Genetisk kartlegging av Thermotolerance forskjeller mellom arter av Saccharomyces gjær via Genova-bredt gjensidige Hemizygosity Analysis

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Gjensidige hemizygosity via sekvensering (RH-SEQ) er en kraftig ny metode for å kartlegge genetisk grunnlag av en egenskap forskjell mellom arter. Bassenger av hemizygotes er generert av Transposon mutagenese og deres egnethet spores gjennom konkurransedyktig vekst ved hjelp av høy-gjennom sekvensering. Analyse av den resulterende data peikt gener underliggende trekket.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Et sentralt mål for moderne genetikk er å forstå hvordan og hvorfor organismer i naturen varierer i fenotype. Hittil har feltet Avansert i stor grad på styrken av kobling og forening kartlegging metoder, som sporer forholdet mellom DNA sekvens varianter og fenotype tvers rekombinant avkom fra siamesere mellom individer av en art. Disse tilnærmingene, men kraftige, er ikke godt egnet til egenskap forskjeller mellom reproductively isolerte arter. Her beskriver vi en ny metode for Disseksjon av naturlig egenskap variasjon som lett kan brukes på inkompatible arter. Vår strategi, RH-SEQ, er en Genova-bred gjennomføring av gjensidig hemizygote test. Vi utnyttet den til å identifisere gener ansvarlig for slående høy temperatur vekst av gjær Saccharomyces cerevisiae i forhold til sin søster arter S. paradoxus. RH-SEQ utnytter Transposon mutagenese å skape en pool av gjensidige hemizygotes, som deretter spores gjennom en høy temperatur konkurranse via høy-gjennomstrømning sekvensering. Våre RH-SEQ arbeidsflyt som er lagt ut her gir en streng, upartisk måte å analysere gamle, komplekse trekk i spirende gjær klade, med påminnelse om at ressurskrevende dyp sekvensering er nødvendig for å sikre genomisk dekning for genetisk kartlegging. Idet sekvensering omkostningene miste, denne adgang avholde stor Love for fremtid bruk vannrett Landplantenes.

Introduction

Siden begynnelsen av feltet, har det vært et førsteklasses mål i genetikk å forstå mekanistisk grunnlag av variasjon over ville individer. Som vi kart Loci underliggende en egenskap av interesse, den emergent gener kan være av umiddelbar bruk som mål for diagnostikk og narkotika, og kan belyse prinsippene om evolusjon. Bransjestandarden mot dette formålet er å teste for et forhold mellom genotype og fenotype over en populasjon via kobling eller forening1. Kraftig som disse tilnærmingene er, de har en viktig begrensning-de er avhengige av store paneler av rekombinant avkom fra krysser mellom interfertile individer. De er ikke i bruk i studiet av arter som ikke kan mate å danne avkom i første omgang. Som sådan har feltet hatt liten kapasitet for objektiv Disseksjon av Personlighets forskjeller mellom reproductively isolerte arter2.

I dette arbeidet rapporterer vi den tekniske grunnlaget av en ny metode, RH-SEQ3, for Genova-skala undersøkelser av genetisk grunnlag av egenskap variasjon mellom arter. Denne tilnærmingen er en massivt parallell versjon av den gjensidige hemizygote test4,5, som først ble unnfanget som en måte å evaluere den fenotypiske effekten av allel forskjeller mellom to genetisk distinkt bakgrunn på en bestemt geometrisk (figur 1a). I denne ordningen, de to avvikende individer er først paret å danne en hybrid, halvparten av hvis Genova kommer fra hver av de respektive foreldre. I denne bakgrunnen, er flere stammer generert, hver med en avbrutt eller slettet kopi av hver av foreldrenes allel av geometriske. Disse stammer er hemizygous siden de forblir diploid overalt i Genova unntatt på geometriske steder av interesse, der de anses haploide, og er referert til som gjensidige siden hver mangler bare én foreldrenes allel, med sine resterende allel avledet fra andre forelderen. Ved å sammenligne fenotyper av disse gjensidige hemizygote stammer, kan man konkludere med om DNA-sekvens varianter ved manipulert geometrisk, bidrar til trekk av interesse, siden varianter på det geometriske er den eneste genetiske forskjellen mellom gjensidig hemizygote stammer. På denne måten er det mulig å knytte genetiske forskjeller mellom arter til en fenotypiske forskjell mellom dem i et godt kontrollert eksperiment oppsett. Hittil har søknader om denne testen vært i et kandidat-gen rammeverk-det vil si tilfeller der hypotesen er allerede i hånden som naturlig variasjon på et kandidat knutepunkt kan påvirke en egenskap.

I det følgende, legger vi ut protokollen for et Genova-skala gjensidige hemizygosity skjermen, ved hjelp av gjær som modell system. Vår metode skaper en genomisk komplement av hemizygote mutanter, ved å generere levedyktig, sterile F1 hybrider mellom arter og utsette dem for Transposon mutagenese. Vi Pool hemizygotes, måle deres fenotyper i sekvensering-baserte analyser, og test for forskjeller i frekvens mellom kloner av bassenget bærer de to foreldrenes alleler av et gitt gen. Resultatet er en katalog av Loci der varianter mellom arter påvirker trekk av interesse. Vi implementerer RH-SEQ arbeidsflyt for å belyse det genetiske grunnlaget for thermotolerance forskjeller mellom to spirende gjær arter, Saccharomyces cerevisiae og S. paradoxus, som skilt ~ 5 000 000 år siden6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. utarbeidelse av piggyBac-inneholdende plasmider for transformasjon

  1. Strek ut til enkelt kolonier E. coli stamme harboring plasmider pJR487 på en lb + carbenicillin agar plate. Ruge for 1 natt ved 37 ° c eller til enkelt kolonier vises.
    Merk: en beskrivelse av hvordan plasmider pJR487 ble klonet finnes i vårt forrige arbeid3.
  2. Vaksinere 1 L av LB + carbenicillin ved 100 μg/mL med en enkelt koloni av E. coli inneholdende pJR487 i en 2 L glass kolbe. Vokser over natten ved 37 ° c med risting ved 200 RPM til mettet (OD600 ≥ 1,0).
  3. Rens plasmider DNA fra kulturen ved hjelp av en stor skala plasmider prep kit som beskrevet i produsentens publiserte protokollen (se tabell over materialer for detaljer). Eluere DNA etter en 10 minutters inkubasjons med 5 mL eluering buffer varmet til 37 ° c.
  4. Mål mengden og kvaliteten på plasmider DNA med en spektrofotometer (se tabell over materialer for detaljer).
  5. Gjenta trinn 1,2 – 1,4 til totalt minst 11 mg plasmider DNA ved en A260: a280 ratio på minst 1,8 er isolert. Dette kan ta noen forbereder, avhengig av effektivitet.
  6. Bland alle plasmider forbereder sammen til et enkelt rør og få det totale volumet opp til 20 mL med eluering buffer eller vann. Mål den endelige kvantitet og kvalitet igjen med en spektrofotometer. Konsentrasjonen av plasmider bør være minst 538 ng/μL i dette siste 20 mL volumet. Hvis konsentrasjonen er høyere enn 538 ng/μL, fortynne plasmider med eluering buffer eller vann til 538 ng/μL. Plasmider kan oppbevares ved 4 ° c opp til et par uker til bruk.

2. opprette en pool av målrettede Genova-bredt gjensidige hemizygotes

  1. Utarbeidelse av hybrid gjærceller for transformasjon
    1. Stripe ut JR507 fra a-80 ° c fryseboks lager belastning til enkelt kolonier på en YPD agar plate. Ruge ved 26 ° c i 2 dager eller til koloniene vises.
      Merk: JR507 er en hybrid stamme gjort gjennom enkelt celle mating av haploide sporer av S. cerevisiae DBVPG1373 og S. paradoxus Z1 (ved hjelp av et Tetrad-disseksjon mikroskop)3.
    2. Vaksinere 100 mL væske YPD i en 250 mL glass kolbe med en enkelt koloni av JR507 og rist ved 28 ° c, 200 RPM i 24 timer, eller til stasjonær fase er nådd.
    3. Neste dag, måle den optiske tettheten på 600 NM (OD600) av overnight kulturen. Lag en ny kultur med tilbake-fortynning noen av overnatting kultur med fersk væske YPD inn i en ny 1 L glass kolbe til en OD600 på 0,2 og et volum på 500 ml.
      Merk: eksempel beregning av en tilbake-fortynning hvis over natten kulturen har en OD600 av 5,0, der C er optisk tetthet og V er volum:
      Equation 1
      Dermed vil 20 mL mettet overnatting kultur legges til 480 mL flytende YPD å gjøre totalt 500 mL kultur på en OD600 av 0,2.
    4. Gjenta trinn 2.1.3 tre ganger for å lage totalt 4 500 mL kulturer på en OD600 av 0,2 i fire 1 L glass flasker, med samme over natten kultur for alle fire nye kulturer. Ruge dem alle ved 28 ° c i 6 timer (2-3 generasjoner) risting ved 200 rpm.
    5. Kombiner to av 500 mL kulturer for å skape en 1 L kultur. Kombiner de resterende 2 500 mL kulturer for å opprette en annen 1 L kultur. På dette punktet er det to 1 L kulturer. Hver av disse 1 L kulturer vil bli gjenstand for transformasjon med pJR487 i følgende trinn.
  2. Transformasjon av pJR487 i hybrid gjærceller
    1. Split hver av 1 L kulturer i 70 mL alikvoter i 20 plast koniske rør for totalt 40 rør. Sett til side 20 rør og utføre følgende trinn på 20 rør om gangen.
    2. Sentrifuger hver av tjue rør for 3 min på 1 000 x g til pellet gjær cellene. Kast supernatanten.
    3. Resuspend hver pellet med 25 mL steril H2O ved virvlingen. Sentrifuger for 3 min ved 1 000 x g. Kast supernatanten.
    4. Resuspend hver pellet med 5 mL 1x TE, 0,1 M LiOAc buffer ved virvlingen. Sentrifuger for 3 min ved 1 000 x g. Kast supernatanten.
    5. Gjenta trinn-2.2.4. Mens cellene er sentrifugering, forberede minst 120 mL av en løsning av 39,52% polyetylen glykol, 0,12 M LiOAc og 1,2 x Tris-EDTA buffer (12 mM Tris-HCl og 1,2 mM EDTA). Oppbevares på is.
    6. For å forberede plasmider DNA for transformasjon, kok først 4 mL laks sperm DNA ved 100 ° c i 5 min og umiddelbart avkjøle det på isen i 5 min. Bland deretter 20 mL pJR487 (fremstilt i avsnitt 1) ved en konsentrasjon på 538 ng/μL med 4 mL avkjølt lakse sæd DNA for et total volum på 24 mL. Hold på isen til bruk.
    7. Tilsett 600 μL av plasmider DNA blandet med lakse sæd DNA på toppen av hver celle pellet. Ikke resuspend ennå.
    8. Tilsett 3 mL PEG-LiOAc-TE-løsning gjort i trinn 2.2.5 til hver pellet. Resuspend pellet ved pipettering opp og ned og virvlingen.
    9. Ruge hvert rør i 10 min ved romtemperatur.
    10. Varme sjokk hvert rør i 26 min i et vannbad satt til 39 ° c.
      Merk: hvert par minutter, inverter hvert rør for å hindre at cellene settling på undersiden av røret.
    11. Sentrifuger hvert rør for 3 min ved 1 000 x g. Kast supernatanten og resuspend hver pellet i 10 mL YPD ved virvlingen. Kombiner alle tjue rør inn i en ny glass kolbe. Det totale volumet av celler bør være ~ 200 mL.
    12. Overfør 66,6 mL av cellene til en ny 1 L glass kolbe og få opp til et volum på 500 mL med flytende YPD. Gjenta to ganger til for å bruke hele 200 mL av transformert celler. Mål OD600 av hver nye 500 ml kultur (forventer en OD600 av ~ 0.35-4).
    13. Rist alle tre flasker ved 28 ° c i 2 timer for å gjenopprette (< 1 generasjon) ved 200 rpm.
    14. Tilsett 0,5 mL 300 mg/mL G418 til hver av de tre flaskene, til en endelig konsentrasjon på 300 μg/mL G418 og sett tilbake for å riste ved 28 ° c, 200 rpm.
      Merk: før dette trinnet, har transformert hybrid celler er utvinne fra transformasjon. Ved tilsetning av G418, er tilstedeværelsen av plasmider pJR487 valgt for. Eventuelle celler som ikke tar opp plasmider under transformasjon vil begynne å dø.
    15. Gjenta trinn 2.2.2-2.2.14 med de resterende 20 koniske rør av celler. På dette punktet bør det være seks 1 L glass flasker, hver med 500 mL celler med G418 lagt.
    16. Ruge alle seks flasker med celler ved 28 ° c, risting ved 200 RPM, i ca. 2 dager eller til en OD600 på ~ 2,3 er nådd i hver kolbe. Kombiner alle seks flasker sammen for å skape en enkel kultur.
      Merk: selv om alle cellene i denne kulturen ikke vil bli brukt i nedstrøms trinn, har målet om å bruke slike store volumer vært å skape så mange unike transformasjon hendelser som mulig og normalisere eventuelle skjevheter over en enkelt transformasjon ved pooling dem alle Sammen.
    17. Bruk kulturen som skapes i 2.2.16 for å vaksinere to nye 1 L flasker med 500 mL YPD + G418 (300 μg/mL) til en OD600 på 0,2. Det vil være rester kultur som kan kastes.
    18. Ruge både 1 L flasker ved 28 ° c over natten, med risting ved 200 RPM, til hver av dem når en OD600 på ~ 2,2 (~ 3,5 generasjoner). Kombiner begge kulturer i en enkelt kultur og måle OD600 av den kombinerte kulturen igjen.
      Merk: på dette punktet, bør kulturen være nesten utelukkende består av celler harboring plasmider pJR487. I en del av befolkningen i cellene, vil PiggyBac Transposon ha blitt gjennomført fra plasmider inn i Genova av transposase uttrykt av plasmider. Imidlertid kan fortsatt uttrykk for transposase føre til transponering i løpet av et utvalg, noe som ville skjule forholdet mellom genotype og fenotype. Målet med de neste trinnene er å utføre en counterselection mot tilstedeværelsen av plasmider, for å sikre at det ikke er mer uttrykk for transposase. Det resulterende bassenget er en blanding av celler med eller uten Transposon integrert i Genova, men bare celler som inneholder Transposon oppdages under de etterfølgende tilordnings trinnene. Tiden i transformasjonen der transposase uttrykkes, før plasmider kodingen går tapt, kan styre sjansen for at en gitt klone etter mutagenese havner mer enn en Transposon innsetting. Hyppigheten av disse, som manifest som "sekundær" mutasjoner i analyse av ett gen om gangen, kan anslås ved stiller opp et definert antall kolonier etter mutagenese, deretter kombinere deres DNA og sekvens-bekrefter antall uavhengige innsetting posisjoner i bassenget.
    19. Sentrifuger 25 mL av denne kulturen for 3 min ved 1 000 x g. Beregn antall totalt OD600 enheter av celler som er i 25 ml (se eksempel beregning nedenfor). Kast supernatanten og resuspend i nok H2O for å skape en celle suspensjon av 1,85 OD600/ml av virvlingen.
      Merk: eksempel beregning for blanding av celler i vann hvis OD600 av kombinerte kulturen var 2,2:
      Equation 2
      Så, etter spinning 25 mL cellekultur og kaste supernatanten, tilsett nok H2o til cellene for å få det totale volumet av celler og vann opp til ~ 29,7 ml (siden cellen pellet vil også ha et volum, tilsett mindre enn 29,7 ml av H2o).
    20. Ved hjelp av glassperler, plate 1 mL av resuspendert celler i vann på hver av 12 store kvadrat komplett syntetiske agar plater med 5-FOA. Ruge hver tallerken ved 28 ° c i 1-2 dager eller til en plen dannes på tallerkenen.
    21. Ved hjelp av små sterile sugenal, skrape cellene av hver av 6 plater og inn i et rør med 35 mL sterilt vann. Gjenta med de andre 6 platene for totalt to rør av celler og vann. Kombiner alle celle suspensjoner i et enkelt rør. Mål OD600 av denne suspensjonen, med vann som en blank. Bring OD600/ml konsentrasjon av celler til 44,4 OD600 enheter/ml med vann. I vår erfaring, transponering effektivitet (andelen av kan + celler som er URA-) er i gjennomsnitt 50%.
    22. Bestem antall-80 ° c fryser bestander av celler å lagre. Hver alikvot kan brukes i fremtiden for et enkelt eksperiment.
      Merk: Hvis tidkrevende generering av bassenget er gitt, bør du lagre flere hetteglass i tilfelle utilsiktet misbruk eller for å utføre replikere eksperimenter. 20-30 aksjer er et rimelig antall.
    23. Hver fryser lager vil inneholde 40 OD600 enheter av celler i 1 ml 10% DMSO. Tilsett 900 μL av celler til 100 μL av DMSO. Gjenta for det totale antallet fryselager som er opprettet. Oppbevares på-80 ° c for fremtidig bruk.

3. valg av gjensidige hemizygotes i et gruppert format

  1. Tin fra-80 ° c fryseren en enkelt alikvot av sammenslåtte gjensidige hemizygotes fra del 2 ved romtemperatur.
    Merk: ikke la alikvot sitte lenge ved romtemperatur når den tiner, bruk den umiddelbart.
  2. Bruk hele 1 mL alikvot til å vaksinere 150 mL flytende YPD i en 250 mL glass kolbe. Mål OD600 av denne kulturen, og deretter ruge ved 28 ° c, risting ved 200 RPM, for ~ 7 timer, eller til kulturen har gått gjennom 2-3 befolkningen doublings. På dette punktet, er kulturen klar til å brukes til å vaksinere kulturer gjennomgår utvalg.
    Merk: eksempel beregning: Hvis OD600 måler 0,25 i det opprinnelige kolbe, ruge kulturen til den når en OD600 på minst 1,0. Hvis noen prøvepunkter er ønsket på "time-Zero" (T-0), som en måte å undersøke hemizygote befolkning før valg, celle pellets kan tas nå av sentrifugering 5-10 mL kultur per pellet ved 1 000 x g for 3 min, kaste supernatanten og frysing ved-80 ° c.
  3. Bruk det dyrkede hemizygote bassenget til å vaksinere kulturer for valg i en passende replikere ordning, ved både høy temperatur (39 ° c) og ettergivende temperatur (28 ° c). På et minimum, satt opp tre biologiske replikere utvalg kulturer ved hver temperatur, for totalt seks utvalg kulturer.
    1. Lag hver utvalg kultur med 500 mL totalt i en 2 L glass kolbe med flytende YPD og vaksinere til en OD600 av 0,02. Rist hvert utvalg kultur ved 100 RPM ved enten 28 ° c eller 39 ° c til 6-7 befolkning doublings har oppstått (tilsvarende en OD600 av ~ 1.28-2.56). Prøv å matche så tett som mulig den endelige OD600 av alle utvalg kulturer.
      Merk: utvalgs kulturer ved 28 ° c vil vokse raskere enn utvalgs kulturer ved 39 ° c. Følgelig vil utvalgs kulturer ved 39 ° c bruke en lengre periode i inkubator. Fortsett med følgende trinn med hver kolbe som det blir klar, uavhengig av det totale antall timer tilbrakt i inkubator. I vår erfaring, kulturer ved 28 ° c eller 39 ° c tok henholdsvis ~ 12 eller ~ 18 timer, for å nå en OD på ~ 2,0. Lange valg kunne ha nytte av forsterke små fitness effekter, men også tillate de Novo bakgrunnen mutasjoner å oppstå, noe som vil innføre støy i den endelige fordelingen av fitnesses over Transposon mutanter i ett gen/allel. Som sådan er det viktig å begrense valg tiden i et RH-SEQ-eksperiment.
  4. Høste celle pellets fra hvert utvalg kultur. Beregn volumet som kreves for å få 7 OD600 enheter av celler og sentrifuger på 1 000 x g for 3 min minst fire pellets av dette volumet fra hvert utvalg kultur som tekniske replikerer for biblioteket forberedelse og sekvensering (se pkt. 4 og 5 , nedenfor). Kast supernatanten og oppbevar ved-80 ° c.
    Merk: eksempel hvis et utvalg kolbe har en siste OD600 av 2,0:
    Equation 3

4. TN-SEQ bibliotek konstruksjon og Illumina sekvensering å bestemme overflod av Transposon mutant hemizygotes

  1. Tin på isen hver celle pellet fra § 3 som kommer til å være sekvensert.
  2. Isoler total genomisk DNA (gDNA) fra hver celle pellet ved hjelp av en gjær gDNA rensing kit følge produsentens instruksjoner. Resuspend DNA-et i 50, μL av eluering buffer varmet til 65 ° c.
  3. Kvantifisere mengden av gDNA fra hver pellet ved hjelp av en fluorimeter. Det minste totale antallet gDNA som kreves for hver celle pellet for å opprette et neste generasjons sekvensering (NGS)-bibliotek for TN-SEQ ved hjelp av følgende fremgangsmåte, er 1 μg.
    Merk: mindre enn 1 μg av gDNA kan brukes til å lage et bibliotek, men den endelige mengden og kvaliteten på biblioteket vil lide.
  4. Følg en etablert protokoll for å lage TN-SEQ bibliotekene7. Legg merke til følgende relevant informasjon som er unik for denne protokollen:
    1. Etter gDNA klipping, Avslutt reparasjon og adapter ligation, forsterke gDNA inneholder Transposon via PCR. For den PCR, bruker du følgende fremover og omvendt primer, som er spesifikke for PiggyBac Transposon og NGS-adaptere, henholdsvis:
      Forover (N – tilfeldig nukleotid)
      5 ' ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
      CTCTTCCGATCTNNNNNNAGCAATATTTCAAGAATGCATGCGTCAAT 3 '
      Reverse (strekningen av NS representerer en unik 6-BP indeks som brukes for multipleksing. Se nedenfor for mer informasjon om indekser)
      5 ' CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAG
      ACGTGTGCTCTTCCGATCT 3 '
    2. Bruk den med følgende opprydding trinnene med størrelse-selektiv perler å minimere andelen av klonet fragmenter i det endelige biblioteket som ville være for kort til å inkludere som kan tilordnes genomisk sekvens.
      Merk: etter å ha fulgt minimum replikere krav frem til nå for utvalg kulturer, vil det være 24 individuelle gDNA prøver for sekvensering. Gitt gjeldende kostnad for sekvensering, er det usannsynlig at hver prøve vil bli kjørt på egen hånd. Hvis du vil kombinere prøver på samme kjørefelt, oppretter du flere omvendte primere, hver med en unik 6-base-par-indeks. Prøver med ulike indekser kan kombineres til samme sekvensering Lane og separert beregningsmessig etterpå.
  5. Sekvens single-end 150 BP leser fra hvert bibliotek ved hjelp av NGS teknologier på tvers av åtte baner.
    Merk: mengden sekvensering leser som kreves avhenger sterkt av kvaliteten på bibliotekene utarbeidet i forrige trinn (dvs. andelen av DNA i biblioteket faktisk inneholder Transposon DNA, som representerer DNA som kommer fra gjensidige hemizygotes). Det er to viktigste faktorene som bidrar til dette. For det første, siden celler uten en integrert Transposon ikke er counterselected mot under opprettelse av basseng, vil hver kultur være en blanding av celler med og uten Transposon. For det andre, selv innenfor genomer av Transposon-inneholder gjensidige hemizygotes, de fleste av Genova er ikke Transposon inneholder sekvens, og dette gDNA vil uunngåelig være en del av biblioteket forberedelse. Målet med den endelige PCR forsterkning av Transposon DNA er å øke forholdet mellom Transposon som inneholder DNA til disse to kildene til bakgrunn gDNA. Jo mer effektiv denne forsterkningen er, jo høyere andel av leser vil kunne brukes i nedstrøms analyse. Den lavere kvalitet bibliotekene er, jo mer sekvensering må gjøres, siden en økende andel av leser vil ikke inneholde Transposon DNA og vil ikke være nyttig. Gitt de ovennevnte begrensningene, åtte kjørefelt av sekvensering var i stand til å spore gjensidige hemizygote forekomster til en rimelig grad. Flere sekvensering ville tillate en dypere analyse.

5. kartlegging av plasseringen av Transposon innsettinger og RH-SEQ analyse

Merk: følgende dataanalyse ble oppnådd med tilpassede Python-skript (finnes på Internett på https://github.com/weiss19/rh-seq), men kan gjøres om ved hjelp av andre skriptspråk. Nedenfor er de viktigste trinnene i prosessen skissert. Utfør følgende trinn på hver enkelt replikere lese filen med mindre det er nevnt å kombinere dem.

  1. Trim adapter sekvenser av av leser og skille ut hver replikere ' s leser i henhold til indeksen.
  2. Finn leser inneholder Transposon-Genova veikryss. For å oppnå dette, søk i hver lese for de siste 20 base parene av Transposon, CAGACTATCTTTCTAGGGTTAA. Forkast alle leser som ikke inneholder denne sekvensen.
    Merk: i vår erfaring, andelen leser kartlegging til slutten av Transposon er 83-95%.
  3. Trim de resterende, Transposon leser til å inneholde bare sekvensen nedstrøms av 3 ' slutten av Transposon. Ved å kartlegge denne sekvensen til gjær Genova, bestemme genomisk konteksten av Transposon innsetting for hver lese (trinn 5,4 nedenfor).
  4. Bruk BLAT eller et tilsvarende tilordnings verktøy til å tilordne sekvensen nedstrøms for Transposon til s. cerevisiae DBVPG1373 x s. paradoxus Z1 hybrid-Genova (Skriptnavn: map_and_pool_BLAT. py).
    1. Forkaste eventuelle lyder som det er færre enn 50 base parene av brukbar sekvens nedstrøms av 3 ' enden av Transposon. Korte sekvenser er vanskelig å kartlegge unikt.
    2. Hvis du bruker BLAT, bruker du følgende parametere: Identity = 95, flis størrelse = 12.
    3. Opprette en grunnleggende hybrid-Genova som skal brukes til tilordning ved å lenke sammen de nyeste versjonene av referanse-genomer av S. cerevisiae S288c og S. paradoxus CBS432.
      Merk: en grunnleggende merknad fil som beskriver genomisk grensene for individuelle gener over hybrid Genova kan bli funnet på GitHub depotet nevnt ovenfor (filnavn: YS2 + CBS432 + plasmid_clean). Bare bruk leser hvilke kart å en enkelt plasseringen inne det blanding Genova (i.e. er enestående å enten den ene eller den andre av S. cerevisiae eller S. paradoxus). En ensartet hyppigheten av innsetting hendelser på tvers av Genova er forventet; fordelingen av innsettings posisjoner på tvers av genomer rapporteres andre steder3.
  5. Tally det totale antall leser kartlegging til hver unike Transposon innsetting sted, som vi antyde alle stammer fra celler av en enkelt Transposon innsetting mutant klone. Summen av alle slike verdier fra ett enkelt bibliotek kalles det totale antallet tilordnede leser for det biblioteket.
  6. I tilfeller der det er flere innsettinger tilordning innen 3 base par av hverandre, kombinere dem alle til et enkelt innsettingspunkt, tilordne alle leser til den enkle plasseringen med høyest lese telling. Denne verdien, nINSERT, representerer overflod av at innsetting klone i cellen pellet som gDNA ble sekvensert. På dette punktet vil det være lister over nINSERT, hver overflod av en unik kartlagt Transposon innsetting, en liste for hver celle pellet sekvensielt.
    Merk: PiggyBac Transposon setter inn på TTAA sekvenser i Genova, en 4 base pair sekvens. Således, vi antyde at innsettinger kartlegging innen 3 base parene av hverandre må ha sin opprinnelse fra samme TTAA området.
  7. Siden det vil være et litt annet antall totalt leser kommer fra hvert sekvensielt bibliotek, normalisere nINSERT verdier på tvers av alle filer hvis de skal sammenlignes. Gjør det ved tabulerer totalt antall kartlagt leser fra hvert enkelt bibliotek, npellet, og ta gjennomsnittet av alle npellet på tvers av alle biblioteker, < npellet>. Multipliser hver nSett inn i et individ bibliotek data ved forholdet mellom < npellet>/npellet å beregne eninnsats, normalisert overflod av en gitt Transposon innsetting klone.
    Equation 4
    Alternativt kan bibliotek størrelsen anslås ved hjelp av tilgjengelige verktøy som DESeq28 (script navn: total_reads_and_normalize. py).
  8. Tabulere angir at alle innsettinger er kartlagt på tvers av alle biblioteker. For innsettinger som finnes i noen biblioteker, men ikke i andre, angir du enINSERT = 1 for nedstrøms beregninger.
  9. Filtrer leser for å finne de innsettinger som faller innenfor gener i henhold til merknads filen (script navn: remove_NC_and_plasmid_inserts. py).
  10. For hver unike innsetting beregner du gjennomsnittlig overflod på tvers av de tekniske replikerer for hvert utvalg (hver kultur ved enten 28 ° c eller 39 ° c), < etSett inn>teknisk (Skriptnavn: combine_tech_reps_V2. py).
  11. For hver unike innsetting, Beregn gjennomsnittlig overflod på tvers av biologiske replikerer av hver temperatur, < eninnsats>totalt, ved å ta gjennomsnittet av alle < eninnsats>teknisk ved hver temperatur. På samme tid, beregne koeffisient av variasjon for hver innsetting, CVINSERT, total over < enINSERT>Technical (script navn: combine_bio_reps. py).
    Merk: på dette punktet, for hver temperatur, 28 ° c og 39 ° c, er det en liste over unike Transposon innsettinger, deres gjennomsnittlige overflod og variasjonskoeffisienten mellom biologiske replikerer for hver. Disse dataene for eksperimentet er rapportert andre steder3.
  12. Filtrer listen over alle innsettinger for de som har, på enten 28 ° c eller 39 ° c, < eninnsats>totalt > 1,1, og CVINSERT,Total ≤ 1,5 (script navn: filter_inserts. py).
  13. For hver unike innsetting beregner du loggen2(< eninnsettingTotal, 28 ° c /< aTTt >Total, 39 ° c). Denne verdien representerer "thermotolerance" av en gitt Transposon innsetting mutant klone (script navn: fitness_ratios. py).
  14. Sorter alle de unike innsettinger av genet og ved allel (s. cerevisiae eller s. paradoxus), og tabulere antall innsettinger i hver allel. Filtrer gener slik at bare gener som har minst 5 innsettinger i hver allel er analysert (script navn: organize_and_filter_genes. py).
    Merk: flere unike innsettinger over hver allel tillate en mer nøyaktig mål på at gjensidige hemizygote ' s thermotolerance. Senke antall innsettinger kreves per allel er mulig, men vil kompromittere nøyaktigheten av dette tiltaket og øke flere tester byrden ved å tillate flere gener som skal testes. I tillegg filtrerer ut gener med for få innsettinger per allel vil bidra til å redusere effekten på testresultatene av individuelle hemizygote klone harboring en sekundær site mutasjon som gir en svært ulike fenotype.
  15. For hvert gen som gjenstår i datasettet etter filtreringen ovenfor, sammenligner du thermotolerances (Logg2 forholdstall) av alle innsettinger i s. cerevisiae allel til de i s. paradoxus allel ved hjelp av en mann-Whitney U test. Alternativt kan en regresjon modell implementeres, tilpasset fra DESeq28 (script navn: mann_whitney_u. py).
  16. Korriger p-verdier for flere tester ved hjelp av Benjamini-Hochberg-metoden.
  17. Gener med signifikante p-verdier (si, ≤ 0,01) er kandidater til gener som er viktige for forskjeller i thermotolerance mellom de to artene.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi paret s. cerevisiae og s. paradoxus å danne en steril hybrid, som vi utsatt for Transposon mutagenese. Hver mutagenized klone var en hemizygote, en diploid hybrid der en allel av ett gen blir forstyrret (figur 1a, figur 2). Vi konkurrerte med hemizygotes mot hverandre ved vekst ved 39 ° c og i et eget eksperiment som kontroll, ved 28 ° c (figur 1B), og vi isolerte DNA fra hver kultur. For å rapportere egnethet for hver hemizygote vi kvantifisert overflod via bulk sekvensering, ved hjelp av en protokoll der DNA var fragmentert og ligaturer til adaptere, etterfulgt av forsterkning av Transposon innsetting posisjoner (figur 1C). Hvis primere for denne forsterkningen er forskjellig fra, og mindre effektiv enn de som er angitt i protokollen, bakgrunn leser vil dominere i sekvensering data, fører til færre brukbare leser og eroding nøyaktigheten av egnethet anslag. Lignende kvalitet problemer kan skyldes lav DNA input inn i sekvensering biblioteket forberedelse.

Med resultater i hånd fra vår sekvensering, for et gitt gen vi sammenlignet hemizygote forekomster ved de to temperaturene mellom to klasser av hemizygotes: kloner der bare S. cerevisiae allel var vill-type og funksjonell, og kloner stole bare på S. paradoxus allel (figur 1d). I analysen på dette stadiet, hvis beregningsorientert etterbehandling strategien av protokollen ikke er fulgt og gener med relativt få Transposon mutanter i bassenget er inkludert i analysen, statistisk kraft vil falle og ingen vesentlige genet samtaler vil resultere. I implementeringen vår, oppdaget vi sterkt signal ved åtte housekeeping gener (Figur 3). I hvert tilfelle, Transposon innsettinger i S. cerevisiae allel i hybrid kompromittert vekst ved høy temperatur (Figur 3). Disse Loci representerte kandidat faktorer for thermotolerance egenskap som skiller s. cerevisiae fra s. paradoxus. I separate eksperimenter rapportert andre steder, validerte vi virkningen av allel variasjon på hvert sted ved hjelp av standard transgenesis metoder utover omfanget av den nåværende protokollen3.

Figure 1
Figur 1. Skjematisk av arbeidsflyten RH-SEQ.
A. S. cerevisiae og S. paradoxus (henholdsvis blå og gul), er paret for å danne en hybrid (grønn) som inneholder en enkelt kopi av hver av foreldrenes genomer. På et gitt knutepunkt i hybrid, en Transposon innsetting (svart boks) i hver art ' allel i sin tur skaper en hemizygote, som er diploid på resten av Genova bortsett fra det geometriske stedet av interesse. Sammenligning av fenotyper på tvers av hemizygotes avslører den fenotypiske effekten av allel variasjon ved manipulert geometrisk. B. over mange kloner hemizygous på et gitt gen (YFG), noen nå høyere overflod enn andre i konkurranse kultur, som kvantifisert av sekvensering. C. DNA fra et hemizygote basseng er skåret og ligaturer til adaptere (rød). For en gitt klone, krysset mellom Transposon (TN, svart) og Genova (blå) forsterkes med en Transposon-spesifikk primer (svart pil spiss) og en adapter-spesifikk primer (rød pil spiss). Sekvensering lese teller fra amplicon rapporten egnethet av klone i befolkningen. D. for en RH-SEQ genet rammet, tabulerer andelen hemizygote kloner (y-aksen) viser en gitt egnethet etter konkurranse ved høy temperatur (x-aksen) avslører en slående forskjell mellom to genotypisk klasser: de med en Transposon innsetting i s. cerevisiae allel (med s. paradoxus allel gjenstår, gul) og de med s. Paradoxus allel forstyrret (og S. cerevisiae allel gjenstår; blå). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2. Valgordning for å generere en pool av Genova-brede gjensidige hemizygotes med PiggyBac plasmider-borne Transposon.
Den PiggyBac plasmider (pJR487) er forvandlet til en URA3-/- klone av diploid hybrid S. cerevisiae DBVPG1373 x S. paradoxus Z1 (JR507). Tilstedeværelsen av plasmider eller Transposon er valgt for via vekst i G418, som velger for tilstedeværelsen av KanMX kassetten; overlevende er celler som har tatt opp PiggyBac plasmider og/eller havn en integrert Transposon. Celler uten sistnevnte er valgt mot via vekst i 5-FOA, som er giftig i nærvær av URA3 kassetten. Siden transformert hybrid er URA3-/-, de eneste cellene som vil dø i dette trinnet er de som fortsatt inneholder PiggyBac plasmider, som inneholder en URA3 kassett. Det som gjenstår er en pool av hybrid mutant celler som inneholder Transposon integrert i Genova. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3. Top hits kartlagt av RH-SEQ.
Hvert panel rapporterer RH-SEQ data for det indikerte genet fra RH-SEQ. X-aksen rapporterer loggen2 av overflod av en Transposon mutant klone etter valg ved 39 ° c, i forhold til det analoge antallet ved 28 ° c. Y-aksen rapporterer andelen av alle kloner peiling innsettinger i angitt allel som viste overflod ratio på x, som en kjerne tetthet estimat. Underliggende lese-og telle data for innsettinger rapporteres andre steder3. Vennligst klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Fordelene med RH-SEQ over tidligere statistiske-genetiske metoder er flere ganger. I motsetning til koblings-og tilknytnings analyse, gir RH-SEQ en løsning for kartlegging av enkelt genet; som sådan, vil det trolig være av betydelig nytte selv i studier av personlighetstrekk variasjon på tvers av individer av en gitt Art, så vel som interspesifikk forskjeller. Også tidligere forsøk på Genova-Wide gjensidige hemizygosity analyse brukt samlinger av gen sletting mutanter, hvorav noen Harbor sekundære mutasjoner som kan føre til falske positive resultater9,10. Det RH-SEQ strategi sidesteps denne utsendelse av utvikler og bestemmelse av fenotype mange hemizygote mutanter inne hver Gene etter tur, slik det bakgrunnen av alle individ mutant Klon bidrar bare marginalt å det final resultere. I prinsippet RH-SEQ også gir studiet av Noncoding Loci, men i dagens arbeid fokuserte vi utelukkende på gener.

Der er et par quirks å RH-SEQ, noe biological og noe teknisk, det en heldig praktiserende ville beskjeftige seg med opp forside å maksimere hjelpemidlet av fremgangsmåten og akselerere forbindelsesveien å best resultater. Biologisk, RH-SEQ bare er fornuftig som en teknikk hvis de to mål arter kan være paret å danne en stabil, levedyktig hybrid som kan være genetisk manipulert. Således vi kan ikke forestille seg anvender RH-SEQ å Art så avvikende det de ikke oppnå sikringen i en karotypisk stabile diploid. På den annen side, hvis de to foreldrene til diploid hybrid er for like på DNA-nivå, de fleste leser fra Transposon innsetting sekvensering kan ikke tilordnes allel-spesielt til bare ett av de to overordnede genomer og vil være ubrukelig; Således, en gitt RH-SEQ eksperiment ville være høyst heldig når foreldrene ha høy-kvalitet henvisning genomer anvendelig og finne en "søt flekk" av orden forskjellene. Som separat punkt av betraktning, gitt en RH-SEQ prosjekt formulerte å analysere det genetisk basis av en personlighetstrekk differansen imellom det foreldre Art, resultater er sikkert å bli meget mere interpretable når, for det personlighetstrekk av interesse, det Biology av det blanding behandler idet en rimelig representant for foreldrenes. Extreme fenotyper unik for hybrid (krysnings effekt) kan påvirke eller skjule virkningene av gener av interesse underliggende fenotype som det skiller mellom foreldrene. Eventuelle gener kartlagt gjennom gjensidig hemizygosity analyse må valideres av uavhengige allel-swap eksperimenter i genetisk bakgrunn av purebred overordnede arter.

Som for tekniske problemer i et RH-SEQ eksperiment, har vår erfaring fremhevet flere potensielle kilder til støy og gitt gjennomførbar løsninger. Støy manifesterer som uenighet blant sekvensering-baserte estimater av egnethet av hemizygotes harboring Transposon innsettinger i en gitt allel av et gitt gen. Dette kan utledes fra ulike sekundære mutasjoner i bakgrunnen av Transposon mutanter (se nedenfor); variasjon i effektiviteten av PCR forsterke ulike innsetting nettsteder; lav representasjon av en gitt mutant i bulk pool, som fører til lav sekvensering dekning som svekker presisjon; og forskjeller i plasseringen av Transposon innsetting i genet (for eksempel, Transposons innsetting på en 3 ' gen enden kan ha minimal fenotypiske effekt). Av alle disse grunner anser vi det som kritisk for å generere svært store Transposon mutant bassenger og, i den endelige analysen, å utelukke fra å teste et gen uten et rimelig antall mutanter i hver av de to alleler. Vi registrerer at selv om vi ikke har implementert det her, kan et Barcoded Transposon system7 ytterligere bidra til å løse problemer med PCR-bias og redusere kostnadene og arbeidskraften til et RH-SEQ-eksperiment.

Avslutningsvis har vi etablert en grei arbeidsflyt for RH-SEQ, og har spesifisert begrensninger i tilnærmingen. Vi finner at sistnevnte ikke signifikant kompromiss nytten av RH-SEQ; Vi mener at det har store løftet om høyoppløselige, Disseksjon av fenotypiske konsekvenser av genetisk variasjon, inkludert forskjeller mellom arter som har blitt reproductively isolert i millioner av år.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker J. Roop, R. Hackley, I. Grigoriev, A. Arkin og J. Skerker for deres bidrag til den opprinnelige studien, F. AlZaben, A. Flury, G. Geiselman, J. Hong, J. Kim, M. Maurer, og L. Oltrogge for teknisk assistanse, D. Savage for sin generøsitet med mikroskopi ressurser, og B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson og A. Sasikumar for diskusjoner; Vi takker også J. Dueber (Department of bioteknologi, UC Berkeley) for PiggyBac plasmider. Denne arbeide var understøttet av R01 GM120430-a1 og av fellesskapet sekvensering prosjekt 1460 å RBB for det U.S. avdeling av energi skjøt Genova off, en DOE kontor av vitenskap bruker Letter. Arbeidet utført av sistnevnte ble støttet av Office of Science av US Department of Energy under kontrakt nr. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics