Genetisk kartläggning av Termotolerans skillnader mellan arter av Saccharomyces jäst via Genomomfattande ömsesidig Hemizygosity analys

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ömsesidig hemizygosity via sekvensering (RH-SEQ) är en kraftfull ny metod för att kartlägga den genetiska grunden för en drag skillnad mellan arter. Pooler av hemizygotes genereras av transposon mutagenes och deras lämplighet spåras genom konkurrenskraftig tillväxt med hög-hela sekvensering. Analys av resulterande data pekar på gener bakom drag.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ett centralt mål för modern genetik är att förstå hur och varför organismer i naturen skiljer sig i fenotyp. Hittills har fältet avancerat till stor del på styrkan i kopplingen och Association kartläggnings metoder, som spårar sambandet mellan DNA-sekvens varianter och fenotyp över rekombinant avkomma från parningar mellan individer av en art. Dessa metoder, även om kraftfulla, är inte väl lämpade för drag skillnader mellan reproducerbara isolerade arter. Här beskriver vi en ny metod för genomomfattande dissektion av naturlig drag variation som lätt kan appliceras på oförenliga arter. Vår strategi, RH-SEQ, är ett genombrett genomförande av det ömsesidiga hemizygotetestet. Vi utnyttjade det för att identifiera de gener som ansvarar för den slående hög temperatur tillväxt av jästen Saccharomyces cerevisiae i förhållande till dess syster arter S. paradoxus. RH-SEQ utnyttjar transposon mutagenes att skapa en pool av ömsesidiga hemizygotes, som sedan spåras genom en hög temperatur konkurrens via hög kapacitet sekvensering. Vår RH-SEQ arbetsflöde som anges här ger en rigorös, opartisk sätt att dissekera gamla, komplexa drag i spirande jäst klad, med förbehållet att resurskrävande djupsekvensering behövs för att säkerställa genomisk täckning för genetisk kartläggning. Eftersom sekvenserings kostnaderna sjunker, har denna metod ett stort löfte för framtida användning över eukaryotes.

Introduction

Sedan gryningen av fältet, har det varit ett huvudmål i genetik att förstå mekanistiska grunden för variation över vilda individer. När vi karta loci underliggande ett drag av intresse, kan de framväxande gener vara till omedelbar användning som mål för diagnostik och droger, och kan belysa principerna om evolution. Branschstandarden för detta ändamål är att testa för ett förhållande mellan genotyp och fenotyp över en population via länkning eller Association1. Kraftfull eftersom dessa metoder är, de har en nyckel begränsning-de förlitar sig på stora paneler av rekombinant avkomma från korsningar mellan interfertil individer. De är inte till någon nytta i studiet av arter som inte kan para sig för att bilda avkomman i första hand. Som sådan har fältet haft liten kapacitet för opartisk dissektion av drag skillnader mellan reproducerbara isolerade arter2.

I detta arbete rapporterar vi den tekniska underbyggnaden av en ny metod, RH-SEQ3, för genomskalningsundersökningar av den genetiska grunden för karaktärsvariationen mellan arter. Detta tillvägagångssätt är en massivt parallell version av det ömsesidiga hemizygotetestet4,5, somförst utformades som ett sätt att utvärdera fenotypiska effekter av alleliska skillnader mellan två genetiskt distinkta bakgrunder på en särskilda Locus (figur 1a). I detta system, de två skilda individer är först parat att bilda en hybrid, hälften av vars arvsmassa kommer från var och en av de respektive föräldrarna. I den här bakgrunden genereras flera stammar, som var och en innehåller en avbruten eller borttagen kopia av varje förälders allel av Locus. Dessa stammar är hemizygot eftersom de förblir diploida överallt i arvsmassan utom vid Locus av intresse, där de anses vara haploid, och kallas ömsesidiga eftersom var och en saknar endast en förälders allel, med dess återstående allel härrör från andra föräldern. Genom att jämföra fenotyper av dessa ömsesidiga hemizygote stammar, kan man dra slutsatsen om DNA-sekvens varianter på manipulerade Locus bidra till drag av intresse, eftersom varianter på Locus är den enda genetiska skillnaden mellan den ömsesidiga hemizygote stammar. På detta sätt är det möjligt att länka genetiska skillnader mellan arter till en fenotypisk skillnad mellan dem i en välkontrollerad experimentell inställning. Hittills har ansökningarna av detta test varit i en kandidat-gen ram-det vill, fall där hypotesen redan är i handen att naturliga variation på en kandidat Locus kan påverka ett drag.

I det följande, vi lägger ut protokollet för en genomskala ömsesidig hemizygosity skärm, med hjälp av jäst som modellsystem. Vår metod skapar ett genomiskt komplement av hemizygote mutanter, genom att generera livskraftiga, sterila F1 hybrider mellan arter och utsätta dem för transposon mutagenes. Vi poolar hemizygoterna, mäta deras fenotyper i sekvenserings-baserade analyser, och testa för skillnader i frekvens mellan kloner av poolen som bär de två föräldrarnas alleler av en given gen. Resultatet är en katalog av loci där varianter mellan arter påverka karaktärsdrag av intresse. Vi genomför RH-SEQ arbetsflöde för att belysa den genetiska grunden för termotolerans skillnader mellan två spirande jäst arter, Saccharomyces cerevisiae och S. paradoxus, som divergerat ~ 5 000 000 år sedan6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. beredning av piggyBac-innehållande plasmid för omvandling

  1. Streck ut till enstaka kolonier E. coli -stammen hyser plasmid pJR487 på en LB + carbenicillin-agarplatta. Inkubera i 1 natt vid 37 ° c eller tills enstaka kolonier dyker upp.
    Anmärkning: en beskrivning av hur plasmid pJR487 klonas kan hittas i vårt tidigare arbete3.
  2. Inokulera 1 L LB + carbenicillin på 100 μg/mL med en enda koloni av E. coli som innehåller pJR487 i en 2 L glaskolv. Växa över natten vid 37 ° c med skakning vid 200 rpm tills den är mättad (OD600 ≥ 1,0).
  3. Rena plasmid DNA från kulturen med hjälp av en storskalig plasmid prep kit enligt instruktionerna i tillverkarens publicerade protokoll (se tabell över material för detaljer). Eluera DNA efter 10 minuters inkubation med 5 mL elueringbuffert som värms till 37 ° c.
  4. Mät kvantiteten och kvaliteten på plasmid-DNA med en spektrofotometer (se tabell över material för detaljer).
  5. Upprepa steg 1,2 – 1,4 tills totalt minst 11 mg plasmid-DNA vid en A260: en280 förhållandet på minst 1,8 är isolerade. Detta kan ta några Preps, beroende på effektivitet.
  6. Blanda alla plasmid Preps tillsammans i ett enda rör och föra den totala volymen upp till 20 mL med elutionsbuffert eller vatten. Mät den slutliga kvantiteten och kvaliteten igen med en spektrofotometer. Koncentrationen av plasmid bör vara minst 538 ng/μL i denna slutliga 20 mL-volym. Om koncentrationen är högre än 538 ng/μL, späd plasmiden med elutionsbuffert eller vatten till 538 ng/μL. Plasmid kan förvaras vid 4 ° c upp till några veckor fram till användning.

2. skapa en pool av oriktade genomhela ömsesidiga hemizygoter

  1. Beredning av hybrid jästceller för omvandling
    1. Streck ut JR507 från a-80 ° c fryslager stam till enstaka kolonier på en YPD agar tallrik. Inkubera vid 26 ° c i 2 dagar eller tills kolonierna dyker upp.
      Anmärkning: JR507 är en hybrid stam som görs genom Single-cell parning av haploida sporer av S. cerevisiae DBVPG1373 och S. paradoxus Z1 (med hjälp av en tetrad-dissektion Mikroskop)3.
    2. Inokulera 100 mL flytande YPD i en 250 mL glas flaska med en enda koloni av JR507 och skaka vid 28 ° c, 200 rpm i 24 timmar, eller tills stationär fas är nådd.
    3. Nästa dag, Mät den optiska densiteten vid 600 Nm (OD600) av natten kulturen. Skapa en ny kultur av back-diluting några av natten kulturen med färsk flytande YPD i en ny 1 L glas flaska till en OD600 av 0,2 och en volym av 500 ml.
      Anmärkning: exempel på beräkning av en back-utspädning om natten kulturen har en OD600 av 5,0, där C är optisk densitet och V är volym:
      Equation 1
      Sålunda, 20 mL av mättade natten kultur skulle läggas till 480 mL flytande YPD att göra totalt 500 mL kultur vid en OD600 av 0,2.
    4. Upprepa steg 2.1.3 tre gånger för att göra totalt 4 500 mL kulturer vid en OD600 av 0,2 i fyra 1 L glasflaskor, med samma övernattning kultur för alla fyra nya kulturer. Inkubera dem alla vid 28 ° c i 6 timmar (2-3 generationer) skaka vid 200 rpm.
    5. Kombinera två av de 500 mL kulturer för att skapa en 1 L kultur. Kombinera de återstående 2 500 mL kulturer för att skapa ytterligare 1 L kultur. Vid denna punkt, det finns två 1 L kulturer. Var och en av dessa 1 L kulturer kommer att bli föremål för omvandling med pJR487 i följande steg.
  2. Omvandling av pJR487 till hybrid jästceller
    1. Dela upp var och en av de 1 L kulturer i 70 mL alikvoter i 20 plast koniska rör för totalt 40 rör. Avsätta 20 rör och utför följande steg på 20 rör i taget.
    2. Centrifugera var och en av de tjugo rören i 3 min vid 1 000 x g till pellets jästceller. Kassera supernatanten.
    3. Omsuspendera varje pellet med 25 mL sterilt H2O genom vortexing. Centrifugera i 3 min vid 1 000 x g. Kassera supernatanten.
    4. Omsuspendera varje pellet med 5 mL 1x TE, 0,1 M LiOAc buffert genom vortexing. Centrifugera i 3 min vid 1 000 x g. Kassera supernatanten.
    5. Upprepa steg 2.2.4. Medan cellerna centrifugeras, Förbered minst 120 mL av en lösning av 39,52% polyetylenglykol, 0,12 M LiOAc och 1,2 x Tris-EDTA buffert (12 mM Tris-HCl och 1,2 mM EDTA). Förvara på isen.
    6. För att förbereda plasmid DNA för omvandling, först koka 4 mL lax sperma DNA vid 100 ° c för 5 min och omedelbart kyla den på is för 5 min. Blanda sedan 20 mL pJR487 (erhålls i avsnitt 1) med en koncentration på 538 ng/μL med 4 mL kylt laxspermie-DNA för en total volym på 24 mL. Håll på is tills användning.
    7. Tillsätt 600 μL plasmid-DNA blandat med laxspermie-DNA ovanpå varje cellpellet. Omsuspendera inte ännu.
    8. Tillsätt 3 mL PEG-LiOAc-TE lösning som gjorts i steg 2.2.5 till varje pellet. Omsuspendera pelleten genom att Pipettera upp och ner och vortexing.
    9. Inkubera varje tub i 10 minuter vid rumstemperatur.
    10. Värme chock varje rör i 26 min i ett vattenbad inställd på 39 ° c.
      Obs: var några minuter, vänd varje rör för att förhindra att cellerna sedimentera på botten av röret.
    11. Centrifugera varje tub i 3 min vid 1 000 x g. Kassera supernatanten och Omsuspendera varje pellet i 10 mL YPD genom vortexing. Kombinera alla tjugo tuber i en ny glaskolv. Den totala volymen av celler bör vara ~ 200 mL.
    12. Överför 66,6 mL av cellerna till en ny 1 L glas flaska och ta upp till en volym av 500 mL med flytande YPD. Upprepa ytterligare två gånger för att använda hela 200 mL transformerade celler. Mät OD600 för varje ny 500 ml kultur (räkna med en OD600 av ~ 0,35-4).
    13. Skaka alla tre kolvar vid 28 ° c i 2 timmar för att återhämta sig (< 1 generation) vid 200 rpm.
    14. Tillsätt 0,5 mL 300 mg/mL G418 till var och en av de tre kolvar, till en slutlig koncentration av 300 μg/mL G418 och sätt tillbaka för att skaka vid 28 ° c, 200 rpm.
      ANMÄRKNINGAR: före det här steget har omvandlade hybridceller återhämtat sig från omvandling. Vid tillägg av G418, förekomst av plasmid pJR487 väljs för. Alla celler som inte tar upp plasmiden under omvandlingen kommer att börja dö.
    15. Upprepa steg 2.2.2 – 2.2.14 med de resterande 20 koniska rören av celler. På denna punkt bör det finnas sex 1 L glasflaskor, vardera med 500 mL celler med G418 till.
    16. Inkubera alla sex flaskor celler vid 28 ° c, skaka vid 200 rpm, i cirka 2 dagar eller tills en OD600 av ~ 2,3 uppnås i varje kolv. Kombinera alla sex kolvar tillsammans för att skapa en enda kultur.
      Observera: även om alla celler i den här kulturen inte kommer att användas i efterföljande steg, har målet att använda sådana stora volymer varit att skapa så många unika transformationshändelser som möjligt och normalisera eventuella avvikelser över en enda omvandling genom att samla dem alla Tillsammans.
    17. Använd kulturen som skapats i 2.2.16 att Inokulera två nya 1 L kolvar med 500 mL YPD + G418 (300 μg/mL) till en OD600 av 0,2. Det kommer att finnas överblivna kultur som kan kasseras.
    18. Inkubera båda 1 L kolvar vid 28 ° c över natten, med skakning vid 200 rpm, tills varje når en OD600 av ~ 2,2 (~ 3,5 generationer). Kombinera båda kulturerna i en enda kultur och mät den kombinerade kulturens OD600 igen.
      Obs: vid denna punkt, bör kulturen nästan helt består av celler härbärga plasmid pJR487. I en del av populationen av celler, den PiggyBac transposon kommer att ha införlivats från plasmiden i genomet av transposase uttryckt utanför Plasmiden. Ett fortsatt uttryck för transposase kan dock leda till införlivande under ett urval, vilket skulle dölja sambandet mellan genotyp och fenotyp. Målet för de nästa flera stegen är att utföra ett motval mot närvaron av plasmid, för att säkerställa att det inte finns något mer uttryck för transposase. Den resulterande poolen är en blandning av celler med eller utan transposon integreras i genomet, men endast celler som innehåller transposon upptäcks under efterföljande kartläggnings steg. Tiden i omvandlingen under vilken transposase uttrycks, innan plasmid kodning förloras, kan styra risken att en viss klon efter mutesis hamnar mer än en transposon insättning. Frekvensen av dessa, som manifesteras som "sekundära" mutationer i analys av någon gen i taget, kan uppskattas genom att försköna ett definierat antal kolonier efter mutagenes, sedan kombinera deras DNA och sekvens-bekräftar antalet oberoende insättning positioner i poolen.
    19. Centrifugera 25 mL av denna kultur i 3 min vid 1 000 x g. Beräkna antalet totalt OD600 enheter av celler som är i 25 ml (se exempel beräkning nedan). Kassera supernatanten och Omsuspendera i tillräckligt H2O för att skapa en cellsuspension av 1,85 OD600/ml genom vortexing.
      Anmärkning: exempel beräkning för resuspension av celler i vatten om OD600 av kombinerad kultur var 2,2:
      Equation 2
      Så, efter spinning 25 mL cellkultur och kasta supernatanten, tillsätt tillräckligt med H2o till cellerna för att få den totala volymen av celler och vatten upp till ~ 29,7 ml (eftersom cellpelleten kommer också att ha en volym, tillsätt mindre än 29,7 ml av H2o).
    20. Med hjälp av glaspärlor, tallrik 1 mL återsuspenderade celler i vatten på vardera av 12 stora kvadratiska kompletta syntetiska agar plattor med 5-FOA. Inkubera varje platta vid 28 ° c i 1-2 dagar eller tills en gräsmatta bildas på plattan.
    21. Använd små sterila raklar, skrapa bort cellerna från var och en av 6 plattor och in i ett rör med 35 mL sterilt vatten. Upprepa med de andra 6 plattorna för totalt två rör av celler och vatten. Kombinera alla cellsuspensioner i ett enda rör. Mät OD600 för denna suspension med hjälp av vatten som blank. Ta OD600/ml koncentrationen av celler till 44,4 OD600 enheter/ml med vatten. Enligt vår erfarenhet är införlivandet effektivitet (andelen KAN + celler som är URA-) i genomsnitt 50%.
    22. Bestäm antalet-80 ° c fryslager av celler att lagra. Varje alikvot kan användas i framtiden för ett enda experiment.
      Obs: med tanke på hur tidskrävande generering av poolen är, lagra flera flaskor i händelse av oavsiktlig missbruk eller för att utföra replikat experiment. 20-30 bestånd är ett rimligt antal.
    23. Varje fryslager kommer att innehålla 40 OD600 enheter av celler i 1 ml 10% DMSO. Tillsätt 900 μL av cellerna till 100 μL av DMSO. Upprepa för det totala antalet fryslager som skapats. Förvara varje vid-80 ° c för framtida bruk.

3. Val av ömsesidiga hemizygoter i ett poolat format

  1. Tina från-80 ° c frys en enda alikvot av sammanslagna reciproka hemizygoter från avsnitt 2 vid rumstemperatur.
    Obs: Låt inte alikvot sitta länge i rumstemperatur när det är Tina, använda den omedelbart.
  2. Använd hela 1 mL alikvot för att Inokulera 150 mL flytande YPD i en 250 mL glas flaska. Mät OD600 av denna kultur, och sedan Inkubera vid 28 ° c, skaka vid 200 rpm, för ~ 7 timmar, eller tills kulturen har gått igenom 2-3 befolknings dubbleringar. Vid denna punkt, kulturen är redo att användas för att Inokulera kulturer som genomgår urval.
    Anmärkning: exempel på beräkning: om den ursprungliga kolven600 mäter 0,25, inkubera kulturen tills den når en OD600 på minst 1,0. Om några provpunkter önskas vid "Time-Zero" (T-0), som ett sätt att undersöka hemizygote befolkningen före valet, kan cell pellets tas nu genom centrifugering 5-10 mL kultur per pellet på 1 000 x g för 3 min, kasta supernatanten och frysning vid-80 ° c.
  3. Använd den odlade hemizygote pool att Inokulera kulturer för val i en lämplig replikat schema, vid både hög temperatur (39 ° c) och tillåtande temperatur (28 ° c). Vid ett minimum, ställa in tre biologiska replikat urvals kulturer vid varje temperatur, för totalt sex urvals kulturer.
    1. Skapa varje urvals kultur med 500 mL totalt i en 2 L glaskolv med flytande YPD och Inokulera till en OD600 av 0,02. Skaka varje urvals kultur vid 100 rpm vid antingen 28 ° c eller 39 ° c till 6-7 befolknings dubbleringar har inträffat (motsvarande en OD600 av ~ 1,28-2,56). Försök att matcha så nära som möjligt den slutliga OD600 av alla urvals kulturer.
      Obs: urvals kulturer vid 28 ° c kommer att växa snabbare än urvals kulturer vid 39 ° c. Följaktligen kommer urvals kulturer vid 39 ° c att tillbringa en längre tid i inkubatorn. Fortsätt med följande steg med varje kolv som den blir klar, oavsett det totala antalet timmar som tillbringas i inkubatorn. Enligt vår erfarenhet, kulturer vid 28 ° c eller 39 ° c tog ~ 12 eller ~ 18 timmar, respektive, för att nå en OD på ~ 2,0. Långa val kan ha fördelen av att förstärka små konditionen verkställer, men också tillstånd de Novo bakgrunds mutationer att uppstå, som skulle introducerar stojar in i Final fördelningen av fitnesses över transposon mutanter i någon en gen/allele. Som sådan är det viktigt att begränsa urvalstiden i ett RH-SEQ-experiment.
  4. Skörd cell pellets från varje urvals kultur. Beräkna den volym som krävs för att erhålla 7 OD600 enheter av celler och centrifugera vid 1 000 x g i 3 min minst fyra pelletar av denna volym från varje urvals kultur som tekniska replikat för förberedelse av bibliotek och sekvensering (se avsnitt 4 och 5 , nedan). Kassera supernatanten och förvara vid-80 ° c.
    Anmärkning: exempel om en valkolv har en slutlig OD600 på 2,0:
    Equation 3

4. TN-SEQ bibliotek konstruktion och Illumina sekvensering att bestämma överflöd av transposon Mutant hemizygotes

  1. Tina på is varje cell pellet från avsnitt 3 som kommer att vara sekvenserade.
  2. Isolera totalt genomiskt DNA (gDNA) från varje cellpellet med hjälp av en jäst gDNA renings sats enligt tillverkarens anvisningar. Omsuspendera DNA i 50 μL elueringbuffert som värms till 65 ° c.
  3. Kvantifiera mängden gDNA från varje pellet med hjälp av en Fluorimeter. Den minsta totala mängden gDNA som krävs för varje cellpellet skapa ett nästa generations sekvenserings bibliotek (NGS) för TN-SEQ med hjälp av följande procedur är 1 μg.
    Obs: mindre än 1 μg gDNA kan användas för att skapa ett bibliotek, men det slutliga antalet och kvaliteten på biblioteket kommer att lida.
  4. Följ ett etablerat protokoll för att skapa TN-SEQ-bibliotek7. Observera följande relevanta information som är unik för detta protokoll:
    1. Efter gDNA klippning, reparation och adapter ligering, förstärka gDNA som innehåller transposon via PCR. För att PCR, Använd följande framåt och omvänd primer, som är specifika för PiggyBac transposon och NGS adaptrar, respektive:
      Framåt (N – slumpmässig nukleotid)
      5 ' ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
      CTCTTCCGATCTNNNNNNAGCAATATTTCAAGAATGCATGCGTCAAT 3 '
      Omvänd (sträckan av ns representerar ett unikt 6-BP-index som används för multiplexering. Se nedan för mer information om index)
      5 ' CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAG
      ACGTGTGCTCTTCCGATCT 3 '
    2. Använd de inkluderade rensnings stegen med storleks selektiva pärlor för att minimera andelen klonade fragment i det slutliga biblioteket som skulle vara för kort för att inkludera mappbar genomisk sekvens.
      Anmärkning: efter att ha följt de minsta replikernas krav fram till nu för urvals kulturer, kommer det att finnas 24 enskilda gDNA-prover för sekvensering. Med tanke på den aktuella kostnaden för sekvensering, är det osannolikt att varje prov kommer att köras på egen hand. Om du vill kombinera exempel på samma körfält skapar du flera omvända primers, var och en med ett unikt par index på 6 bas. Tar prov med olika index kan kombineras in i den samma sekvenseringen körfält och avskilt beräkningsmässigt därefter.
  5. Sekvens enda 150 BP läser från varje bibliotek med NGS Technologies över åtta körfält.
    Obs: mängden sekvensering läsningar som krävs beror mycket på kvaliteten på de bibliotek som utarbetats i föregående steg (dvs. andelen DNA i biblioteket faktiskt innehåller transposon DNA, som representerar DNA som kommer från ömsesidiga hemizygoter). Det finns två huvudfaktorer som bidrar till detta. Först, eftersom celler utan en integrerad transposon inte är kontraselected mot under skapandet av poolen, varje kultur kommer att vara en blandning av celler med och utan transposon. För det andra, även inom genomet av transposon som innehåller ömsesidiga hemizygoter, de flesta av genomet är inte transposon innehåller sekvens, och detta gDNA kommer oundvikligen att vara en del av biblioteket förberedelse. Målet med den slutliga PCR-amplifieringen av transposon-innehållande DNA är att öka kvoten av transposon-innehållande DNA till dessa två källor av bakgrund gDNA. Ju effektivare denna förstärkning är, desto större andel av läsningar kommer att kunna användas i nedströms analys. Ju lägre kvalitet biblioteken är, desto mer sekvensering kommer att behöva göras, eftersom en ökande andel av läsningar inte kommer att innehålla transposon DNA och kommer inte att vara till nytta. Med tanke på ovanstående begränsningar, åtta körfält sekvensering kunde spåra ömsesidiga hemizygote överflöd till en rimlig grad. Mer sekvensering skulle möjliggöra en djupare analys.

5. kartlägga platserna för transposon infogningar och RH-SEQ analys

Anmärkning: följande dataanalys utfördes med anpassade Python-skript (finns online på https://github.com/weiss19/rh-seq), men kan vara redone med andra skriptspråk. Nedan beskrivs de viktigaste stegen i processen. Utför följande steg på varje enskild replikerar Läs fil om det inte noteras att kombinera dem.

  1. Trimma adaptersekvenser av läsningar och separera varje repliks läsningar enligt index.
  2. Hitta läsningar som innehåller transposon-Genome korsningar. För att åstadkomma detta, Sök inom varje läsa för de senaste 20 bas par av transposon, CAGACTATCTTTCTAGGGTTAA. Ignorera alla läsningar som inte innehåller den här sekvensen.
    Notera: enligt vår erfarenhet, andelen läsningar kartläggning till slutet av transposon är 83-95%.
  3. Trimma de resterande, transposon-innehållande läser för att innehålla endast ordna nedströms av 3 ' en avslutar av transposonen. Genom att kartlägga denna sekvens till jästgenomet, bestämma genomiskt sammanhang av transposon insättning för varje läsning (steg 5,4 nedan).
  4. Använd BLAT eller ett likvärdigt kartläggningsverktyg för att kartlägga sekvensen nedströms transposon till S. cerevisiae DBVPG1373 x S. paradoxus Z1 hybrid arvsmassa (script namn: map_and_pool_BLAT. py).
    1. Kassera alla läsningar för vilka det finns färre än 50 bas par av användbar sekvens nedströms 3 ' slutet av transposon. Korta sekvenser är svåra att kartlägga unikt.
    2. Använd följande parametrar om du använder BLAT: Identity = 95, kakel storlek = 12.
    3. Skapa en grundläggande hybrid arvsmassa att använda för mappning genom att sammanfoga de senaste versionerna av referens genom S. cerevisiae S288c och S. paradoxus CBS432.
      Anmärkning: en grundläggande anteckningsfil som beskriver genomiska gränser för enskilda gener över hybrid genomet finns på GitHub-lagringsplatsen ovan (filnamn: YS2 + CBS432 + plasmid_clean). Använd endast läsningar som mappas till en enda plats i hybridgenomet (d.v.s. är unika för antingen S. cerevisiae eller S. paradoxus). En enhetlig frekvens av insättnings händelser över genomet förväntas. fördelningen av insättnings positioner över genomerna rapporteras på annan plats3.
  5. Tally det totala antalet läsningar mappning till varje unik transposon insättnings plats, som vi dra slutsatsen alla härstammar från celler av en enda transposon insättning Mutant klon. Summan av alla sådana värden från ett enda bibliotek kallas det totala antalet mappade läsningar för biblioteket.
  6. I de fall där det finns flera infogningar mappning inom 3 bas par av varandra, kombinera dem alla till en enda insättningspunkt, tilldela alla läsningar till den enda platsen med den högsta Läs antal. Detta värde, ninsert, representerar överflödet av den införingsklon i cellpelleten från vilken gDNA sekvenserades. Vid denna punkt kommer det att finnas listor över nInfoga, var överflödet av en unik kartlagd transposon insättning, en lista för varje cell pellet sekvenserade.
    Obs: den PiggyBac transposon infogar på TTAA sekvenser i genomet, en 4 bas par sekvens. Sålunda, vi dra slutsatsen att infogningar kartläggning inom 3 bas par av varandra måste ha sitt ursprung från samma TTAA webbplats.
  7. Eftersom det kommer att finnas ett något annorlunda antal totala läsningar som kommer från varje sekvenserade bibliotek, normalisera nInfoga värden över alla filer om de ska jämföras. Gör det genom att TABULERA det totala antalet mappade läsningar från varje enskilt bibliotek, npellet, och ta genomsnittet av alla npellets över alla bibliotek, < npellets>. Multiplicera varje nInfoga i ett enskilt biblioteks data med förhållandet mellan < npellets>/npellets för att beräkna eninsats, det normaliserade överflöd av en given transposon insättning klon.
    Equation 4
    Alternativt kan biblioteks storlek uppskattas med hjälp av tillgängliga verktyg som DESeq28 (script namn: total_reads_and_normalize. py).
  8. TABULERA uppsättningen med alla infogningar mappade över alla bibliotek. För infogningar som finns i vissa bibliotek men inte i andra, ange eninsert = 1 för nedströms beräkningar.
  9. Filtrera läsningar för att hitta de infogningar som faller inom gener enligt anteckningsfilen (script namn: remove_NC_and_plasmid_inserts. py).
  10. För varje unik infogning beräknar du det genomsnittliga överflödet över tekniska replikat för varje markering (varje kultur vid 28 ° c eller 39 ° c) < ettskär>tekniskt (Skriptnamn: combine_tech_reps_V2. py).
  11. Beräkna det genomsnittliga överflödet över biologiska replikat för varje temperatur, < eninsats>totalt, genom att ta medelvärdet för alla < eninsats>teknisk vid varje temperatur. Samtidigt, beräkna koefficienten variation för varje insättning, CVInfoga, totalt över < enInfoga>tekniska (script namn: combine_bio_reps. py).
    Anmärkning: vid denna punkt, för varje temperatur, 28 ° c och 39 ° c, det finns en lista över unika transposon infogningar, deras genomsnittliga överflöd och koefficienten variation mellan biologiska replikat för varje. Dessa data för vårt experiment rapporteras någon annanstans3.
  12. Filtrera listan över alla införanden för dem som har, vid antingen 28 ° c eller 39 ° c, < eninsats>totalt > 1,1 och CV-insats,totalt ≤ 1,5 (script namn: filter_inserts. py).
  13. För varje unik insättning, beräkna loggen2(< ainsertTotal, 28 ° c /< ainsert >Total, 39 ° c). Detta värde representerar "termotolerans" för en given transposon insättning Mutant klon (script namn: fitness_ratios. py).
  14. Sortera alla de unika införanden av Gene och allel (s. cerevisiae eller s. paradoxus), och TABULERA antalet införanden i varje allel. Filtrera gener så att endast gener som har minst 5 infogningar i varje allel analyseras (script namn: organize_and_filter_genes. py).
    Obs: flera unika infogningar över varje allel möjliggöra en mer exakt mått på den ömsesidiga hemizygote s termotolerans. Att sänka antalet införanden som krävs per allel är möjligt, men kommer att äventyra noggrannheten i denna åtgärd och öka den multipla test bördan genom att tillåta att fler gener testas. Dessutom, filtrering ut gener med alltför få införanden per allel kommer att bidra till att minska påverkan på testresultaten av varje enskild hemizygote klon härbärgerar en sekundär plats mutation som ger en mycket olika fenotyp.
  15. För varje gen kvar i datauppsättningen efter ovanstående filtrering, jämföra termotoleranser (log2 nyckeltal) av alla införanden i s. cerevisiae allel till dem i s. paradoxus allel med hjälp av en Mann-Whitney U test. Alternativt kan en regressionsmodell implementeras, anpassad från DESeq28 (Skriptnamn: mann_whitney_u. py).
  16. Korrekta p-värden för flera tester med hjälp av benjamini-Hochberg-metoden.
  17. Gener med signifikanta p-värden (säg, ≤ 0,01) är kandidater till gener som är viktiga för skillnader i termotolerans mellan de två arterna.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi parat s. cerevisiae och s. paradoxus att bilda en steril hybrid, som vi utsätts för transposon mutagenes. Varje mutageniserad klon var en hemizygot, en diploida hybrid där en allel av en gen störs (figur 1a, figur 2). Vi tävlade hemizygoterna mot varandra genom tillväxt vid 39 ° c och, i ett separat experiment som kontroll, vid 28 ° c (figur 1b), och vi isolerade DNA från varje kultur. För att rapportera lämpligheten av varje hemizygote vi kvantifierade överflöd via bulk sekvensering, med hjälp av ett protokoll där DNA var fragmenterad och och ligaturer till adaptrar, följt av förstärkning av transposon insättnings positioner (figur 1c). Om primers för denna förstärkning skiljer sig från, och mindre effektiva än, de som anges i protokollet, bakgrunds läsningar kommer att dominera i sekvenserings data, vilket leder till färre användbara läsningar och urholkning riktigheten av fitness uppskattningar. Liknande kvalitetsproblem kan bero på låg DNA-inmatning i sekvenserings biblioteket.

Med resultat i handen från vår sekvensering, för en given gen jämförde vi hemizygoteöverflöd vid de två temperaturerna mellan två klasser av hemizygoter: kloner där endast S. cerevisiae allel var vildtyp och funktionella, och kloner som endast förlitar sig på S. paradoxus allel (figur 1d). I analysen i detta skede, om den beräknande efter behandling strategi av protokollet inte följs och gener med relativt få transposon mutanter i poolen ingår i analysen, statistiska makt kommer att sjunka och inga betydande gen anrop kommer att resultera. I vår implementering upptäckte vi en stark signal på åtta städ gener (figur 3). I varje fall transposon infogningar i S. cerevisiae allel i hybrid äventyras tillväxten vid hög temperatur (figur 3). Dessa loci representerade kandidat determinanter av termotolerans drag som skiljer s. cerevisiae från s. paradoxus. I separata experiment rapporterade någon annanstans, validerat vi effekterna av alleliska variation på varje plats med hjälp av vanliga transgenetik metoder utanför tillämpningsområdet för det nuvarande protokollet3.

Figure 1
Figur 1. Schematiskt för RH-SEQ-arbetsflödet.
A. s. cerevisiae och s. paradoxus (blått respektive gult) är parat med att bilda en hybrid (grön) som innehåller en enda kopia av var och en av föräldrarnas genomer. Vid en given Locus i hybriden, en transposon insättning (svart låda) i varje art allel i sin tur skapar en hemizygot, som är diploida i resten av arvsmassan utom för Locus av intresse. Jämföra fenotyper över hemizygoter avslöjar fenotypiska effekterna av alleliska variation på den manipulerade Locus. B. över många kloner hemizygot vid en given gen (yfg), vissa når högre överflöd än andra i konkurrenskraftig kultur, som kvantifieras genom sekvensering. C. DNA från en hemizygote pool är klippt och och ligaturer till adaptrar (röd). För en given klon, korsningen mellan transposon (TN, svart) och arvsmassan (blå) förstärks med en transposon-specifik primer (svart pilspets) och en adapter-specifik primer (röd pilspets). Sekvensering läsa räknas från den amplikon rapporten lämplighet klon i befolkningen. D. för en träff med RH-SEQ-genen, tabell över andelen hemizygote kloner (y-axel) uppvisar en given kondition efter konkurrens vid hög temperatur (x-axeln) avslöjar en slående skillnad mellan två genotypisk klasser: de med en transposon införande i s. cerevisiae allel (med s. paradoxus allel kvar; gult) och de med s. paradoxus allel störd (och s. cerevisiae allel kvar; blå). Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2. Urvalssystem för att generera en pool av genomomfattande ömsesidiga hemizygoter med PiggyBac plasmid-Borne transposon.
Den piggybac plasmid (pJR487) omvandlas till en URA3-/- klon av diploida hybrid S. cerevisiae DBVPG1373 x S. paradoxus Z1 (JR507). Närvaroen av Plasmiden eller transposonen är utvald för via tillväxt i G418, som väljer för närvaroen av den KanMX kassetten; överlevande är celler som har tagit upp PiggyBac plasmid och/eller hamn en integrerad transposon. Celler utan de senare väljs mot via tillväxt i 5-FOA, vilket är giftigt i närvaro av URA3 kassetten. Eftersom den otransformerade Hybrid är URA3-/-, de enda celler som kommer att dö i detta steg är de som fortfarande innehåller piggybac plasmid, som innehåller en URA3 kassett. Det som återstår är en pool av hybrid Mutant celler som innehåller transposon integreras i genomet. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3. Top Hits kartlagda av RH-SEQ.
Varje panel rapporterar RH-SEQ-data för den indikerade genen från RH-SEQ. X-axeln rapporterar logg2 av överflöd av en transposon Mutant klon efter val vid 39 ° c, i förhållande till den analoga kvantiteten vid 28 ° c. Y-axeln rapporterar den andel av alla kloner som har infogningar i den angivna allelen som uppvisade överflöd förhållandet på x, som en kernel densitet uppskattning. Underliggande läsa och räkna data för infogningar rapporteras någon annanstans3. Vänligen klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Fördelarna med RH-SEQ jämfört med tidigare statistiska genetiska metoder är flera gånger. Till skillnad från kopplings-och associationsanalys ger RH-SEQ en lösning för enkel gen mappning. som sådan, det kommer sannolikt att vara av betydande nytta även i studier av drag variation mellan individer av en viss art, samt mellanartskonkurrens skillnader. Även tidigare försök till genomomfattande ömsesidig hemizygosity analys används samlingar av gendeletion mutanter, varav några Harbor sekundära mutationer som kan leda till falskt positiva resultat9,10. RH-SEQ-strategin undviker denna fråga genom att generera och fenotypning många hemizygote mutanter i varje gen i sin tur, så att bakgrunden av varje enskild Mutant klon bidrar endast marginellt till slutresultatet. I princip ger RH-SEQ också studiet av icke-kodande loci, men i det nuvarande arbetet fokuserade vi uteslutande på gener.

Det finns några quirks att RH-SEQ, vissa biologiska och några tekniska, att en framgångsrik utövare kommer att ta itu med på framsidan för att maximera nyttan av metoden och påskynda vägen till bästa resultat. Biologiskt, RH-SEQ är bara vettigt som en teknik om de två målarterna kan parat att bilda en stabil, livskraftig hybrid som kan vara genetiskt manipuleras. Således kan vi inte föreställa tillämpa RH-SEQ till arter så olika att de misslyckas med att smälta in i en karyotypiskt stabil diploid. Å andra sidan, om de två föräldrarna till diploida Hybrid är alltför lika på DNA-nivå, de flesta läsningar från transposon insättning sekvensering kan inte mappas allele-specifikt till bara en av de två överordnade genom och kommer att vara obrukbar; Sålunda, en givit RH-SEQ experiment vilja bli mest framgångsrik när föräldern har hög-kvalitet hänvisningen genom tillgänglig och slå till en "söt fläck" av ordningsföljd divergensen. Som en separat punkt i övervägande, med tanke på en RH-SEQ projekt formuleras för att dissekera den genetiska grunden för en egenskap skillnad mellan de överordnade arterna, resultaten kommer sannolikt att vara mycket mer tolkningsbara när, för drag av intresse, biologi hybrid fungerar som en rimlig representant för föräldrarnas. Extrema fenotyper som är unika för hybriden (Heterosis) kan påverka eller dölja effekterna av gener av intresse som underliggande fenotypen eftersom det skiljer sig mellan föräldrarna. Alla gener kartlagda genom ömsesidig hemizygosity analys måste valideras av oberoende allele-swap experiment i den genetiska bakgrunder av renrasiga föräldra arter.

När det gäller tekniska frågor i ett RH-SEQ-experiment har vår erfarenhet belyst flera potentiella källor till buller och tillhandahållit genomförbara lösningar. Buller manifesterar som oenighet mellan sekvensering-baserade uppskattningar av lämplighet för hemizygotes hartråkigt transposon infogningar i en given allel av en given gen. Detta kan bero på olika sekundära mutationer i bakgrunden av transposon mutanter (se nedan); variationer i effektiviteten hos PCR-amplifierande olika insättnings ställen; låg representation av en given Mutant i bulk pool, vilket leder till låg sekvensering täckning som försvagar precision; och skillnader i position av transposon insättning inom genen (t. ex. transposoner som sätter på en 3 ' gen kan ha minimal fenotypisk effekt). Av alla dessa skäl anser vi att det är kritiskt att generera mycket stora transposon Mutant pooler och, i slutändan, att utesluta från att testa någon gen utan ett rimligt antal mutanter i var och en av de två alleler. Vi noterar att även om vi inte har genomfört det här, en Barcoded transposon system7 kan ytterligare bidra till att lösa frågor om PCR bias och skära ner på kostnaden och arbetet med en RH-SEQ experiment.

Sammanfattningsvis har vi etablerat ett enkelt arbetsflöde för RH-SEQ, och har specificerat förbehåll för tillvägagångssättet. Vi anser att det sistnämnda inte i någon större utsträckning äventyrar nyttan med RH-SEQ. Vi anser att det är mycket lovande för högupplöst, genomskalningsdissektion av de fenotypiska konsekvenserna av genetisk variation, inklusive skillnader mellan arter som har varit reproduktivt isolerade i miljontals år.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Vi tackar J. Roop, R. Hackley, I. Grigoriev, A. Arkin och J. skerker för deras bidrag till den ursprungliga studien, F. alzaben, A. FLURY, G. geiselman, j. Hong, j. Kim, M. Maurer och L. oltrogge för tekniskt bistånd, D. Savage för hans generositet med mikroskopi och B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson och A. Sasikumar för diskussioner. Vi tackar också J. Dueber (Institutionen för bioteknik, UC Berkeley) för PiggyBac plasmid. Detta arbete stöddes av R01 GM120430-a1 och av community sekvensering projekt 1460 till RBB vid US Department of energi joint Genome Institute, en DOE Office of Science User Facility. Det arbete som utfördes av den senare stöddes av Office of Science i USA: s energidepartement enligt kontrakt nr. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics