Genetische mapping van Thermotolerance verschillen tussen soorten Saccharomyces gist via genoom-brede wederzijdse Hemizygosity analyse

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wederzijdse hemizygosity via sequencing (RH-SEQ) is een krachtige nieuwe methode om de genetische basis van een eigenschap verschil tussen soorten in kaart te worden. Pools van hemizygotes worden gegenereerd door transposon mutagenese en hun fitheid wordt bijgehouden door concurrerende groei met behulp van High-through sequencing. Analyse van de resulterende gegevens wijst genen aan die aan de eigenschap ten grondslag liggen.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Een centraal doel van de moderne genetica is om te begrijpen hoe en waarom organismen in het wild verschillen in fenotype. Tot op heden is het veld grotendeels uitgebreid op de sterkte van koppelings-en koppelingsmethoden, die de relatie tussen DNA-sequentie varianten en fenotype over recombinant nageslacht van paringen tussen individuen van een soort traceren. Deze benaderingen, hoewel krachtig, zijn niet goed geschikt voor eigenschap verschillen tussen reproductief geïsoleerde soorten. Hier beschrijven we een nieuwe methode voor genoom-brede dissectie van natuurlijke eigenschap variatie die gemakkelijk kan worden toegepast op onverenigbare soorten. Onze strategie, RH-seq, is een Genome-brede implementatie van de wederzijdse hemizygote-test. We hebben het aangewend om de genen te identificeren die verantwoordelijk zijn voor de opvallende hoge temperatuur groei van de gist Saccharomyces cerevisiae ten opzichte van zijn zuster soorten S. paradoxus. RH-SEQ maakt gebruik van transposon-mutagenese om een pool van wederzijdse hemizygoten te creëren, die vervolgens worden gevolgd door een hoge-temperatuur competitie via een hoge doorvoer volgorde. Onze RH-SEQ workflow zoals hier uiteengezet biedt een rigoureuze, onbevooroordeelde manier om oude, complexe eigenschappen in de ontluikende gist clade te ontleden, met het voorbehoud dat resource-intensieve Deep sequencing nodig is om genomische dekking voor genetische mapping te garanderen. Als sequencing kosten dalen, deze aanpak houdt grote belofte voor toekomstig gebruik over eukaryoten.

Introduction

Sinds het begin van het veld, het is een belangrijker doel in de genetica om te begrijpen van de mechanistische basis van variatie tussen wilde individuen. Als we loci in kaart plaatsen die aan een kenmerk van belang zijn gekoppeld, kunnen de opkomende genen onmiddellijk worden gebruikt als doelstellingen voor diagnostiek en drugs, en kunnen ze licht werpen op de principes van evolutie. De industriestandaard in de richting van dit doel is om te testen op een relatie tussen genotype en fenotype over een populatie via koppeling of vereniging1. Krachtig als deze benaderingen zijn, ze hebben een belangrijke beperking-ze vertrouwen op grote panelen van recombinant nageslacht van kruisen tussen interfertile individuen. Ze zijn niet van toepassing in de studie van soorten die niet kunnen paren om in de eerste plaats nakomelingen te vormen. Als zodanig heeft het veld weinig capaciteit voor onbevooroordeelde dissectie van eigenschap-verschillen tussen reproductief geïsoleerde soorten2.

In dit werk rapporteren we de technische onderbouwing van een nieuwe methode, RH-SEQ3, voor genoom onderzoeken van de genetische basis van eigenschap variatie tussen soorten. Deze aanpak is een massaal parallelle versie van de wederzijdse hemizygote test4,5, die eerst werd bedacht als een manier om de fenotypische effecten van allel verschillen tussen twee genetisch verschillende achtergronden te evalueren op een bepaalde Locus (Figuur 1a). In deze regeling worden de twee divergente personen voor het eerst tot een hybride, waarvan de helft afkomstig is van elk van de respectieve ouders. In deze achtergrond worden meerdere stammen gegenereerd, elk met een onderbroken of verwijderde kopie van het allel van elke ouder van de Locus. Deze stammen zijn hemizygoot, omdat ze overal in het genoom diploïde blijven, behalve op de Locus van belang, waar ze worden beschouwd als haploïde, en worden aangeduid als wederkerig omdat ze slechts één ouder allel missen, met zijn overgebleven allel afgeleid van de andere ouder. Door de fenotypes van deze wederzijdse hemizygote stammen te vergelijken, kan men concluderen of DNA sequentie varianten op de gemanipuleerde Locus bijdragen aan de eigenschap van belang, aangezien varianten op de Locus het enige genetische verschil zijn tussen de wederkerige hemizygote stammen. Op deze manier is het mogelijk om genetische verschillen tussen soorten te koppelen aan een fenotypische verschil tussen hen in een goed gecontroleerde experimentele opstelling. Tot op heden zijn de toepassingen van deze test in een kandidaat-gen-kader geweest — dat wil doen, gevallen waarin de hypothese al in de hand is dat een natuurlijke variatie op een kandidaat-locus van invloed kan zijn op een eigenschap.

In wat volgt, we leggen het protocol voor een genoom schaal wederzijdse hemizygosity scherm, met behulp van gist als een modelsysteem. Onze methode creëert een genomische aanvulling van hemizygote mutanten door levensvatbare, steriele F1-hybriden te genereren tussen soorten en ze te onderwerpen aan transposon-mutagenese. We pool de hemizygoten, meten hun fenotypes in sequentiegebaseerde testen en testen op verschillen in frequentie tussen de klonen van het zwembad met de allelen van een bepaald gen van de twee ouders. Het resultaat is een catalogus van loci waarbij varianten tussen soorten invloed hebben op de eigenschap van belang. We implementeren de RH-SEQ workflow om te verhelderen de genetische basis van thermotolerance verschillen tussen twee ontluikende gist soorten, Saccharomyces cerevisiae en S. paradoxus, die omgeleid ~ 5.000.000 jaar geleden6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. bereiding van het piggyBac-bevattende plasmide voor transformatie

  1. Streak uit naar enkele kolonies de E. coli stam harkotteren plasmide pJR487 op een lb + carbenicillin agar plaat. Incuberen gedurende 1 nacht bij 37 °C of totdat er enkele kolonies verschijnen.
    Opmerking: een beschrijving van hoe plasmide pJR487 werd gekloond, vindt u in ons vorige werk3.
  2. Inoculeren 1 L LB + carbenicillin op 100 μg/mL met een enkele kolonie E. coli met pJR487 in een glazen kolf van 2 liter. Groei 's nachts bij 37 °C met schudden bij 200 rpm tot verzadigd (OD600 ≥ 1,0).
  3. Reinig plasmide DNA uit de cultuur met behulp van een grootschalige plasmide prep Kit volgens de instructies in het gepubliceerde Protocol van de fabrikant (Zie tabel met materialen voor meer informatie). Elueer het DNA na een incubatie van 10 minuten met 5 mL elzen buffer opgewarmd tot 37 °C.
  4. Meet de hoeveelheid en de kwaliteit van het plasmide DNA met een spectrofotometer (Zie tabel van de materialen voor meer informatie).
  5. Herhaal de stappen 1,2 – 1,4 tot een totaal van ten minste 11 mg plasmide DNA bij een A260: een280 verhouding van ten minste 1,8 zijn geïsoleerd. Dit kan een paar Preps nemen, afhankelijk van de efficiëntie.
  6. Meng alle plasmide Preps in een enkele buis en breng het totale volume tot 20 mL met elutie buffer of water. Meet de uiteindelijke hoeveelheid en kwaliteit opnieuw met een spectrofotometer. De concentratie plasmide moet ten minste 538 ng/μL in dit laatste volume van 20 mL zijn. Als de concentratie hoger is dan 538 ng/μL, Verdun het plasmide met elutie buffer of water tot 538 ng/μL. Plasmide kan tot een paar weken bij 4 °C worden bewaard tot het gebruik.

2. het creëren van een groep van ongerichte genoom-brede wederzijdse hemizygoten

  1. Bereiding van hybride gistcellen voor transformatie
    1. Streep uit JR507 van a-80 °C vriezer stam op enkele kolonies op een YPD agar plaat. Incuberen bij 26 °C gedurende 2 dagen of totdat er kolonies verschijnen.
      Opmerking: JR507 is een hybride stam die wordt gemaakt door een eencellige paring van haploïde sporen van S. cerevisiae DBVPG1373 en S. paradoxus Z1 (met behulp van een tetrad-dissectie Microscoop)3.
    2. Inoculeren 100 mL vloeibare YPD in een glazen kolf van 250 mL met een enkele kolonie JR507 en schud bij 28 °C, 200 rpm gedurende 24 uur of totdat de stationaire fase is bereikt.
    3. Meet de volgende dag de extinctie op 600 nm (OD600) van de nachtelijke kweek. Creëer een nieuwe cultuur door een deel van de nachtelijke cultuur met Fresh Liquid YPD te verdunnen tot een nieuwe glazen kolf van 1 liter naar een OD600 van 0,2 en een volume van 500 ml.
      Opmerking: voorbeeld berekening van een back-verdunning als de nachtelijke cultuur heeft een OD600 van 5,0, waarbij C is optische dichtheid en V is volume:
      Equation 1
      Zo zou 20 mL van de verzadigde nachtelijke kweek worden toegevoegd aan 480 mL vloeibare YPD om in totaal 500 mL cultuur te maken op een OD600 van 0,2.
    4. Herhaal stap 2.1.3 nog drie keer om in totaal 4 500 mL-culturen te maken op een OD600 van 0,2 in vier glazen kolven van 1 liter, waarbij dezelfde nachtelijke cultuur wordt gebruikt voor alle vier de nieuwe culturen. Incuberen ze allemaal bij 28 °C gedurende 6 uur (2-3 generaties) schudden bij 200 rpm.
    5. Combineer twee van de 500 mL culturen om een 1 L cultuur te creëren. Combineer de overgebleven 2 500 mL culturen om nog een 1 L cultuur te creëren. Op dit punt zijn er twee culturen van 1 L. Elk van deze 1 L culturen zal worden onderworpen aan de transformatie met pJR487 in de volgende stappen.
  2. Transformatie van pJR487 in hybride gistcellen
    1. Splits elk van de 1 L-culturen in 70 mL aliquots in 20 plastic conische buizen voor een totaal van 40 buizen. Zet 20 tubes opzij en voer de volgende stappen uit op 20 tubes tegelijk.
    2. Centrifugeer elk van de twintig buisjes gedurende 3 minuten bij 1.000 x g om de gistcellen te pellet. Gooi het supernatant weg.
    3. Respendeer elke pellet met 25 mL steriele H2O door vortexing. Centrifugeer 3 min bij 1.000 x g. Gooi het supernatant weg.
    4. Respendeer elke pellet met 5 mL 1x TE, 0,1 M LiOAc buffer door vortexing. Centrifugeer 3 min bij 1.000 x g. Gooi het supernatant weg.
    5. Herhaal stap 2.2.4. Terwijl de cellen centrifugeren, bereid ten minste 120 mL van een oplossing van 39,52% Polyethyleenglycol, 0,12 M LiOAc en 1,2 x tris-EDTA buffer (12 mM tris-HCl en 1,2 mM EDTA). Opslaan op ijs.
    6. Om het plasmide DNA voor transformatie voor te bereiden, kook eerst 4 mL zalm sperma-DNA bij 100 °C gedurende 5 minuten en koel het onmiddellijk op het ijs gedurende 5 minuten. Meng vervolgens 20 mL pJR487 (verkregen in rubriek 1) met een concentratie van 538 ng/μL met de 4 mL afgekoeld zalm sperma-DNA voor een totaal volume van 24 mL. Blijf op ijs tot het gebruik.
    7. Voeg toe 600 μL plasmide DNA vermengd met zalm sperma-DNA bovenop elke celpellet. Nog niet respenderen.
    8. Voeg 3 mL PEG-LiOAc-TE oplossing uit stap 2.2.5 toe aan elke pellet. Rebreng de pellet door te pipetteren op en neer en vortexing.
    9. Inincuberen elke buis gedurende 10 minuten bij kamertemperatuur.
    10. Warmte schok elke buis voor 26 min in een waterbad ingesteld op 39 °C.
      Let op: om de paar minuten, keer elke buis om te voorkomen dat de cellen op de bodem van de buis vestigen.
    11. Centrifugeer elke buis gedurende 3 minuten bij 1.000 x g. Gooi de supernatant weg en regeer elke pellet in 10 mL YPD door vortexing. Combineer alle twintig tubes tot een nieuwe glazen kolf. Het totale volume van de cellen moet ~ 200 mL.
    12. Breng 66,6 mL cellen over naar een nieuwe glazen kolf van 1 liter en breng tot een volume van 500 mL met vloeibare YPD. Herhaal nog twee keer om de hele 200 mL getransformeerde cellen te gebruiken. Meet de OD600 van elke nieuwe 500 ml cultuur (verwacht een od600 van ~ 0.35-4).
    13. Schud alle drie de kolven bij 28 °C gedurende 2 uur om te herstellen (< 1 generatie) bij 200 rpm.
    14. Voeg 0,5 mL 300 mg/mL G418 toe aan elk van de drie kolven, tot een eindconcentratie van 300 μg/mL G418 en zet terug om te schudden bij 28 °C, 200 rpm.
      Opmerking: voorafgaand aan deze stap zijn de getransformeerde hybride cellen herstellende van transformatie. Bij de toevoeging van G418 is de aanwezigheid van de plasmide pJR487 geselecteerd. Alle cellen die tijdens de transformatie niet het plasmide hebben opgehouden, zullen beginnen te sterven.
    15. Herhaal stap 2.2.2 – 2.2.14 met de overige 20 conische buizen van cellen. Op dit punt moeten er zes 1 L glazen kolven, elk met 500 mL cellen met G418 toegevoegd.
    16. Inbroed alle zes kolven van cellen bij 28 °C, schudden bij 200 rpm, gedurende ongeveer 2 dagen of totdat een OD600 van ~ 2,3 in elke kolf is bereikt. Combineer alle zes kolven samen om een enkele cultuur te creëren.
      Opmerking: Hoewel alle cellen in deze cultuur niet zullen worden gebruikt in downstream-stappen, is het doel van het gebruik van dergelijke grote volumes geweest om zo veel unieke transformatie gebeurtenissen mogelijk te maken en eventuele vooroordelen in één transformatie te normaliseren door ze allemaal te bundelen Samen.
    17. Gebruik de in 2.2.16 gecreëerde cultuur om twee nieuwe kolven van 1 L met 500 mL YPD + G418 (300 μg/mL) te inoculeren tot een OD600 van 0,2. Er zal overgebleven cultuur zijn die weggegooid kan worden.
    18. Inincuberen beide 1 L kolven bij 28 °C 's nachts, met schudden bij 200 rpm, tot elk een OD600 van ~ 2,2 (~ 3,5 generaties) bereikt. Combineer beide culturen tot één cultuur en meet de OD600 van de gecombineerde cultuur opnieuw.
      Let op: op dit punt, de cultuur moet bijna volledig bestaan uit cellen harkotteren plasmide pJR487. In een deel van de populatie van cellen, zal de PiggyBac transposon worden omgezet van het plasmide in het genoom door de transposase uitgedrukt uit het plasmide. De voortdurende uitdrukking van de transposase kan echter leiden tot omzetting in de loop van een selectie, wat de relatie tussen genotype en fenotype zou verhullen. Het doel van de volgende stappen is het uitvoeren van een tegen selectie tegen de aanwezigheid van het plasmide, om ervoor te zorgen dat er geen expressie meer is van de transposase. De resulterende pool is een mix van cellen met of zonder de transposon geïntegreerd in het genoom, maar alleen cellen met de transposon worden gedetecteerd tijdens de volgende toewijzings stappen. De tijd in de transformatie waarin transposase wordt uitgedrukt, voordat de plasmide codering verloren gaat, kan de kans bepalen dat een bepaalde kloon na mutagenese meer dan één transposon insertie herbergt. De frequentie hiervan, die zich manifesteert als "secundaire" mutaties in analyse van één gen per keer, kan worden geschat door een bepaald aantal kolonies na mutagenese te plaatsen, en vervolgens hun DNA en sequentie te combineren-waarbij het aantal onafhankelijke insertie wordt bevestigd posities in het zwembad.
    19. Centrifugeer 25 mL van deze kweek gedurende 3 minuten bij 1.000 x g. Bereken het aantal totale OD600 eenheden cellen in de 25 ml (zie voorbeeld berekening hieronder). Gooi de supernatant weg en regeer in voldoende H2O om een celsuspensie van 1,85 od600/ml te creëren door vortexing.
      Opmerking: voorbeeld berekening voor resuspensie van cellen in water als OD600 van de gecombineerde cultuur was 2,2:
      Equation 2
      Dus, na het spinnen van 25 mL celcultuur en het verwijderen van de supernatant, Voeg genoeg H2O toe aan de cellen om het totale volume van cellen en water tot ~ 29,7 ml te brengen (aangezien de celpellet ook een volume zal hebben, minder dan 29,7 ml H2o toevoegen).
    20. Met glas parels plaat 1 mL geresuspendeerde cellen in water op elk van de 12 grote vierkante complete synthetische agar-platen met 5-FOA. Inbroed elke plaat bij 28 °C gedurende 1-2 dagen of totdat een gazon op de plaat vormt.
    21. Schik met behulp van kleine steriele knijpers de cellen van elk van de 6 platen en in een buisje met 35 mL steriel water. Herhaal met de andere 6 platen voor een totaal van twee buizen van cellen en water. Combineer alle celsuspensies in een enkele buis. Meet de OD600 van deze suspensie met water als blank. Breng de OD600/ml concentratie van cellen naar 44,4 od600 eenheden/ml met water. In onze ervaring is de omzettingsefficiëntie (het percentage van de KAN +-cellen dat URA-) is gemiddeld 50%.
    22. Bepaal het aantal van-80 °C Vries voorraden van cellen om op te slaan. Elk aliquot kan in de toekomst voor één experiment worden gebruikt.
      Opmerking: gegeven hoe tijdrovend het genereren van het zwembad is, meerdere flacons opslaan in geval van onbedoeld misbruik of voor het uitvoeren van replicaatexperimenten. 20-30 aandelen zijn een redelijk aantal.
    23. Elk Vries bestand bevat 40 OD600 eenheden cellen in 1 ml van 10% DMSO. Voeg 900 μL cellen toe aan 100 μL DMSO. Herhaal dit voor het totale aantal gecreëerde Vries voorraden. Bewaar elk bij-80 °C voor toekomstig gebruik.

3. selectie van wederzijdse hemizygoten in een gepoolde vorm

  1. Ontdooien van de-80 °C vriezer een enkel aliquot van gepoolde wederzijdse hemizygoeten uit rubriek 2 bij kamertemperatuur.
    Let op: laat de aliquot niet lang op kamertemperatuur staan zodra deze ontdooit, onmiddellijk gebruiken.
  2. Gebruik de hele 1 mL aliquot om 150 mL vloeibare YPD in een glazen kolf van 250 mL te inoculeren. Meet de OD600 van deze cultuur en inbroed bij 28 °c, schudden bij 200 rpm, gedurende ~ 7 uur, of totdat de cultuur door de 2-3 populatie doublings is gegaan. Op dit punt is de cultuur klaar om te worden gebruikt om culturen te beënten die een selectie ondergaan.
    Opmerking: voorbeeld berekening: als de OD600 van de oorspronkelijke kolf 0,25, inbroed de cultuur tot een od600 van ten minste 1,0 bereikt. Als een monsterpunten gewenst zijn bij "time-Zero" (T-0), als een manier om de hemizygote populatie voor selectie te onderzoeken, kunnen celpellets nu worden ingenomen door 5-10 mL cultuur per pellet te centrifugeren bij 1.000 x g gedurende 3 minuten, waarbij de supernatant wordt bevriezing bij-80 °C.
  3. Gebruik het gekweekte hemizygote-zwembad voor het inoculeren van culturen voor selectie in een geschikt replicaatsschema, bij zowel hoge temperatuur (39 °C) als een permissieve temperatuur (28 °C). Stel minimaal drie biologische duplo selectie culturen in bij elke temperatuur, voor in totaal zes selectie culturen.
    1. Maak elke selectie cultuur met 500 mL totaal in een 2 L glazen kolf met vloeibare YPD en inoculeren tot een OD600 van 0,02. Schud elke selectie cultuur bij 100 RPM bij 28 °C of 39 °C tot 6-7 populatie doublings heeft plaatsgevonden (overeenkomend met een OD600 van ~ 1.28-2.56). Probeer zo goed mogelijk de laatste OD600 van alle selectie culturen te matchen.
      NB: selectie culturen bij 28 °C zullen sneller groeien dan selectie culturen bij 39 °C. Daarom zullen selectie culturen bij 39 °C een langere periode in de incubator doorbrengen. Voer de volgende stappen uit voor elke kolf, ongeacht het totale aantal uren dat in de incubator wordt doorgebracht. In onze ervaring hebben culturen bij 28 °C of 39 °C respectievelijk ~ 12 of ~ 18 uur gekost om een OD van ~ 2,0 te bereiken. Lange selecties kunnen het voordeel hebben om kleine fitness effecten te versterken, maar ook om de Novo achtergrond mutaties mogelijk te maken, wat ruis zou introduceren in de uiteindelijke distributie van fittes over transposon mutanten in een gen/allel. Het is daarom belangrijk om de selectie tijd in een RH-SEQ-experiment te beperken.
  4. Oogst celpellets uit elke selectie cultuur. Bereken het volume dat nodig is om 7 OD600 eenheden cellen te verkrijgen en centrifugeer bij 1.000 x g gedurende 3 minuten ten minste vier pellets van dit volume uit elke selectie cultuur als technische replicaties voor bibliotheek voorbereiding en sequentiëren (zie rubrieken 4 en 5 , hieronder). Gooi het supernatant weg en bewaar bij-80 °C.
    Opmerking: bijvoorbeeld als een selectie kolf een laatste OD600 van 2,0 heeft:
    Equation 3

4. tn-SEQ bibliotheek bouw en Illumina sequencing om de overvloed van transposon Mutant hemizygotes te bepalen

  1. Ontdooien op ijs elke cel pellet uit sectie 3 die zal worden gesequenced.
  2. Isoleer totaal genomisch DNA (gDNA) van elke celpellet met behulp van een gist gDNA-zuiverings pakket volgens de instructies van de fabrikant. Respendeer het DNA in 50 μL elutie buffer verwarmd tot 65 °C.
  3. Kwantificeer de hoeveelheid gDNA van elke pellet met behulp van een Fluorimeter. De minimale totale hoeveelheid gDNA die voor elke celpellet is vereist om een volgende-generatie-sequencing-bibliotheek (NGS) voor de TN-SEQ te maken met behulp van de volgende procedure is 1 μg.
    Opmerking: minder dan 1 μg gDNA kan worden gebruikt om een bibliotheek te maken, maar de uiteindelijke hoeveelheid en kwaliteit van de bibliotheek zal lijden.
  4. Volg een vastgesteld protocol voor het maken van TN-SEQ bibliotheken7. Noteer de volgende relevante informatie die uniek is voor dit Protocol:
    1. Na gDNA Shearing, end Repair en adapter ligation, versterken de gDNA met de transposon via PCR. Gebruik voor die PCR de volgende voorwaartse en omgekeerde primer, die specifiek zijn voor de PiggyBac transposon en NGS-adapters, respectievelijk:
      Voorwaarts (N – Random nucleotide)
      5 ' ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
      CTCTTCCGATCTNNNNNNAGCAATATTTCAAGAATGCATGCGTCAAT 3 '
      Reverse (het stuk van NS vertegenwoordigt een unieke 6-BP index die wordt gebruikt voor multiplexing. Zie hieronder voor meer informatie over indices)
      5 ' CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAG
      ACGTGTGCTCTTCCGATCT 3 '
    2. Gebruik de meegeleverde opschonings stappen met maat-selectieve kralen om de verhouding van gekloonde fragmenten in de uiteindelijke bibliotheek te minimaliseren die te kort zou zijn om toewijsbare genomische-reeks op te nemen.
      Opmerking: nadat u de minimumvereisten voor repliceren hebt gevolgd tot nu voor selectie culturen, zijn er 24 afzonderlijke gDNA-voorbeelden voor sequentiëren. Gezien de huidige kosten voor sequentiëren, is het onwaarschijnlijk dat elk monster op zichzelf wordt uitgevoerd. Om samples op dezelfde Lane te combineren, maak je meerdere reverse primers, elk met een unieke 6-base pair index. Samples met verschillende indexen kunnen achteraf worden gecombineerd in dezelfde volgorde strook en gescheiden computationeel.
  5. Sequentie single-end 150 BP leest uit elke bibliotheek met NGS-technologieën in achtbanen.
    Opmerking: het aantal vereiste sequentiëren is sterk afhankelijk van de kwaliteit van de bibliotheken die in de vorige stap zijn voorbereid (d.w.z. het aandeel van het DNA in de bibliotheek dat in feite het transposon-DNA bevat, dat het DNA vertegenwoordigt dat afkomstig is van wederzijdse hemizygoeten). Er zijn twee belangrijke factoren die hieraan bijdragen. Ten eerste, omdat cellen zonder een geïntegreerde transposon niet tegen zijn geselecteerd tijdens het maken van het zwembad, zal elke cultuur een mix van cellen zijn met en zonder de transposon. Ten tweede is het grootste deel van het genoom, zelfs binnen het genoom van transposon met wederkerige hemizygoeten, niet transposon met sequentie, en deze gDNA zal onvermijdelijk onderdeel zijn van de voorbereiding van de bibliotheek. Het doel van de uiteindelijke PCR-versterking van transposon-bevattende DNA is om de verhouding van transposon-bevattende DNA te verhogen naar deze twee bronnen van de achtergrond gDNA. Hoe efficiënter deze versterking is, het hogere percentage leesbewerkingen kan worden gebruikt in de downstream-analyse. De lagere kwaliteit van de bibliotheken zijn, hoe meer sequencing zal moeten worden gedaan, aangezien een toenemend aantal leesbewerkingen geen transposon DNA zal bevatten en zal niet nuttig zijn. Gezien de bovenstaande beperkingen waren acht Lanes van sequencing in staat om wederzijdse hemizygote abundanten in een redelijke mate te volgen. Meer sequentiëren zou een diepere analyse mogelijk maken.

5. mapping van de locaties van transposon inserties en RH-SEQ analyse

Opmerking: de volgende gegevensanalyse is uitgevoerd met aangepaste python-scripts (online gevonden op https://github.com/weiss19/rh-seq), maar kan opnieuw worden uitgevoerd met andere scripttalen. Hieronder worden de belangrijkste stappen in het proces beschreven. Voer de volgende stappen uit op elk afzonderlijk Lees bestand repliceren, tenzij het wordt vermeld om ze te combineren.

  1. Trim adapter sequenties van leesbewerkingen en scheid de leesbewerkingen van elke replicaten volgens de index.
  2. Vind leesbewerkingen met transposon-genoom kruisingen. Om dit te bereiken, zoeken in elk gelezen voor de laatste 20 baseparen van de transposon, CAGACTATCTTTCTAGGGTTAA. Verwijder alle leesbewerkingen die deze reeks niet bevatten.
    Opmerking: in onze ervaring is de verhouding van leesbewerkingen tot het einde van de transposon 83-95%.
  3. Trim de overgebleven, transposon-bevattende leesbewerkingen alleen de sequentie stroomafwaarts van het 3 ' einde van de transposon bevatten. Door deze sequentie aan het gist genoom te koppelen, bepaalt u de genomische context van de transposon-insertie voor elke Lees (stap 5,4 hieronder).
  4. Gebruik BLAT of een gelijkwaardige mapping tool om de sequentie stroomafwaarts van de transposon aan de S. cerevisiae DBVPG1373 x S. paradoxus Z1 Hybrid genoome (script naam: map_and_pool_BLAT. py) in kaart te brengen.
    1. Gooi alle leesbewerkingen weg waarvoor er minder dan 50 basis paren bruikbare sequentie stroomafwaarts van 3 ' einde van de transposon. Korte sequenties zijn moeilijk om uniek in kaart te worden.
    2. Gebruik de volgende parameters als u BLAT gebruikt: Identity = 95, tegelgrootte = 12.
    3. Maak een basis hybride genoom te gebruiken voor toewijzing door het samenvoegen van de meest recente versies van Reference genomen van s. cerevisiae S288c en s. paradoxus CBS432.
      Opmerking: een eenvoudig aantekening bestand dat de genomische grenzen van individuele genen in het hybride genoom beschrijft, is te vinden op de hierboven vermelde github-repository (bestandsnaam: YS2 + CBS432 + plasmid_clean). Gebruik alleen leesbewerkingen die naar een enkele locatie in het hybride genoom (d.w.z. zijn uniek voor ofwel S. cerevisiae of S. paradoxus). Er wordt een uniforme frequentie van insertie gebeurtenissen in het genoom verwacht; de verdeling van de plaatsingsposities over de genomen wordt elders gerapporteerd3.
  5. Het totale aantal leesbewerkingen aan elke unieke transposon-plaatsings locatie, die we afleiden, is afkomstig uit cellen van een enkele transposon insertion Mutant Clone. De som van alle dergelijke waarden uit één bibliotheek wordt het totale aantal toegewezen leesbewerkingen voor die bibliotheek genoemd.
  6. In gevallen waarin er meerdere invoegingen toewijzing binnen 3 basis paren van elkaar, combineer ze allemaal op een enkele invoegpositie, alle leesbewerkingen toewijzen aan de enkele locatie met de hoogste aantal lezen. Deze waarde, nInsert, vertegenwoordigt de overvloed van die insertie kloon in de celpellet waaruit gdna is gesequentieerd. Op dit punt, zullen er lijsten van nInvoegen, elk van de overvloed van een unieke toegewezen transposon inbrengen, één lijst voor elke cel pellet Sequenced.
    Opmerking: de PiggyBac transposon inserts op TTAA sequenties in het genoom, een 4 basis paar sequentie. Zo concluderen we dat inserties mapping binnen 3 basis paren van elkaar moet zijn afkomstig van dezelfde TTAA site.
  7. Aangezien er een enigszins verschillend aantal van de totale leesbewerkingen uit elke gesequentieerde bibliotheek zal zijn, Normaliseer de n waardenInvoegen voor alle bestanden als ze moeten worden vergeleken. Doe dit door het totale aantal toegewezen leesbewerkingen uit elke afzonderlijke bibliotheek, npellet, te tabuleren en het gemiddelde te nemen van alle npellet in alle bibliotheken, < npellet>. Vermenigvuldig elke nInsert in de gegevens van een individuele bibliotheek door de verhouding van < npellet>/npellet om eenInsertte berekenen, de genormaliseerde overvloed van een gegeven transposon insertion Clone.
    Equation 4
    Als alternatief kan de grootte van de bibliotheek worden geschat met behulp van de beschikbare tools zoals DESeq28 (script naam: total_reads_and_normalize. py).
  8. Tabuleren de set van alle inserties toegewezen in alle bibliotheken. Voor inserties gevonden in sommige bibliotheken, maar niet in andere, stel eenInsert = 1 voor downstream berekeningen.
  9. Filter de leesbewerkingen om die inserties te vinden die binnen genen vallen volgens het aantekening bestand (script naam: remove_NC_and_plasmid_inserts. py).
  10. Bereken voor elke unieke insertie de gemiddelde overvloed over technische replicaties van elke selectie (elke cultuur bij 28 °C of 39 °C), < eeninsert>Technical (script naam: combine_tech_reps_V2. py).
  11. Bereken voor elke unieke insertie de gemiddelde overvloed over biologische replicaties van elke temperatuur, < eenwisselplaat>totaal, door het gemiddelde van alle < eenwisselplaat>technische bij elke temperatuur te nemen. Bereken tegelijkertijd de variatiecoëfficiënt voor elke insertie, CVInsert, totaal over de < eenInsert>Technical (script naam: combine_bio_reps. py).
    Let op: op dit punt, voor elke temperatuur, 28 °C en 39 °C, is er een lijst van unieke transposon inserties, hun gemiddelde overvloed en de variatiecoëfficiënt tussen biologische replicaten voor elk. Deze gegevens voor ons experiment worden elders gerapporteerd3.
  12. Filter de lijst van alle inserties voor degenen die hebben, bij 28 °C of 39 °C, < eeninsert>totaal > 1,1, en CVInsert,totaal ≤ 1,5 (script naam: filter_inserts. py).
  13. Bereken voor elke unieke insertie de log2(< eenInsert>totaal, 28 °c /< eenwordt ingevoegdt >totaal, 39 °c). Deze waarde staat voor de "thermotolerance" van een gegeven transposon insertion Mutant Clone (script naam: fitness_ratios. py).
  14. Sorteer alle unieke inserties door gen en allel (s. cerevisiae of s. paradoxus), en tabuleren het aantal inserties in elk allel. Filter genen zodat alleen genen met ten minste 5 inserties in elk allel geanalyseerd worden (script naam: organize_and_filter_genes. py).
    Opmerking: meerdere unieke inserties over elk allel zorgen voor een nauwkeurigere meting van die wederzijdse hemizygote thermotolerance. Het verlagen van het aantal vereiste inserties per allel is mogelijk, maar zal de nauwkeurigheid van deze maatregel in gevaar brengen en de meervoudige test last verhogen doordat meer genen kunnen worden getest. Bovendien, het filteren van genen met te weinig inserties per allel zal helpen verminderen de impact op de testresultaten van elke individuele hemizygote kloon harkotteren van een secundaire site mutatie die een zeer verschillend fenotype verleent.
  15. Vergelijk voor elk gen in de gegevensset na bovenstaande filtering de thermotoleranties (Log2 -verhoudingen) van alle inserties in de s. cerevisiae allel aan die van de s. paradoxus allel met behulp van een Mann-Whitney U-test. Als alternatief kan een regressiemodel worden geïmplementeerd, aangepast van DESeq28 (script naam: mann_whitney_u. py).
  16. Correcte p-waarden voor meervoudige testen met de benjamini-Hochberg methode.
  17. Genen met significante p-waarden (bijvoorbeeld ≤ 0,01) zijn kandidaten voor genen die belangrijk zijn voor verschillen in Thermo tolerantie tussen de twee soorten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

We gedekt s. cerevisiae en s. paradoxus om een steriele hybride te vormen, die we aan transposon mutagenese onderworpen hebben. Elke gemutageniseerde kloon was een hemizygote, een diploïde hybride waarin één allel van één gen verstoord is (Figuur 1a, Figuur 2). We namen de hemizygoten tegen elkaar op door groei bij 39 °C en, in een afzonderlijk experiment als controle, op 28 °C (Figuur 1b), en we geïsoleerd DNA van elke cultuur. Om de geschiktheid van elke hemizygote te rapporteren, hebben we overvloed gekwantificeerd via bulk volgordebepaling, met behulp van een protocol waarin DNA was gefragmenteerd en geligeerd aan adapters, gevolgd door versterking van transposon insertion posities (figuur 1c). Als de primers voor deze versterking onderscheiden van, en minder efficiënt dan, die in het Protocol, achtergrond leest zal overheerten in de sequentiëren gegevens, wat leidt tot minder bruikbare leest en eroderen van de nauwkeurigheid van fitness schattingen. Vergelijkbare kwaliteitsproblemen kunnen het gevolg zijn van lage DNA-invoer in de voorbereiding van sequentiëren bibliotheken.

Met resultaten in de hand van onze sequencing, voor een gegeven gen vergeleken we hemizygote Abundances bij de twee temperaturen tussen twee klassen van hemizygotes: klonen waar alleen de S. cerevisiae allel was wild-type en functioneel, en klonen alleen vertrouwen op de S. paradoxus allel (figuur 1d). In de analyse in dit stadium, als de computationele nabewerkings strategie van het protocol niet wordt gevolgd en genen met relatief weinig transposon mutanten in het zwembad in de analyse zijn opgenomen, zal statistisch vermogen dalen en geen significante gen-oproepen zullen resulteren. In onze implementatie hebben we een sterk signaal gedetecteerd bij acht huishoudelijke genen (Figuur 3). In elk geval, transposon inserties in de S. cerevisiae allel in de hybride gecompromitteerde groei bij hoge temperatuur (Figuur 3). Deze loci vertegenwoordigde kandidaat-determinanten van de thermotolerance-eigenschap die s. cerevisiae onderscheidt van s. paradoxus. In afzonderlijke experimenten die elders werden gerapporteerd, hebben we de impact van allel variatie op elke site gevalideerd met behulp van standaard Transgenese methoden buiten het bereik van het huidige protocol3.

Figure 1
Figuur 1. Schematische voorstelling van de RH-SEQ-workflow.
A. S. cerevisiae en s. paradoxus (respectievelijk blauw en geel), worden gemuleerd om een hybride (groen) te vormen die een enkel exemplaar van elk van de Genomes van de ouders bevat. Bij een bepaalde Locus in de hybride creëert een transposon insertie (zwarte doos) in elke soort ' allel op zijn beurt een hemizygote, wat diploïde is bij de rest van het genoom, met uitzondering van de Locus van belang. Het vergelijken van fenotypes over hemizygoten onthult de fenotypische effecten van allel variatie op de gemanipuleerde Locus. B. over veel klonen hemizygoot bij een gegeven gen (yfg), sommige bereiken een grotere overvloed dan anderen in concurrerende cultuur, zoals gekwantificeerd door sequencing. C. DNA van een hemizygote pool wordt geschoren en aan adapters (rood) geligeerd. Voor een bepaalde kloon wordt de kruising tussen de transposon (TN, zwart) en het genoom (blauw) versterkt met een transposon-specifieke primer (zwarte pijlpunt) en een adapterspecifieke primer (rode pijlpunt). Sequentiëren lezen tellingen van de ampliconlengte voor temp verslag de geschiktheid van de kloon in de populatie. D. voor het bereiken van een RH-SEQ gen hit, het aantal hemizygote klonen (y-as) dat een bepaalde fitheid vertoont na een wedstrijd bij hoge temperatuur (x-as), een opvallend verschil tussen twee genotypische klassen onthult: die met een transposon insertie in de s. cerevisiae allel (met de s. paradoxus allel overgebleven; geel) en die met de s. paradoxus allel verstoord (en S. cerevisiae allel overgebleven; blauw). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2. Selectie schema voor het genereren van een pool van genoom-brede wederzijdse hemizygoten met de PiggyBac plasmide-Borne transposon.
De piggybac plasmide (pJR487) wordt omgevormd tot een URA3-/- kloon van de diploïde hybride S. cerevisiae DBVPG1373 x S. paradoxus Z1 (JR507). De aanwezigheid van de plasmide of transposon is geselecteerd voor via groei in G418, die voor de aanwezigheid van de KanMX cassette selecteert; overlevenden zijn cellen die de PiggyBac plasmide en/of de haven van een geïntegreerde transposon hebben overgenomen. Cellen zonder de laatste worden geselecteerd tegen via groei in 5-FOA, die giftig is in de aanwezigheid van de URA3 cassette. Aangezien de niet-getransformeerde hybride URA3-/-, de enige cellen die zullen sterven in deze stap zijn die nog steeds bevatten de piggybac plasmide, die een URA3 cassette bevat. Wat overblijft is een pool van hybride mutanten cellen die de transposon bevatten, geïntegreerd in het genoom. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3. Top Hits toegewezen door RH-SEQ.
Elk paneel rapporteert de RH-SEQ gegevens voor het aangegeven gen van de RH-SEQ. De x-as rapporteert de log2 van overvloed van een transposon Mutant kloon na selectie bij 39 ° c, ten opzichte van de analoge hoeveelheid bij 28 ° c. De y-as rapporteert het aandeel van alle klonen met invoegingen in het aangegeven allel dat de abundantie verhouding op de xvertoonde, als een schatting van de kerneldichtheid. Onderliggende Lees-en telgegevens voor inserties worden elders gerapporteerd3. Klik hier om een grotere versie van dit cijfer te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De voordelen van de RH-SEQ ten opzichte van eerdere statistische-genetische methoden zijn meerdere malen. In tegenstelling tot de koppeling-en associatie analyse, biedt de RH-SEQ een single-gen mapping-resolutie; als zodanig, het zal waarschijnlijk van belangrijk nut zijn, zelfs in studies van eigenschap variatie over individuen van een bepaalde soort, evenals interspecifieke verschillen. Ook, eerdere pogingen tot genoom-brede wederzijdse hemizygosity analyse gebruikt verzamelingen van gendeletie mutanten, waarvan sommige Secundaire mutaties in de haven die kunnen leiden tot vals positieve resultaten9,10. De RH-SEQ strategie zijt dit probleem door het genereren en fenotypen van veel hemizygote mutanten in elk gen op zijn beurt, zodat de achtergrond van een individuele Mutant kloon slechts marginaal bijdraagt aan het eindresultaat. In principe biedt de RH-SEQ ook de studie van Noncoding loci, hoewel we in het huidige werk uitsluitend gericht waren op genen.

Er zijn een paar eigenaardigheden aan RH-seq, sommige biologische en sommige technische, dat een succesvolle beoefenaar zal omgaan met up front om het nut van de aanpak te maximaliseren en het pad naar de beste resultaten te versnellen. Biologisch gezien is RH-SEQ alleen zinvol als een techniek als de twee doelsoorten kunnen worden gelijkgesteld met een stabiele, levensvatbare hybride die genetisch gemanipuleerd kan worden. Zo kunnen we niet voor ogen hebben dat er RH-SEQ worden toegepast op soorten die zo uiteenlopend zijn dat ze niet in een karyotypisch stabiele diploïde smelten. Aan de andere kant, als de twee ouders van de diploïde hybride te gelijkaardig zijn op het DNA-niveau, kunnen de meeste leesbewerkingen van de transposon insertion sequencing niet allel worden toegewezen-specifiek voor slechts één van de twee bovenliggende genomen en onbruikbaar; een gegeven RH-SEQ-experiment zal dus het meest succesvol zijn wanneer de ouders hoogwaardige referentie-genomen beschikbaar hebben en een "zoete vlek" van sequentie divergentie raken. Als een afzonderlijk punt van overweging, gezien een RH-SEQ project geformuleerd om de genetische basis van een eigenschap verschil tussen de moeder soort te ontleden, zullen de resultaten waarschijnlijk veel meer interpreteerbaar zijn wanneer, voor de eigenschap van belang, de biologie van de hybride dient als een redelijke vertegenwoordiger van die van de ouders. Extreme fenotypes die uniek zijn voor de hybride (Heterosis) kunnen de effecten van genen van belang die aan het fenotype ten grondslag liggen, beïnvloeden of verhullen, aangezien deze verschillen tussen de ouders. Alle genen die worden gemapt via wederzijdse hemizygosity-analyse moeten worden gevalideerd door onafhankelijke allel-swap-experimenten in de genetische achtergronden van de raszuivere moeder soort.

Wat technische problemen in een RH-SEQ-experiment betreft, heeft onze ervaring verschillende potentiële bronnen van lawaai belicht en bruikbare oplossingen geboden. Ruis manifesteert zich als onenigheid tussen de op sequentiëren gebaseerde schattingen van de fitheid van de hemizygoten harkotteren van transposon inserties in een gegeven allel van een gegeven gen. Dit kan voortvloeien uit verschillende secundaire mutaties in de achtergronden van transposon mutanten (zie hieronder); variabiliteit in de efficiëntie van de PCR-versterkend verschillende insertie plaatsen; lage weergave van een bepaalde mutant in de bulk pool, wat leidt tot een lage sequentiedekking die de precisie verzwakt; en verschillen in positie van de transposon inbrengen binnen het gen (bijv. transposons inbrengen bij een 3 ' gen-end kunnen een minimaal fenotypische effect hebben). Om al deze redenen achten wij het van cruciaal belang om zeer grote transposon Mutant Pools te genereren en, uiteindelijk, om het testen van een gen zonder een redelijk aantal mutanten in elk van de twee allelen uit te sluiten. We merken op dat, hoewel we het hier niet hebben geïmplementeerd, een met transposon systeem7 verder kan helpen bij het oplossen van problemen van PCR-bias en bezuinigen op de kosten en arbeid van een RH-SEQ-experiment.

Kortom, we hebben een eenvoudige workflow voor RH-SEQ opgesteld en hebben de voorkant van de aanpak gespecificeerd. Wij vinden dat deze laatste het nut van de RH-SEQ niet significant in gevaar brengt; Wij zijn van mening dat het een grote belofte is voor een dissectie van de fenotypische gevolgen van genetische variatie, met inbegrip van de verschillen tussen soorten die al miljoenen jaren op een reproductief niveau zijn geïsoleerd.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken J. Roop, R. Hackley, I. Grigoriev, A. Arkin en J. Skerker voor hun bijdragen aan de oorspronkelijke studie, F. AlZaben, A. Flury, G. Geiselman, J. Hong, J. Kim, M. Maurer, en L. Oltrogge voor technische bijstand, D. Savage voor zijn vrijgevigheid met microscopie bronnen, en B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson, en A. Sasikumar voor discussies; We danken ook J. dueber (Department of Bioengineering, UC Berkeley) voor de PiggyBac plasmide. Dit werk werd ondersteund door R01 GM120430-a1 en door communautaire sequencing project 1460 aan RBB op het Amerikaanse ministerie van energie joint Genome Institute, een DOE kantoor van Science user facility. Het werk van deze laatste werd gesteund door het kantoor van de wetenschap van het Amerikaanse ministerie van energie onder contract nr. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics