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proceedings of the National Academy of Sciences of the United States of America. 101, (16), 6110-6115 (2004).
  13. Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation. Nature Protocols. 12, (7), 1387-1399 (2017).
  14. Martinez-Argudo, I., Jepson, M. A. Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2. Microbiology. 154, (Pt 12), 3887-3894 (2008).
  15. Lee, J. B., et al. Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays. European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).
  16. Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium. Mucosal Immunology. 6, (4), 666-677 (2013).
  17. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, (7244), 262-265 (2009).
  18. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141, (5), 1762-1772 (2011).
  19. Knoop, K. A., et al. RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium. Journal of Immunology. 183, (9), 5738-5747 (2009).
  20. Taylor, R. T., et al. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. Journal of Immunology. 178, (9), 5659-5667 (2007).
  21. de Lau, W., et al. Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured "miniguts". Molecular and Cellular Biology. 32, (18), 3639-3647 (2012).
  22. Rouch, J. D., et al. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PloS One. 11, (1), e0148216 (2016).
  23. Wood, M. B., Rios, D., Williams, I. R. TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures. American Journal of Physiology: Cell Physiology. 311, (3), C498-C507 (2016).
  24. Zou, W. Y., et al. Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections. Methods in Molecular Biology. (2017).
  25. Kozuka, K., et al. Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform. Stem Cell Reports. 9, (6), 1976-1990 (2017).
  26. Barker, N., et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449, (7165), 1003-1007 (2007).
  27. Mantis, N. J., et al. Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor. Journal of Immunology. 169, (4), 1844-1851 (2002).
  28. Rios, D., et al. Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria. Mucosal Immunology. 9, (4), 907-916 (2016).
  29. Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. Intestinal M cells: the fallible sentinels? World Journal of Gastroenterology. 13, (10), 1477-1486 (2007).
  30. Heijmans, J., et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Reports. 3, (4), 1128-1139 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics