जीनोम-वाइड पारस्परिक हेमीजिगिसिटी विश्लेषण के माध्यम से Saccharomyces खमीर की प्रजातियों के बीच थर्मोफ्लोरी अंतर की आनुवंशिक मानचित्रण

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

अनुक्रमण के माध्यम से पारस्परिक hemizygosity (आरएच-सेक) प्रजातियों के बीच एक विशेषता अंतर के आनुवंशिक आधार को मैप करने के लिए एक शक्तिशाली नई विधि है। hemizygotes के पूल transposon mutagenesis द्वारा उत्पन्न कर रहे हैं और उनकी फिटनेस उच्च भर अनुक्रमण का उपयोग कर प्रतिस्पर्धी विकास के माध्यम से ट्रैक किया जाता है। परिणामी डेटा का विश्लेषण विशेषता अंतर्निहित जीनों को इंगित करता है।

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

आधुनिक आनुवंशिकी का एक केंद्रीय लक्ष्य यह समझना है कि कैसे और क्यों जंगली में जीव फीनोटाइप में भिन्न होते हैं। तारीख करने के लिए, क्षेत्र काफी हद तक लिंकेज और एसोसिएशन मानचित्रण तरीकों की ताकत पर उन्नत किया गया है, जो डीएनए अनुक्रम वेरिएंट और एक प्रजाति के व्यक्तियों के बीच संभोग से रिकॉमबिनेंट संतान भर में phenotype के बीच संबंध का पता लगाने. इन दृष्टिकोणों, हालांकि शक्तिशाली, अच्छी तरह से प्रजनन अलग प्रजातियों के बीच अंतर विशेषता के लिए अनुकूल नहीं हैं. यहाँ हम प्राकृतिक विशेषता भिन्नता है कि आसानी से असंगत प्रजातियों के लिए लागू किया जा सकता है के जीनोम व्यापक विच्छेदन के लिए एक नई विधि का वर्णन. हमारी रणनीति, आरएच-सेक, पारस्परिक हेमीजेगोटे परीक्षण का जीनोम-व्यापी कार्यान्वयन है। हमने इसका उपयोग अपनी बहन प्रजाति एस विरोधाभासके सापेक्ष खमीर सैकरोमाइसीस सेरेविएस के हड़ताली उच्च तापमान वृद्धि के लिए जिम्मेदार जीनों की पहचान करने के लिए किया . आरएच-सेक पारस्परिक हेमीजोजोट्स का एक पूल बनाने के लिए ट्रांसपोसन म्यूटजेनेसिस का उपयोग करता है, जिसे उच्च-थ्रूपुट अनुक्रमण के माध्यम से उच्च तापमान प्रतियोगिता के माध्यम से ट्रैक किया जाता है। हमारे आरएच-सेक कार्यप्रवाह के रूप में यहाँ बाहर रखी नवोदित खमीर clade में प्राचीन, जटिल लक्षण विच्छेदन के लिए एक कठोर, निष्पक्ष तरीका प्रदान करता है, चेतावनी के साथ कि संसाधन गहन गहरी अनुक्रमण आनुवंशिक मानचित्रण के लिए जीनोमिक कवरेज सुनिश्चित करने की जरूरत है. अनुक्रमण लागत ड्रॉप के रूप में, इस दृष्टिकोण यूकैरियोट में भविष्य के उपयोग के लिए महान वादा रखती है।

Introduction

क्षेत्र की सुबह के बाद से, यह आनुवंशिकी में एक प्रमुख लक्ष्य जंगली व्यक्तियों में भिन्नता के मशीनी आधार को समझने के लिए किया गया है. जैसा कि हम ब्याज की एक विशेषता अंतर्निहित लोसी नक्शा, आकस्मिक जीन निदान और दवाओं के लिए लक्ष्य के रूप में तत्काल उपयोग की जा सकती है, और विकास के सिद्धांतों पर प्रकाश डाला जा सकता है. इस छोर की ओर उद्योग मानक लिंकेज या एसोसिएशन1के माध्यम से जनसंख्या भर में जीनोटाइप और फीनोटाइप के बीच संबंध के लिए परीक्षण करने के लिए है . इन दृष्टिकोणों के रूप में शक्तिशाली हैं, वे एक महत्वपूर्ण सीमा है-वे intereriner व्यक्तियों के बीच पार से पुनः संयोजक संतान के बड़े पैनलों पर भरोसा करते हैं. वे प्रजातियों है कि पहली जगह में संतान बनाने के लिए दोस्त नहीं कर सकते हैं के अध्ययन में कोई फायदा नहीं कर रहे हैं. इस प्रकार, इस क्षेत्र में प्रजनन पृथक प्रजातियों2के बीच विशेष अंतर के निष्पक्ष विच्छेदन के लिए बहुत कम क्षमता है।

इस कार्य में हम प्रजातियों के बीच विशेषता भिन्नता के आनुवंशिक आधार के जीनोम पैमाने पर सर्वेक्षण के लिए एक नई विधि, आरएच-सेक3की तकनीकी underpinnings रिपोर्ट. यह दृष्टिकोण व्युत्क्रम हेमीजिगोटे परीक्षण 4,5का एक विशाल समानांतर संस्करण है , जिसे पहली बार एक में दो आनुवंशिक रूप से भिन्न पृष्ठभूमि के बीच एलिलिक अंतरों के फेनोलिक प्रभावों का मूल्यांकन करने के तरीके के रूप में कल्पना की गई थी। विशिष् ट लोकपथ (चित्र 1क) इस योजना में, दो अलग-अलग व्यक्तियों को पहले एक संकर बनाने के लिए तैयार किया जाता है, जिनमें से आधे का जीनोम प्रत्येक संबंधित माता-पिता से आता है। इस पृष्ठभूमि में, कई उपभेदों उत्पन्न कर रहे हैं, प्रत्येक एक बाधित या टिड्डी के प्रत्येक माता पिता के allele के नष्ट कर दिया प्रतिलिपि युक्त. इन उपभेदों hemizygous के बाद से वे ब्याज की लोकपथ पर छोड़कर जीनोम में हर जगह द्विगुणित रहते हैं, जहां वे अगुणित माना जाता है, और पारस्परिक के रूप में संदर्भित कर रहे हैं के बाद से प्रत्येक केवल एक ही माता पिता के एलीले की कमी है, इसके शेष allele से व्युत्पन्न के साथ अन्य माता पिता. इन पारस्परिक hemizygote उपभेदों के phenotypes की तुलना करके, एक हेरफेर टिड्डी पर डीएनए अनुक्रम वेरिएंट ब्याज की विशेषता के लिए योगदान है कि क्या निष्कर्ष निकाल सकते हैं, क्योंकि टिड्डी पर वेरिएंट पारस्परिक के बीच ही आनुवंशिक अंतर कर रहे हैं हेमीजोट उपभेदों. इस तरह, यह एक अच्छी तरह से नियंत्रित प्रयोगात्मक सेटअप में उन दोनों के बीच एक phenotypic अंतर करने के लिए प्रजातियों के बीच आनुवंशिक अंतर जोड़ने के लिए संभव है. आज तक इस परीक्षा के आवेदन एक उम्मीदवार-जीन ढांचे में रहे हैं-अर्थात, ऐसे मामले जिनमें परिकल्पना पहले से ही हाथ में है कि उम्मीदवार टिड्डी में प्राकृतिक भिन्नता एक विशेषता को प्रभावित कर सकती है।

इसके बाद, हम एक मॉडल प्रणाली के रूप में खमीर का उपयोग कर, एक जीनोम पैमाने पर पारस्परिक hemizygosity स्क्रीन के लिए प्रोटोकॉल बाहर रखना. हमारी विधि प्रजातियों के बीच व्यवहार्य, बाँझ F1 संकर पैदा करने और उन्हें transposon mutagenesis के अधीन द्वारा, hemizygote उत्परिवर्ती के एक जीनोमिक पूरक बनाता है. हम hemizygotes पूल, अनुक्रमण आधारित परख में उनके phenotypes उपाय, और एक दिया जीन के दो माता पिता के alleles असर पूल के क्लोन के बीच आवृत्ति में अंतर के लिए परीक्षण. परिणाम loci की एक सूची है जिस पर प्रजातियों के बीच वेरिएंट ब्याज की विशेषता को प्रभावित करते हैं. हम आरएच-सेक कार्यप्रवाह को लागू करने के लिए दो नवोदित खमीर प्रजातियों के बीच थर्मोफ्लोरेंसी मतभेदों के आनुवंशिक आधार को स्पष्ट करने के लिए, Saccharomyces सेरेविसियाई और एसविरोधाभास, जो 5 लाख साल पहले diverged6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. परिवर्तन के लिए पिग्गीबैकयुक्त प्लाज्मिड की तैयारी

  1. एकल कालोनियों के लिए बाहर स्ट्रीक ई. कोलाई तनाव एक LB + carbenicillin आगर प्लेट पर plasmid pJR487 शरण. 37 डिग्री सेल्सियस पर 1 रात के लिए इनक्यूबेट या जब तक एकल कालोनियों दिखाई देते हैं।
    नोट: कैसे प्लाज्मिड pJR487 क्लोन किया गया था का एक विवरण हमारे पिछले काम3में पाया जा सकता है.
  2. एक 2 एल ग्लास फ्लास्क में pJR487 युक्त ई. कोलाई की एक कॉलोनी के साथ 100 g/एमएल पर एलबी + carbenicillin के 1 एल टीका। संतृप्त तक 200 आरपीएम पर मिलाते हुए के साथ 37 डिग्री सेल्सियस पर रात भर बढ़ें (ओडी600 $ 1.0)।
  3. निर्माता के प्रकाशित प्रोटोकॉल में निर्देश के रूप में एक बड़े पैमाने पर प्लाज्मिड प्रस्तुत किट का उपयोग संस्कृति से प्लाज्मिड डीएनए शुद्ध (विवरण के लिए सामग्री की तालिका देखें). 10 मिनट के ऊष्मायन के बाद डीएनए को 5 एमएल एल्यूशन बफर के साथ 37 डिग्री सेल्सियस तक गर्म किया गया।
  4. मात्रा और एक स्पेक्ट्रोफोटोमीटर के साथ प्लाज्मिड डीएनए की गुणवत्ता को मापने (विवरण के लिए सामग्री की तालिका देखें).
  5. दोहराएँ कदम 1.2 - 1.4 जब तक कम से कम की कुल 11 मिलीग्राम प्लाज्मिड डीएनए एक A260पर: कम से कम 1.8 के एक280 अनुपात अलग कर रहे हैं. यह दक्षता के आधार पर, कुछ preps लग सकता है.
  6. एक एकल ट्यूब में एक साथ सभी प्लाज्मिड preps मिक्स और elution बफर या पानी के साथ 20 एमएल तक कुल मात्रा लाने के लिए। एक स्पेक्ट्रोफोटोमीटर के साथ फिर से अंतिम मात्रा और गुणवत्ता को मापने. इस अंतिम 20 एमएल आयतन में प्लाज़्मिड की सांद्रता कम से कम 538 एनजी/जेडएल होनी चाहिए। यदि सांद्रता 538 एनजी/जेडएल से अधिक है, तो प्लाज्मिड को इल्यूशन बफर या जल के साथ 538 एनजी/जेडएल तक पतला कर दें। Plasmid उपयोग तक कुछ हफ्तों तक 4 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।

2. अलक्षित जीनोम चौड़ा पारस्परिक hemizygotes का एक पूल बनाना

  1. रूपांतरण के लिए संकर खमीर कोशिकाओं की तैयारी
    1. एक -80 डिग्री सेल्सियस फ्रीजर स्टॉक तनाव से एक YPD agar प्लेट पर एकल कालोनियों के लिए JR507 बाहर स्ट्रीक. 2 दिनों के लिए या कालोनियों दिखाई देते हैं जब तक 26 डिग्री सेल्सियस पर इनक्यूबेट।
      नोट: JR507 एक संकर तनाव एस cerevisiae DBVPG1373 और एस विरोधाभास के अगुणित बीजाणुओं की एकल कोशिका संभोग के माध्यम से किया जाता है (एक tetrad-विच्छेदन माइक्रोस्कोप का उपयोग करके)3.
    2. जेआर 507 की एक कॉलोनी के साथ 250 एमएल ग्लास फ्लास्क में तरल YPD के 100 एमएल टीका और 28 डिग्री सेल्सियस, 24 घंटे के लिए 200 आरपीएम, या स्थिर चरण तक पहुंच ने हिला।
    3. अगले दिन, रात भर संस्कृति के 600 एनएम (ओडी600)पर ऑप्टिकल घनत्व को मापने। 0.2 के एक OD600 और 500 एमएल की मात्रा के लिए एक नया 1 एल ग्लास फ्लास्क में ताजा तरल YPD के साथ रात भर संस्कृति के कुछ वापस diluting द्वारा एक नई संस्कृति बनाएँ.
      नोट: एक वापस-dilution के उदाहरण गणना अगर रात भर संस्कृति 5.0 के एक OD600 है, जहां सी ऑप्टिकल घनत्व है और वी मात्रा है:
      Equation 1
      इस प्रकार, संतृप्त रात भर संस्कृति के 20 एमएल तरल YPD के 480 एमएल करने के लिए 0.2 के एक OD600 पर संस्कृति की कुल 500 एमएल बनाने के लिए जोड़ा जाएगा.
    4. चरण 2.1.3 तीन बार दोहराएँ चार 1 एल ग्लास फ्लास्क में 0.2 के एक OD600 में चार 500 एमएल संस्कृतियों की कुल बनाने के लिए, सभी चार नई संस्कृतियों के लिए एक ही रात भर संस्कृति का उपयोग कर. उन सभी को 28 डिग्री सेल्सियस पर 6 घंटे (2-3 पीढ़ियों) 200 आरपीएम पर मिलाते हुए इनक्यूबेट करें।
    5. एक 1 L संस्कृति बनाने के लिए 500 एमएल संस्कृतियों में से दो का मिश्रण. शेष दो 500 एमएल संस्कृतियों का मिश्रण एक और 1 एल संस्कृति बनाने के लिए. इस बिंदु पर, वहाँ दो 1 एल संस्कृतियों रहे हैं. इन 1 L संस्कृतियों में से प्रत्येक निम्न चरणों में pJR487 के साथ परिवर्तन के अधीन हो जाएगा.
  2. संकर खमीर कोशिकाओं में pJR487 का परिवर्तन
    1. 40 ट्यूबों की कुल के लिए 20 प्लास्टिक शंकु ट्यूबों में 20 एमएल aliuots में 1 एल संस्कृतियों में से प्रत्येक को विभाजित करें। 20 ट्यूबों को अलग रखें और एक समय में 20 ट्यूबों पर निम्नलिखित चरणों का पालन करें।
    2. खमीर कोशिकाओं को गोली के लिए 1,000 x ग्राम पर 3 मिनट के लिए बीस ट्यूबों में से प्रत्येक सेंट्रीफ्यूज। महादलित को त्याग दें।
    3. भंवर द्वारा बाँझ एच2ओ के 25 एमएल के साथ प्रत्येक गोली को पुन: निलंबित करें। 1,000 x ग्रामपर 3 मिनट के लिए सेंट्रीफ्यूज | महादलित को त्याग दें।
    4. भंवर द्वारा 1x TE, 0.1 M LiOAc बफर के 5 एमएल के साथ प्रत्येक गोली को पुन: निलंबित करें। 1,000 x ग्रामपर 3 मिनट के लिए सेंट्रीफ्यूज | महादलित को त्याग दें।
    5. चरण 2.2.4 दोहराएँ. जबकि कोशिकाओं centrifuging रहे हैं, 39.52% polyethylene ग्लाइकोल, 0.12 एम LiOAc और 1.2x Tris-EDTA बफर (12 m Tris-HCl और 1.2 एमएम EDTA) के समाधान के कम से कम 120 एमएल तैयार करते हैं। बर्फ पर स्टोर.
    6. परिवर्तन के लिए प्लाज्मिड डीएनए तैयार करने के लिए, पहले सामन शुक्राणु डीएनए के 4 एमएल को 100 डिग्री सेल्सियस पर 5 मिनट के लिए उबालें और तुरंत इसे बर्फ पर 5 मिनट के लिए ठंडा करें। फिर, 24 एमएल की कुल मात्रा के लिए ठंडा सामन शुक्राणु डीएनए के 4 एमएल के साथ 538 एनजी/जेडएल की सांद्रता पर pJR487 (खंड 1 में प्राप्त) के 20 एमएल मिश्रण। उपयोग होने तक बर्फ पर रखें।
    7. प्रत्येक सेल गोली के शीर्ष पर सामन शुक्राणु डीएनए के साथ मिश्रित प्लाज्मिड डीएनए के 600 डिग्री एल जोड़ें। अभी तक नहीं resuspend.
    8. प्रत्येक गोली के लिए चरण 2.2.5 में किए गए पेग-LiOAc-TE समाधान के 3 एमएल जोड़ें। ऊपर और नीचे और भंवर पाइपिंग द्वारा गोली को पुन: निलंबित करें।
    9. कमरे के तापमान पर 10 मिनट के लिए प्रत्येक ट्यूब इनक्यूबेट करें।
    10. गर्मी सदमे प्रत्येक ट्यूब के लिए 26 मिनट के लिए एक पानी के स्नान में सेट करने के लिए 39 डिग्री सेल्सियस.
      नोट: हर कुछ मिनट, ट्यूब के तल पर बसने से कोशिकाओं को रोकने के लिए प्रत्येक ट्यूब उलटा.
    11. 1,000 x ग्रामपर 3 मिनट के लिए प्रत्येक ट्यूब सेंट्रीफ्यूज . सुपरनेंट को त्यागें और प्रत्येक गोली को 10 एमएल YPD में भंवर द्वारा फिर से लागू करें। सभी बीस ट्यूबों को एक नए कांच के फ्लास्क में मिलाएं। कक्षों की कुल मात्रा $200 एमएल होना चाहिए।
    12. एक नया 1 एल ग्लास फ्लास्क के लिए कोशिकाओं के 66.6 एमएल स्थानांतरण और तरल YPD के साथ 500 एमएल की मात्रा तक ले आओ। रूपांतरणित कोशिकाओं के पूरे 200 एमएल का उपयोग करने के लिए दो बार दोहराएँ। प्रत्येक नए500 एमएल संस्कृति के OD 600 उपाय (0.35-4) के एक OD600 की उम्मीद है.
    13. 200 आरपीएम पर ठीक होने के लिए 2 8 डिग्री सेल्सियस पर सभी तीन फ्लास्क हिलाएं।
    14. तीन फ्लास्कमेंस में से प्रत्येक के लिए 300 मिलीग्राम/एमएल G418 का 0.5 एमएल जोड़ें, 300 डिग्री/एमएल जी418 की अंतिम सांद्रता में जोड़ें और 28 डिग्री सेल्सियस, 200 आरपीएम पर हिला करने के लिए वापस डाल दें।
      नोट: इस चरण से पहले, रूपांतरित हाइब्रिड कोशिकाओं परिवर्तन से ठीक हो गया है। G418 के अलावा पर, प्लाज्मिड pJR487 की उपस्थिति के लिए चुना गया है. किसी भी कोशिकाओं है कि परिवर्तन के दौरान प्लाज्मिड नहीं लिया मरने के लिए शुरू हो जाएगा.
    15. 2-2-2 - 2ण्2ण्14 कोशिकाओं के शेष 20 शंकु-ट्यूबों के साथ दोहराएँ। इस बिंदु पर छह 1 एल ग्लास फ्लास्क होना चाहिए, प्रत्येक G418 के साथ कोशिकाओं के 500 एमएल के साथ जोड़ा.
    16. 28 डिग्री सेल्सियस पर कोशिकाओं के सभी छह फ्लास्क इनक्यूबेट करें, 200 आरपीएम पर मिलाते हुए, लगभग 2 दिनों के लिए या प्रत्येक फ्लास्क में $2.3 के OD600 तक पहुंच ने नहीं किया। एक ही संस्कृति बनाने के लिए सभी छह फ्लास्क को एक साथ मिलाएं।
      नोट: हालांकि इस संस्कृति में कोशिकाओं के सभी downstream चरणों में इस्तेमाल नहीं किया जाएगा, इस तरह के बड़े संस्करणों का उपयोग करने का लक्ष्य के रूप में संभव के रूप में कई अद्वितीय परिवर्तन की घटनाओं बनाने के लिए और उन सब पूलिंग द्वारा एक एकल परिवर्तन भर में किसी भी पूर्वाग्रहों को सामान्यीकृत करने के लिए किया गया है साथ-साथ.
    17. 2.2.16 में बनाई गई संस्कृति का उपयोग करने के लिए YPD के 500 एमएल के साथ दो नए 1 L फ्लास्क टीका + G418 (300 g/ वहाँ बचे हुए संस्कृति है कि खारिज किया जा सकता है.
    18. 28 डिग्री सेल्सियस पर दोनों 1 एल फ्लास्क को रात भर में, 200 आरपीएम पर मिलाते हुए के साथ, जब तक प्रत्येक $2.2 ($3.5 पीढ़ियों) के एक OD600 तक पहुंचता है। एक ही संस्कृति में दोनों संस्कृतियों का मिश्रण है और संयुक्त संस्कृति के OD600 फिर से उपाय.
      नोट: इस बिंदु पर, संस्कृति लगभग पूरी तरह से कोशिकाओं के शामिल किया जाना चाहिए plasmid pJR487 शरण. कोशिकाओं की आबादी के हिस्से में, पिग्गीबैक ट्रांसपोसन को प्लाज्मिड से जीनोम में स्थानांतरित कर दिया गया होगा। हालांकि, transposase की निरंतर अभिव्यक्ति एक चयन के दौरान स्थानांतरण के लिए नेतृत्व कर सकते हैं, जो जीनोटाइप और phenotype के बीच संबंधअस्पष्ट होगा. अगले कई चरणों का लक्ष्य प्लाज्मिड की उपस्थिति के खिलाफ एक counterselection प्रदर्शन करने के लिए है, यह सुनिश्चित करने के लिए transposase की कोई और अभिव्यक्ति है. परिणामस्वरूप पूल के साथ या जीनोम में एकीकृत transposon बिना कोशिकाओं का एक मिश्रण है, लेकिन केवल transposon युक्त कोशिकाओं बाद मानचित्रण चरणों के दौरान पता चला रहे हैं. परिवर्तन में समय जिसके दौरान transposase व्यक्त किया जाता है, प्लाज्मिड एन्कोडिंग खो जाने से पहले, यह संभावना है कि mutagenesis के बाद दिया क्लोन एक से अधिक ट्रांसपोसन प्रविष्टि बंदरगाह नियंत्रित कर सकते हैं. इन की आवृत्ति, जो एक समय में किसी भी एक जीन के विश्लेषण में "माध्यमिक" उत्परिवर्तनों के रूप में प्रकट होती है, mutagenesis के बाद कालोनियों की एक परिभाषित संख्या arraying द्वारा अनुमान लगाया जा सकता है, तो उनके डीएनए और अनुक्रम के संयोजन स्वतंत्र प्रविष्टि की संख्या की पुष्टि पूल में पदों.
    19. इस संस्कृति का 25 एमएल 1,000 x gपर 3 मिनट के लिए सेंट्रीफ्यूज . 25 एमएल में हैं जो कक्षों की कुल OD600 इकाइयों की संख्या की गणना (नीचे उदाहरण परिकलन देखें). सुपरनेंट को त्याग दें और पर्याप्त एच2ओ में फिर से निलंबित करें ताकि भ्रमिल द्वारा 1.85 ओडी600/
      नोट: पानी में कोशिकाओं के resuspension के लिए उदाहरण गणना अगर संयुक्त संस्कृति के OD600 2.2 था:
      Equation 2
      इसलिए, सेल संस्कृति के 25 एमएल कताई और supernatant discarding के बाद, कोशिकाओंऔरपानी की कुल मात्रा को लाने के लिए कोशिकाओं और पानी की कुल मात्रा को लाने के लिए पर्याप्त एच 2 O जोड़ें $29.7 एमएल (क्योंकि सेल गोली भी एक मात्रा होगी, कम से कम 29.7 एमएल एच2O के जोड़ें).
    20. कांच मोती का उपयोग करना, प्लेट 1 एमएल पानी में 5-FOA के साथ 12 बड़े वर्ग पूरा सिंथेटिक agar प्लेटों में से प्रत्येक पर पानी में resuspended कोशिकाओं की. प्रत्येक प्लेट को 1-2 दिनों के लिए या प्लेट पर लॉन बनने तक 28 डिग्री सेल्सियस पर इनक्यूबेट करें।
    21. छोटे बाँझ sueegees का उपयोग करना, 6 प्लेटों में से प्रत्येक के बंद कोशिकाओं को परिमार्जन और बाँझ पानी के 35 एमएल के साथ एक ट्यूब में. कोशिकाओं और पानी की दो ट्यूबों की कुल के लिए अन्य 6 प्लेटों के साथ दोहराएँ. एक एकल ट्यूब में सभी सेल निलंबन का मिश्रण. इस निलंबन के OD600 उपाय, एक खाली के रूप में पानी का उपयोग कर. पानी के साथ 44.4 OD600इकाइयों / एमएल करने के लिए कोशिकाओं की OD600 / एमएल एकाग्रता लाओ। हमारे अनुभव में, स्थानांतरण दक्षता (KAN + कोशिकाओं है कि URA हैं का अनुपात-) औसत 50% पर है.
    22. स्टोर करने के लिए कोशिकाओं के -80 डिग्री सेल्सियस फ्रीजर स्टॉक की संख्या निर्धारित करें। प्रत्येक एलिकोट का उपयोग भविष्य में एक ही प्रयोग के लिए किया जा सकता है।
      नोट: यह देखते हुए कि पूल की पीढ़ी लेने में कितना समय लगता है, आकस्मिक दुरुपयोग के मामले में या प्रतिकृति प्रयोगों के प्रदर्शन के लिए कई शीशियों की दुकान। 20-30 स्टॉक एक उचित संख्या में हैं.
    23. प्रत्येक फ्रीजर स्टॉक 10% DMSO के 1 एमएल में कोशिकाओं के 40 OD 600 इकाइयों शामिल होंगे. DMSO के 100 डिग्री सेल्सियस में कोशिकाओं के 900 डिग्री एल जोड़ें. बनाया फ्रीजर स्टॉक की कुल संख्या के लिए दोहराएँ. भविष्य में उपयोग के लिए -80 डिग्री सेल्सियस पर प्रत्येक स्टोर।

3. एक पूल ्ड प्रारूप में पारस्परिक हेमीजिगोट्स का चयन

  1. -80 डिग्री सेल्सियस फ्रीजर से कमरे के तापमान पर खंड 2 से पूल्ड पारस्परिक हेमीजिजोट्स का एक एकल एलिकोट।
    नोट: एक बार यह thaws कमरे के तापमान पर लंबे समय के लिए alicot बैठने मत देना, इसे तुरंत उपयोग करें।
  2. 250 एमएल ग्लास फ्लास्क में 150 एमएल तरल YPD टीका करने के लिए पूरे 1 एमएल ऐलिकोट का उपयोग करें। इस संस्कृति के OD600 उपाय, और फिर 28 डिग्री सेल्सियस पर इनक्यूबेट, 200 आरपीएम पर मिलाते हुए, $ 7 घंटे के लिए, या जब तक संस्कृति 2-3 जनसंख्या दोहरीकरण के माध्यम से चला गया है. इस बिंदु पर, संस्कृति के चयन के दौर से गुजर संस्कृतियों टीका करने के लिए इस्तेमाल किया जा करने के लिए तैयार है.
    नोट: उदाहरण गणना: यदि मूल फ्लास्क के OD600 उपाय 0.25, संस्कृति incubate जब तक यह कम से कम 1.0 के एक OD600 तक पहुँच ता. यदि कोई नमूना अंक "समय शून्य" (टी-0) में वांछित हैं, चयन से पहले हेमीजोगोटे आबादी की जांच करने के लिए एक तरीका के रूप में, सेल छर्रों अब 3 मिनट के लिए 1,000 x ग्राम पर संस्कृति प्रति गोली के 5-10 एमएल centrifuging द्वारा लिया जा सकता है, supernatant discarding और -80 डिग्री सेल्सियस पर ठंड।
  3. दोनों उच्च तापमान (39 डिग्री सेल्सियस) और अनुमत तापमान (28 डिग्री सेल्सियस) पर, एक उपयुक्त प्रतिकृति योजना में चयन के लिए संस्कृतियों टीका करने के लिए बड़े hemizygote पूल का प्रयोग करें। कम से कम, छह चयन संस्कृतियों की कुल के लिए, प्रत्येक तापमान पर तीन जैविक प्रतिकृति चयन संस्कृतियों की स्थापना की।
    1. तरल YPD के साथ एक 2 एल ग्लास फ्लास्क में 500 एमएल कुल के साथ प्रत्येक चयन संस्कृति बनाएँ और 0.02 के एक OD600 को टीका. या तो 28 डिग्री सेल्सियस या 39 डिग्री सेल्सियस पर 100 आरपीएम पर प्रत्येक चयन संस्कृति हिला जब तक 6-7 जनसंख्या दोहरीकरण हुआ है (एक OD600 के लिए संगत $1.28-2.56). सभी चयन संस्कृतियों के अंतिम OD600 संभव के रूप में बारीकी से मैच की कोशिश करो.
      नोट: 28 डिग्री सेल्सियस पर चयन संस्कृतियों 39 डिग्री सेल्सियस पर चयन संस्कृतियों की तुलना में तेजी से विकसित होगा। नतीजतन, 39 डिग्री सेल्सियस पर चयन संस्कृतियों इनक्यूबेटर में समय की एक लंबी अवधि खर्च करेगा। प्रत्येक फ्लास्क के साथ निम्न चरणों के साथ आगे बढ़ें क्योंकि यह तैयार हो जाता है, इनक्यूबेटर में बिताए गए घंटों की कुल संख्या की परवाह किए बिना। हमारे अनुभव में, 28 डिग्री सेल्सियस या 39 डिग्री सेल्सियस पर संस्कृतियों $ 2.0 के एक OD तक पहुँचने के लिए क्रमशः $ 12 या $ 18 घंटे लग गए। लंबे चयन छोटे फिटनेस प्रभाव बढ़ाना का लाभ हो सकता है, लेकिन यह भी पैदा करने के लिए de नोवो पृष्ठभूमि उत्परिवर्तनों की अनुमति है, जो किसी भी एक जीन में transposon उत्परिवर्ती भर में फिटनेस के अंतिम वितरण में शोर परिचय होगा / इस प्रकार आरएच-सेक प्रयोग में चयन समय को सीमित करना महत्वपूर्ण है।
  4. प्रत्येक चयन संस्कृति से हार्वेस्ट सेल छर्रों. पुस्तकालय की तैयारी और अनुक्रमण के लिए तकनीकी प्रतिकृति के रूप में प्रत्येक चयन संस्कृति से इस खंड के कम से कम चार छोले के लिए 1,000 x ग्राम पर कोशिकाओं और सेंट्रीफ्यूज की 7 ओड600 इकाइयों को प्राप्त करने के लिए आवश्यक मात्रा की गणना करें (खंड 4 और 5 देखें , नीचे). सुपरनेटेंट को त्यागदें और -80 डिग्री सेल्सियस पर स्टोर करें।
    नोट: उदाहरण यदि एक चयन फ्लास्क 2.0 के अंतिम OD600 है:
    Equation 3

4. Tn-सेक पुस्तकालय निर्माण और Illumina अनुक्रमण transposon उत्परिवर्ती hemizygotes की बहुतायत निर्धारित करने के लिए

  1. बर्फ पर Thaw अनुभाग 3 से प्रत्येक सेल गोली कि अनुक्रम होने जा रहा है.
  2. निर्माता के निर्देशों का पालन एक खमीर gDNA शुद्धि किट का उपयोग कर प्रत्येक सेल गोली से कुल जीनोमिक डीएनए (gDNA) अलग करें। 65 डिग्री सेल्सियस तक गर्म एल्यूशन बफर के 50 डिग्री एल में डीएनए को पुन: निलंबित करें।
  3. एक फ्लोरीमीटर का उपयोग कर प्रत्येक गोली से gDNA की मात्रा की मात्रा की मात्रा की मात्रा. निम्न कार्यविधि का उपयोग करते हुए Tn-seQ के लिए एक अगली पीढ़ी अनुक्रमण (NGS) लायब्रेरी बनाने के लिए प्रत्येक सेल गोली के लिए आवश्यक gDNA की न्यूनतम कुल मात्रा 1 g है।
    नोट: एक पुस्तकालय बनाने के लिए gDNA के कम से कम 1 डिग्री ग्राम का उपयोग किया जा सकता है, लेकिन अंतिम मात्रा और पुस्तकालय की गुणवत्ता भुगतना होगा।
  4. Tn-सेक पुस्तकालयों7बनाने के लिए एक स्थापित प्रोटोकॉल का पालन करें. इस प्रोटोकॉल के लिए अनन्य है जो निम्न प्रासंगिक जानकारी नोट करें:
    1. gDNA कतरनी, अंत मरम्मत और एडाप्टर लिगेशन के बाद, पीसीआर के माध्यम से transposon युक्त gDNA बढ़ाना। उस PCR के लिए, निम्न आगे और रिवर्स प्राइमर का उपयोग करें, जो क्रमशः पिग्गीबैक ट्रांसपोसन और एनजीएस एडाप्टर के लिए विशिष्ट हैं:
      फॉरवर्ड (N - यादृच्छिक न्यूक्लिओटाइड)
      5' ATGATACCGACCGAGATCTACCTCTACTACACGACG
      सीटीसीटीसीसीटीसीटीएनएनएनएनजीकाएटटीकाAGAATGCGTCAAT 3'
      उत्क्रम (न का खिंचाव बहुसंकेतन के लिए प्रयुक्त एक अद्वितीय 6-बीपी सूचकांक का प्रतिनिधित्व करता है। सूचकांकों के बारे में अधिक जानकारी के लिए नीचे देखें)
      5' कैगकागागकागगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगगग
      ACGTGTGCTCCTCTCT 3'
    2. मपकरने जीनोमिक अनुक्रम को शामिल करने के लिए बहुत कम होगा कि अंतिम पुस्तकालय में क्लोन टुकड़े के अनुपात को कम करने के लिए आकार-चयनात्मक मोती के साथ शामिल सफाई चरणों का उपयोग करें।
      नोट: चयन संस्कृतियों के लिए अब तक न्यूनतम प्रतिकृति आवश्यकताओं का पालन करने के बाद, अनुक्रमण के लिए 24 अलग-अलग gDNA नमूने होंगे। अनुक्रमण के लिए वर्तमान लागत को देखते हुए, यह संभावना नहीं है कि प्रत्येक नमूना अपने दम पर चलाया जाएगा. एक ही लेन पर नमूने गठबंधन करने के लिए, कई रिवर्स प्राइमर, एक अद्वितीय 6-आधार जोड़ी सूचकांक के साथ प्रत्येक बनाएँ। भिन्न अनुक्रमित के साथ नमूने एक ही अनुक्रमण लेन में जोड़ा जा सकता है और computationally बाद में अलग.
  5. अनुक्रम एकल अंत 150 बीपी आठ गलियों में NGS प्रौद्योगिकियों का उपयोग कर प्रत्येक पुस्तकालय से पढ़ता है.
    नोट: अनुक्रमण की मात्रा की आवश्यकता है पिछले चरण में तैयार पुस्तकालयों की गुणवत्ता पर भारी निर्भर करता है (यानी वास्तव में ट्रांसपोसन डीएनए युक्त पुस्तकालय में डीएनए के अनुपात, पारस्परिक hemizygotes से आने वाले डीएनए का प्रतिनिधित्व). इसमें योगदान देने वाले दो मुख्य कारक हैं। सबसे पहले, के बाद से एक एकीकृत transposon के बिना कोशिकाओं पूल निर्माण के दौरान के खिलाफ counterselected नहीं हैं, प्रत्येक संस्कृति के साथ और transposon के बिना कोशिकाओं का एक मिश्रण हो जाएगा. दूसरे, यहां तक कि transposon युक्त पारस्परिक hemizygotes के जीनोम के भीतर, जीनोम के अधिकांश अनुक्रम युक्त transposon नहीं है, और इस gDNA unavoidably पुस्तकालय की तैयारी का हिस्सा होगा. ट्रांसपोसन युक्त डीएनए के अंतिम पीसीआर प्रवर्धन का लक्ष्य पृष्ठभूमि gDNA के इन दो स्रोतों के लिए transposon युक्त डीएनए के अनुपात में वृद्धि करने के लिए है। अधिक कुशल इस प्रवर्धन है, पढ़ता के उच्च अनुपात बहाव विश्लेषण में इस्तेमाल किया जा करने में सक्षम हो जाएगा. कम गुणवत्ता पुस्तकालयों रहे हैं, और अधिक अनुक्रमण किया जा करने की आवश्यकता होगी, पढ़ता की एक बढ़ती अनुपात ट्रांसपोसन डीएनए शामिल नहीं होगा और उपयोगी नहीं होगा के बाद से। उपरोक्त बाधाओं को देखते हुए, अनुक्रमण के आठ लेन एक उचित डिग्री के लिए पारस्परिक hemizygote बहुतायत पर नज़र रखने में सक्षम थे. अधिक अनुक्रमण एक गहरी विश्लेषण की अनुमति होगी.

5. ट्रांसपोसन सम्मिलन और आरएच-सेक विश्लेषण के स्थानों मानचित्रण

नोट: निम्न डेटा विश्लेषण कस्टम पायथन स्क्रिप्ट के साथ पूरा किया गया था (https://github.com/weiss19/rh-seq पर ऑनलाइन पाया), लेकिन अन्य स्क्रिप्टिंग भाषाओं का उपयोग कर फिर से हो सकता है. नीचे, इस प्रक्रिया में प्रमुख चरणों को रेखांकित कर रहे हैं. यह उन्हें संयोजित करने के लिए नोट किया गया है जब तक कि प्रत्येक व्यक्ति प्रतिकृति पठन फ़ाइल पर निम्न चरणों का पालन करें।

  1. एडाप्टर दृश्यों को पढ़ता बंद ट्रिम करें और प्रत्येक प्रतिकृति के अनुक्रम के अनुसार पढ़ता अलग करें।
  2. ट्रांसपोसन-जीनोम जंक्शनों वाले रीड का पता लगाएं। यह पूरा करने के लिए, transposon के पिछले 20 आधार जोड़े के लिए प्रत्येक पढ़ने के भीतर खोज, CAGACTATCtTCTAGGGTTAA. इस अनुक्रम वाले सभी पढ़ता छोड़ें.
    नोट: हमारे अनुभव में, transposon के अंत करने के लिए मैपिंग पढ़ता का अनुपात 83-95% है।
  3. शेष ट्रिम, transposon युक्त transposon के 3' अंत के केवल अनुक्रम बहाव शामिल करने के लिए पढ़ता है. खमीर जीनोम करने के लिए इस अनुक्रम मानचित्रण द्वारा, प्रत्येक पढ़ने के लिए transposon प्रविष्टि के जीनोमिक संदर्भ निर्धारित (नीचे कदम 5.4).
  4. BlAT या एक समकक्ष मानचित्रण उपकरण का उपयोग करने के लिए S. cerevisiae DBVPG1373 x S. paradoxus $1 संकर जीनोम (स्क्रिप्ट का नाम: map[and]pool]BLAT.py करने के लिए transposon के अनुक्रम नीचे मैप करने के लिए।
    1. किसी भी पढ़ता है जिसके लिए वहाँ कम से कम 50 उपयोगी अनुक्रम के आधार जोड़े हैं छोड़ दें 3' transposon के अंत के बहाव. लघु दृश्यों विशिष्ट नक्शा करने के लिए मुश्किल कर रहे हैं।
    2. BLAT का उपयोग कर रहे हैं, तो निम्न पैरामीटर का उपयोग करें: पहचान $ 95, टाइल आकार $ 12।
    3. एस cerevisiae S288c और एस विरोधाभास CBS432 के संदर्भ जीनोम के नवीनतम संस्करण concatenating द्वारा मानचित्रण के लिए उपयोग करने के लिए एक बुनियादी संकर जीनोम बनाएँ.
      नोट: संकर जीनोम भर में व्यक्तिगत जीन की जीनोमिक सीमाओं का वर्णन एक बुनियादी एनोटेशन फ़ाइल ऊपर सूचीबद्ध Github भंडार में पाया जा सकता है (फ़ाइल नाम: YS2 + CBS432 +plasmid]clean). केवल संकर जीनोम में एक ही स्थान के लिए जो नक्शा पढ़ता का उपयोग करें (यानी या तो एस cerevisiae या एस विरोधाभास के लिए अद्वितीय हैं). जीनोम भर में प्रविष्टि की घटनाओं की एक समान आवृत्ति की उम्मीद है; जीनोम में प्रविष्टि की स्थिति के वितरण की सूचना अन्यत्र3में दी गई है .
  5. प्रत्येक अद्वितीय ट्रांसपोसन प्रविष्टि स्थान के लिए मानचित्रण पढ़ता की कुल संख्या टैली, जो हम सभी एक एकल transposon प्रविष्टि उत्परिवर्ती क्लोन की कोशिकाओं से उत्पन्न infer. किसी एकल लायब्रेरी से ऐसे सभी मानों का योग उस लायब्रेरी के लिए मैप किए गए reads की कुल संख्या के रूप में संदर्भित किया जाता है।
  6. मामलों में जहां एक दूसरे के 3 आधार जोड़े के भीतर एकाधिक सम्मिलन मानचित्रण कर रहे हैं, उन सब को एक एकल प्रविष्टि बिंदु के लिए गठबंधन, उच्चतम पढ़ें गिनती के साथ एकल स्थान के लिए सभी पढ़ता बताए. यह मान, nसम्मिलितकरें, कोशिका गोली में उस प्रविष्टि क्लोन की बहुतायत का प्रतिनिधित्व करता है जिससे gDNA अनुक्रमित किया गया था. इस बिंदु पर, nडालनेकी सूची होगी, एक अद्वितीय मैप transposon प्रविष्टि के प्रत्येक बहुतायत, हर सेल गोली अनुक्रम के लिए एक सूची.
    नोट: PiggyBac transposon जीनोम, एक 4 आधार जोड़ी अनुक्रम में TTAA दृश्यों में सम्मिलित करता है. इस प्रकार, हम अनुमान है कि सम्मिलन एक दूसरे के 3 आधार जोड़े के भीतर मानचित्रण एक ही TTAA साइट से उत्पन्न हुआ होगा.
  7. चूंकि प्रत्येक अनुक्रमित लाइब्रेरी से आने वाले कुल पढ़ता की एक थोड़ी अलग संख्या होगी, इसलिए यदि उनकी तुलना की जानी है, तो nसम्मिलित मान ों को सभी फ़ाइलों में सामान्यीकृत करें. मैप की गई की कुल संख्या सारणीबद्ध करकेऐसा करें प्रत्येक व्यक्तिगत पुस्तकालय से पढ़ता है, n गोली, और सभी पुस्तकालयों में सभी nगोली के औसत ले, ;lt;nगोलीऔर gt; एकसम्मिलितकरने की गणनाकरने के लिए एकव्यक्तिगत पुस्तकालय के डेटा में प्रत्येक nसम्मिलित करें, दिए गए ट्रांसपोसन प्रविष्टि क्लोन की सामान्यीकृत बहुतायत।
    Equation 4
    वैकल्पिक रूप से, लायब्रेरी का आकार DESeQ28 (स्क्रिप्ट का नाम: total[reads]and]normalize.py) जैसे उपलब्ध उपकरणों का उपयोग कर के अनुमान लगाया जा सकता है।
  8. सभी पुस्तकालयों में मैप किए गए सभी सम्मिलनों के सेट को सारणीबद्ध करें. कुछ लायब्रेरीज़ में नहीं बल्कि अन्य में सम्मिलन के लिए, डाउनस्ट्रीम परिकलनों के लिए सम्मिलितकरें $ 1 सेट करें.
  9. एनोटेशन फ़ाइल के अनुसार जीन के भीतर आने वाले उन सम्मिलनों को ढूँढने के लिए पढ़ता है फ़िल्टर करें (स्क्रिप्ट नाम: remove[NC]and]plasmid]inserts.py).
  10. प्रत्येक अद्वितीय प्रविष्टि के लिए, प्रत्येक चयन के तकनीकी प्रतिकृति में औसत बहुतायत की गणना (या तो 28 डिग्री सेल्सियस या 39 डिग्री सेल्सियस पर प्रत्येक संस्कृति), [lt;aसम्मिलितकरें औरतकनीकी (स्क्रिप्ट का नाम: combine[tech]reps]V2.py).
  11. प्रत्येक अद्वितीय प्रविष्टि के लिए, प्रत्येक तापमान के जैविक प्रतिकृति भर में औसत बहुतायत की गणना, lt;aडालनेऔरकुल,सभी का मतलब लेने के द्वारा [lt;aसम्मिलितकरें] प्रत्येक तापमान परतकनीकी. एक ही समय में, प्रत्येक प्रविष्टि के लिए भिन्नता के गुणांक की गणना, CVडालने, कुल भर में [lt;aसम्मिलितकरें gt;तकनीकी (स्क्रिप्ट का नाम: combine]bio]reps.py).
    नोट: इस बिंदु पर, प्रत्येक तापमान के लिए, 28 डिग्री सेल्सियस और 39 डिग्री सेल्सियस, अद्वितीय ट्रांसपोसन प्रविष्टि, उनकी औसत बहुतायत और प्रत्येक के लिए जैविक प्रतिकृति के बीच भिन्नता के गुणांक की एक सूची है। हमारे प्रयोग के ये आंकड़े कहीं और रिपोर्ट किएगएहैं .
  12. उन है कि उन लोगों के लिए सभी सम्मिलन की सूची फ़िल्टर, या तो 28 डिग्री सेल्सियस या 39 डिग्री सेल्सियस पर, [lt;aसम्मिलितकरें और ]gt; 1.1, और CVसम्मिलितकरें,कुल $ 1.5 (स्क्रिप्ट नाम: filter]inserts.py).
  13. प्रत्येक अद्वितीय प्रविष्टि के लिए, लॉग 2 कीगणना([lt;aसम्मिलितकरें]कुल,28 डिग्री सेल्सियस / यह मान किसी दिए गए transposon सम्मिलन उत्परिवर्ती क्लोन (स्क्रिप्ट नाम: fitness-ratios.py) के "थर्मोसहिष्णुता" का प्रतिनिधित्व करता है।
  14. जीन द्वारा और एलीले द्वारा और सभी अद्वितीय सम्मिलनों को क्रमबद्ध करें (एस. सेरेविसे या एस. विरोधाभास), और प्रत्येक एलीमेंट में सम्मिलन की संख्या को सारणीबद्ध करें। जीन फ़िल्टर इतना है कि केवल जीन है कि प्रत्येक allele में कम से कम 5 प्रविष्टि है विश्लेषण कर रहे हैं (स्क्रिप्ट नाम: organize[and]filter]genes.py).
    नोट: प्रत्येक एलील भर में एकाधिक अद्वितीय प्रविष्टि है कि पारस्परिक hemizygote thermotolerance का एक अधिक सटीक उपाय के लिए अनुमति देते हैं. allele प्रति आवश्यक प्रविष्टि की संख्या को कम करना संभव है, लेकिन इस उपाय की सटीकता समझौता और अधिक जीन का परीक्षण किया जा करने के लिए अनुमति देकर कई परीक्षण बोझ में वृद्धि होगी. इसके अतिरिक्त, एलेल प्रति बहुत कम प्रविष्टि के साथ जीन को छानने में मदद मिलेगी किसी भी व्यक्ति hemizygote क्लोन एक माध्यमिक साइट उत्परिवर्तन है कि एक बहुत अलग phenotype प्रदान शरण के परीक्षण के परिणामों पर प्रभाव को कम.
  15. उपरोक्त फ़िल्टरिंग के बाद सेट डेटा में शेष प्रत्येक जीन के लिए, एस cerevisiae allele में सभी सम्मिलन के thermotolerances (लॉग2 अनुपात) की तुलना एस विरोधाभास allele में उन लोगों के लिए एक मान-Whitney यू परीक्षण का उपयोग कर. वैकल्पिक रूप से, एक प्रतिगमन मॉडल लागू किया जा सकता है, DESeQ28 से अनुकूलित (स्क्रिप्ट का नाम: mann-whitney.u.py).
  16. बेंजामिन-हॉचबर्ग विधि का उपयोग करके एकाधिक परीक्षण के लिए सही p-मान.
  17. महत्वपूर्ण p-मूल्यों के साथ जीन (कहते हैं, $ 0.01) जीन के लिए उम्मीदवार हैं दो प्रजातियों के बीच thermotolerance में मतभेद के लिए महत्वपूर्ण.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

हम एस cerevisiae और एस विरोधाभास एक बाँझ संकर है, जो हम transposon mutagenesis के अधीन फार्म के लिए mated. प्रत्येक म्यूटेजेनीकृत क्लोन एक हेमीजिगोट, एक द्विगुणित संकर था जिसमें एक जीन का एक एलील बाधित होता है (चित्र 1क, चित्र 2) । हमने एक-दूसरे के विरुद्ध 39 डिग्री सेल्सियस की वृद्धि से और एक नियंत्रण के रूप में एक पृथक प्रयोग में 28 डिग्री सेल्सियस (चित्र1ख) में, और हमने प्रत्येक संस्कृति से डीएनए को अलग किया। प्रत्येक hemizygote की फिटनेस की रिपोर्ट करने के लिए हम थोक अनुक्रमण के माध्यम से बहुतायत मात्रा निर्धारित, एक प्रोटोकॉल जिसमें डीएनए खंडित और एडाप्टर के लिए ligated था का उपयोग कर, transposon प्रविष्टि पदों के प्रवर्धन के बाद (चित्र 1C). यदि इस प्रवर्धन के लिए प्राइमर से अलग हैं, और कम से कम कुशल, प्रोटोकॉल में प्रदान की उन, पृष्ठभूमि पढ़ता अनुक्रमण डेटा में प्रबल होगा, कम प्रयोग करने योग्य पढ़ता है और फिटनेस के अनुमान की सटीकता eroding के लिए अग्रणी. इसी तरह की गुणवत्ता के मुद्दों अनुक्रमण पुस्तकालय की तैयारी में कम डीएनए इनपुट से परिणाम हो सकता है.

हमारे अनुक्रमण से हाथ में परिणाम के साथ, एक दिए गए जीन के लिए हम hemizygotes के दो वर्गों के बीच दो तापमान पर hemizygote बहुतायत की तुलना में: क्लोन जहां केवल एस cerevisiae allele जंगली प्रकार और कार्यात्मक था, और क्लोन केवल पर निर्भर एस विरोधाभास एलील (चित्र 1D)। इस स्तर पर विश्लेषण में, यदि प्रोटोकॉल की अभिकलनोत्तर प्रसंस्करण रणनीति का पालन नहीं किया जाता है और पूल में अपेक्षाकृत कम ट्रांसपोसन म्यूटेंट वाले जीन विश्लेषण में शामिल हैं, तो सांख्यिकीय शक्ति गिर जाएगी और कोई महत्वपूर्ण जीन कॉल परिणाम नहीं होगा। हमारे कार्यान्वयन में हमने आठ गृहव्यवस्था जीनों में मजबूत संकेत का पता लगाया (चित्र 3)। प्रत्येक स्थिति में, उच्च ताप पर संकर समझौता वृद्धि में एस सेरेविसीए एलाले में ट्रांसपोसन सम्मिलन (चित्र 3)। इन लोसी ने थर्माटॉरंसी विशेषता के निर्धारकों का प्रतिनिधित्व किया जो एस सेरेविसियाई को एस विरोधाभास से अलग करता है . अन्य स्थानों पर रिपोर्ट किए गए अलग-अलग प्रयोगों में, हमने वर्तमान प्रोटोकॉल3के दायरे से परे मानक ट्रांसजेनेसिस विधियों का उपयोग करके प्रत्येक साइट पर एलीलिक भिन्नता के प्रभाव को मान्य किया है।

Figure 1
चित्र 1. आरएच-सेक कार्यप्रवाह की योजना।
एस cerevisiae और एस विरोधाभास (नीले और पीले क्रमशः), एक संकर (हरा) है कि माता पिता के जीनोम में से प्रत्येक की एक प्रतिलिपि शामिल फार्म के लिए mated हैं. संकर में दिए गए स्थान पर, प्रत्येक प्रजाति के एलेले में एक ट्रांसपोसन प्रविष्टि (ब्लैक बॉक्स) एक हेमीजेगोटबनाता बनाता है, जो ब्याज की टिड्डी को छोड़कर जीनोम के बाकी हिस्सों में द्विगुणित है। hemizygotes भर में phenotypes की तुलना हेरफेर टिड्डी पर allelic भिन्नता के phenotypic प्रभाव से पता चलता है. बी एक दिए गए जीन (YFG)पर कई क्लोन hemizygous के पार, कुछ प्रतिस्पर्धी संस्कृति में दूसरों की तुलना में उच्च बहुतायत तक पहुँचने, अनुक्रमण द्वारा परिमाणित के रूप में. C. एक hemizygote पूल से डीएनए काट दिया और एडाप्टर (लाल) के लिए ligated है. किसी दिए गए क्लोन के लिए, ट्रांसपोसन (tn, black) और जीनोम (नीला) के बीच का जंक्शन ट्रांसपोसन-विशिष्ट प्राइमर (काला ऐरोहेड) और एक एडाप्टर-विशिष्ट प्राइमर (लाल ऐरोहेड) के साथ प्रवर्धित होता है। आयाम से पढ़ने की गिनती पढ़ने की गणना जनसंख्या में क्लोन की फिटनेस की रिपोर्ट. D. एक आरएच-सेक जीन हिट के लिए, हेमिज़गोटक्लोन (y-अक्ष) के अनुपात को उच्च तापमान पर प्रतिस्पर्धा के बाद एक दी गई फिटनेस का प्रदर्शन करने के लिए सारणीबद्ध करना ( x-अक्ष) दो जीनोटिपिक वर्गों के बीच एक हड़ताली अंतर का पता चलता है: उन लोगों के साथ S. cerevisiae allele में एक transposon प्रविष्टि (एस विरोधाभास एलील शेष के साथ; पीला) और एस विरोधाभास एलील के साथ उन बाधित (और एस cerevisiae allele शेष; नीले). कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2. पिग्गीबैकप्लाज्मिड-बोर्न ट्रांसपोसन के साथ जीनोम-वाइड पारस्परिक हेमीजिगोट्स का एक पूल तैयार करने के लिए चयन योजना।
पिग्गीबैकक्लैम (pJR487) एक URA3में तब्दील हो जाता है-/- द्विगुणित संकर एस सेरेविसिया DBVPG1373 x एस विरोधाभास $1 (JR507) के क्लोन। प्लाज्मिड या ट्रांसपोसन की उपस्थिति G418 में विकास के माध्यम से के लिए चुना गया है, जो KanMX कैसेट की उपस्थिति के लिए चयन करता है; बचे कोशिकाओं जो PiggyBac प्लाज्मिड ले लिया है और / बाद के बिना कोशिकाओं के खिलाफ में विकास के माध्यम से चुना जाता है 5-FOA, जो URA3 कैसेट की उपस्थिति में विषाक्त है. के बाद से untransformed संकर URA3है - /-, केवल कोशिकाओं है कि इस कदम में मर जाएगा उन अभी भी PiggyBac प्लाज्मिड, जो एक URA3 कैसेट शामिल हैं. क्या रहता है संकर उत्परिवर्ती जीनोम में एकीकृत transposon युक्त कोशिकाओं का एक पूल है. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3. शीर्ष हिट RH-सेक द्वारा मैप किया गया।
प्रत्येक पैनल आरएच-सेक से इंगित जीन के लिए आरएच-सेक डेटा रिपोर्ट करता है। x-अक्ष 28 डिग्री सेल्सियस पर अनुरूप मात्रा के सापेक्ष 39 डिग्री सेल्सियस पर चयन के बाद एक transposon उत्परिवर्ती क्लोन की बहुतायत के लॉग2 रिपोर्ट करता है। y-अक्ष संकेत allele में सम्मिलन असर सभी क्लोन के अनुपात की रिपोर्ट है कि एक कर्नेल घनत्व अनुमान के रूप में, एक्सपर बहुतायत अनुपात का प्रदर्शन किया. सम्मिलन के लिए पठन-पाठन और गणना के आंकड़ों की सूचना कहीं और दी गईहै3 . कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

पिछले सांख्यिकीय-आनुवंशिक तरीकों पर आरएच-सेक के फायदे कई गुना हैं। लिंकेज और एसोसिएशन विश्लेषण के विपरीत, आरएच-सेक एकल-जीन मानचित्रण संकल्प देता है; जैसे, यह संभावना भी एक दिया प्रजातियों के व्यक्तियों में विशेषता भिन्नता के अध्ययन में महत्वपूर्ण उपयोगिता का हो जाएगा, साथ ही साथ interspecific मतभेद. इसके अलावा, जीनोम व्यापक पारस्परिक hemizygosity विश्लेषण पर पिछले प्रयासजीन विलोपन उत्परिवर्ती के संग्रह का इस्तेमाल किया, जिनमें से कुछ बंदरगाह माध्यमिक उत्परिवर्तनों कि झूठी सकारात्मक परिणाम9,10के लिए नेतृत्व कर सकते हैं . आरएच-सेक रणनीति बदले में प्रत्येक जीन में कई hemizygote म्यूटेंट पैदा करने और phenotyping द्वारा इस मुद्दे sidesteps, इस तरह है कि किसी भी व्यक्ति उत्परिवर्ती क्लोन की पृष्ठभूमि अंतिम परिणाम के लिए केवल मामूली योगदान देता है. सिद्धांत रूप में, आरएच-सेक भी noncoding loci के अध्ययन affords, हालांकि वर्तमान काम में हम विशेष रूप से जीन पर ध्यान केंद्रित किया.

वहाँ आरएच-सेक, कुछ जैविक और कुछ तकनीकी, कि एक सफल व्यवसायी दृष्टिकोण की उपयोगिता को अधिकतम करने और सबसे अच्छा परिणाम के लिए पथ में तेजी लाने के लिए सामने के साथ सौदा होगा करने के लिए कुछ विचित्र हैं. जैविक रूप से, आरएच-सेक केवल एक तकनीक के रूप में समझ में आता है अगर दो लक्ष्य प्रजातियों को एक स्थिर, व्यवहार्य संकर बनाने के लिए किया जा सकता है जिसे आनुवंशिक रूप से हेरफेर किया जा सकता है। इस प्रकार हम प्रजातियों के लिए आरएच-सेक को लागू करने की कल्पना नहीं कर सकते हैं ताकि वे एक केरियोआमतौर पर स्थिर द्विगुणित में फ्यूज करने में विफल हो जाते हैं। दूसरी ओर, यदि द्विगुणित संकर के दो माता-पिता डीएनए स्तर पर बहुत समान हैं, तो ट्रांसपोसन प्रविष्टि अनुक्रमण से अधिकांश पढ़ता है, विशेष रूप से दो माता-पिता जीनोम में से केवल एक के लिए एलील-विशेष रूप से मैप नहीं किया जा सकता है और अनुपयोगी होगा; इस प्रकार, एक दिया आरएच-सेक प्रयोग सबसे सफल होगा जब माता पिता उच्च गुणवत्ता संदर्भ जीनोम उपलब्ध है और अनुक्रम विचलन के एक "मीठा स्थान" मारा. विचार के एक अलग बिंदु के रूप में, एक आरएच-सेक मूल प्रजातियों के बीच एक विशेषता अंतर के आनुवंशिक आधार विच्छेदन के लिए तैयार की परियोजना को देखते हुए, परिणाम बहुत अधिक व्याख्या योग्य होने की संभावना है जब, ब्याज की विशेषता के लिए, संकर के जीव विज्ञान के रूप में कार्य करता है माता पिता की है कि एक उचित प्रतिनिधि. संकर (हेटेरोसिस) के लिए अद्वितीय चरम phenotypes को प्रभावित या यह माता पिता के बीच अलग है के रूप में phenotype अंतर्निहित ब्याज के जीन के प्रभाव को अस्पष्ट सकता है. किसी भी जीन पारस्परिक hemizygosity विश्लेषण के माध्यम से मैप purebred माता पिता प्रजातियों की आनुवंशिक पृष्ठभूमि में स्वतंत्र allele-स्वैप प्रयोगों द्वारा मान्य किया जाना चाहिए.

एक आरएच-सेक प्रयोग में तकनीकी मुद्दों के लिए के रूप में, हमारे अनुभव शोर के कई संभावित स्रोतों पर प्रकाश डाला गया है और व्यावहारिक समाधान प्रदान की. शोर एक दिए गए जीन के दिए गए एलील में ट्रांसपोसन सम्मिलन को शरण देने वाले हेमीजेगोट्स की फिटनेस के अनुक्रमण-आधारित अनुमानों के बीच असहमति के रूप में प्रकट होता है। यह transposon म्यूटेंट की पृष्ठभूमि में भिन्न माध्यमिक उत्परिवर्तनों से प्राप्त कर सकते हैं (नीचे देखें); पीसीआर की दक्षता में परिवर्तनशीलता विभिन्न प्रविष्टि साइटों बढ़ाना; थोक पूल में एक दिया उत्परिवर्ती के कम प्रतिनिधित्व, कम अनुक्रमण कवरेज जो परिशुद्धता कमजोर करने के लिए अग्रणी; और जीन के भीतर transposon प्रविष्टि की स्थिति में मतभेद (उदा., transposons एक 3' जीन अंत में डालने कम से कम phenotypic प्रभाव हो सकता है). इन सभी कारणों के लिए, हम यह बहुत बड़ी transposon उत्परिवर्ती पूल उत्पन्न करने के लिए महत्वपूर्ण पर विचार करें और, अंतिम विश्लेषण में, दो alleles में से प्रत्येक में म्यूटेंट की एक उचित संख्या के बिना किसी भी जीन के परीक्षण से बाहर करने के लिए. हम ध्यान दें कि, हालांकि हम इसे यहाँ लागू नहीं किया है, एक बारकोड transposon प्रणाली7 आगे पीसीआर पूर्वाग्रह के मुद्दों को हल करने में मदद कर सकता है और लागत और एक आरएच-सेक प्रयोग के श्रम पर कटौती.

अंत में, हम आरएच-सेक के लिए एक सीधा कार्यप्रवाह की स्थापना की है, और दृष्टिकोण के caveats निर्दिष्ट किया है. हम पाते हैं कि बाद में आरएच-सेक की उपयोगिता से महत्वपूर्ण समझौता नहीं होता है; हम मानते हैं कि यह उच्च संकल्प के लिए महान वादा रखती है, आनुवंशिक भिन्नता के phenotypic परिणामों के जीनोम पैमाने विच्छेदन, प्रजातियों है कि प्रजनन वर्षों के लाखों लोगों के लिए अलग किया गया है के बीच मतभेद सहित.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

हम जे रूप, आर हैकली, मैं Grigoriev, ए Arkin और जे Skerker मूल अध्ययन के लिए उनके योगदान के लिए धन्यवाद, एफ अल ज़ैबेन, ए फ्लूरी, जी Geiselman, जे हांगकांग, जे किम, एम Maurer, और एल Oltrogge तकनीकी सहायता के लिए अपनी उदारता के लिए, डी. संसाधन, और बी ब्लैकमैन, एस Coradetti, ए Flamholz, वी Guacci, डी Koshland, सी नेल्सन, और ए Sasikumar चर्चा के लिए; हम भी पिग्गीबैक प्लाज्मिड के लिए जे डुबर (बायोइंजीनियरिंग विभाग, यूसी बर्कले) का धन्यवाद करते हैं। यह काम R01 GM120430-A1 द्वारा समर्थित किया गया था और संयुक्त जीनोम संस्थान, विज्ञान उपयोगकर्ता सुविधा के एक डीईओ कार्यालय में अमेरिकी ऊर्जा विभाग में RBB के लिए सामुदायिक अनुक्रमण परियोजना 1460 द्वारा. बाद के द्वारा किए गए कार्य अनुबंध नंबर के तहत अमेरिकी ऊर्जा विभाग के विज्ञान के कार्यालय द्वारा समर्थित किया गया था। डे-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics