Genetisk kortlægning af termo Toleranceforskelle mellem arter af Saccharomyces gær via Genome-Wide gensidig Hemizygosity analyse

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Gensidig hemizygosity via sekvensering (RH-SEQ) er en kraftfuld ny metode til at kort det genetiske grundlag for en træk forskel mellem arter. Puljer af hemizygotes genereres af gennemførelse af mutagenese og deres egnethed spores via konkurrencedygtig vækst ved hjælp af høj-i hele sekvensering. Analyse af de resulterende data peger på gener underliggende træk.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Et centralt mål for moderne genetik er at forstå, hvordan og hvorfor organismer i naturen er forskellige i fænotype. Til dato, feltet har fremskreden i høj grad på styrken af sammenkædning og forening kortlægning metoder, der sporer forholdet mellem DNA sekvens varianter og fænotype på tværs af rekombinant afkom fra parring mellem individer af en art. Selv om disse tilgange er effektive, er de ikke velegnede til forskelle mellem reproductivt isolerede arter. Her beskriver vi en ny metode til Genome-dækkende dissektion af naturlig træk variation, som let kan anvendes på uforenelige arter. Vores strategi, RH-SEQ, er en Genome-dækkende gennemførelse af den gensidige hemizygote test. Vi udnytter det til at identificere de gener, der er ansvarlige for den slående høje temperatur vækst af gær Saccharomyces cerevisiae i forhold til sine søster arter S. paradoksalt os. RH-SEQ udnytter gennemførelse af mutagenese til at skabe en pulje af gensidige hemizygotes, som derefter spores via en høj temperatur konkurrence via High-gennemløb sekvensering. Vores RH-SEQ workflow som beskrevet her giver en stringent, upartisk måde at dissekere gamle, komplekse træk i den spirende gær clade, med den advarsel, at ressourceintensive dybe sekvensering er nødvendig for at sikre genomisk dækning for genetisk kortlægning. I takt med at udgifterne til sekvensering falder, har denne tilgang store løfter om fremtidig brug på tværs af eukaryoter.

Introduction

Siden begyndelsen af feltet, har det været et førsteklasses mål i genetik til at forstå det mekanistiske grundlag for variation på tværs af vilde individer. Da vi kort loci underliggende en egenskab af interesse, de emergente gener kan være af umiddelbar anvendelse som mål for diagnostik og narkotika, og kan kaste lys over principperne for Evolution. Branchens standard mod dette formål er at teste for en forbindelse mellem genotype og fænotype på tværs af en population via sammenkædning eller Association1. Kraftfulde som disse tilgange er, de har en nøglebegrænsning-de er afhængige af store paneler af rekombinant afkom fra krydsninger mellem interfertile individer. De er ikke til nogen nytte i studiet af arter, der ikke kan parre sig for at danne afkom i første omgang. Som sådan har feltet ikke haft megen kapacitet til objektiv dissektion af træk forskelle mellem reproductivt isolerede arter2.

I dette arbejde rapporterer vi det tekniske funda-up for en ny metode, RH-SEQ3, for genomskala undersøgelser af det genetiske grundlag for træk variation mellem arterne. Denne fremgangsmåde er en massivt parallel version af den gensidige hemizygote test4,5, somførst blev udtænkt som en metode til at evaluere de fænotypiske virkninger af alleliske forskelle mellem to genetisk adskilte baggrunde på en særlige locus (figur 1a). I denne ordning, de to divergerende individer er først parret at danne en hybrid, halvdelen af hvis genom kommer fra hver af de respektive forældre. I denne baggrund genereres der flere stammer, der hver indeholder en afbrudt eller slettet kopi af hver forælders allel af locus. Disse stammer er hemizygous, da de forbliver diploide overalt i genomet undtagen på locus af interesse, hvor de betragtes som haploid, og betegnes som gensidige, da hver mangler kun en forælders allel, med dens resterende allel afledt af anden forælder. Ved at sammenligne fænotyperne af disse gensidige hemizygote stammer, kan man konk ægge, om DNA-sekvens varianter på den manipulerede locus bidrager til den egenskab af interesse, da varianter på locus er den eneste genetiske forskel mellem de gensidige hemizygote stammer. På denne måde er det muligt at knytte genetiske forskelle mellem arterne til en fænotypisk forskel mellem dem i et velkontrolleret forsøgs setup. Til dato er ansøgningerne fra denne test har været i en kandidat-gen ramme-det vil, tilfælde, hvor hypotesen er allerede i hånden, at naturlige variation på en kandidat locus kan påvirke en egenskab.

I det følgende, vi lægger ud protokollen for en genomskala gensidig hemizygosity skærm, ved hjælp af gær som et model system. Vores metode skaber en genomisk supplement af hemizygote mutanter, ved at generere levedygtige, sterile F1 hybrider mellem arter og underkaste dem til gennemførelse af mutagenese. Vi samle hemizygotes, måle deres fænotyper i sekvensering-baserede assays, og test for forskelle i hyppigheden mellem kloner af puljen med de to forældres alleler af et givent gen. Resultatet er et katalog over loci, hvor varianter mellem arter påvirker den egenskab af interesse. Vi gennemfører RH-SEQ workflow for at belyse det genetiske grundlag for termo toleranceforskelle mellem to spirende gærarter, Saccharomyces cerevisiae og S. paradoksalt US, som afveg ~ 5.000.000 år siden6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. fremstilling af det piggyBac-holdige plasmid til omdannelse

  1. Streak ud til enlige kolonier den E. coli stamme husly plasmid pJR487 på en lb + carbenicillin agar plade. Inkuber 1 nat ved 37 °C, eller indtil enkelt kolonier vises.
    Bemærk: en beskrivelse af hvordan plasmid pJR487 blev klonet kan findes i vores tidligere arbejde3.
  2. 1 L af LB + carbenicillin ved 100 μg/mL med en enkelt koloni af E. coli indeholdende pJR487 i en 2 L glas kolbe. Vokse natten over ved 37 °C med omrystning ved 200 rpm indtil mættet (OD600 ≥ 1,0).
  3. Purify plasmid DNA fra kulturen ved hjælp af en storstilet plasmid prep kit som anvist i producentens offentliggjorte protokol (Se tabel over materialer for detaljer). Elute DNA efter en 10 minutters inkubation med 5 mL elueringsbuffer opvarmes til 37 °C.
  4. Måle mængden og kvaliteten af plasmid DNA med et spektrofotometer (Se tabel over materialer for detaljer).
  5. Gentag trin 1,2 – 1,4 indtil i alt mindst 11 mg plasmid-DNA i A260: et280 -forhold på mindst 1,8 er isoleret. Dette kan tage et par Preps, afhængigt af effektiviteten.
  6. Bland alle plasmid Preps sammen i et enkelt rør og Bring den totale volumen op til 20 mL med elueringsbuffer eller vand. Mål den endelige mængde og kvalitet igen med et spektrofotometer. Koncentrationen af plasmid bør være mindst 538 ng/μL i denne sidste 20 mL volumen. Hvis koncentrationen er højere end 538 ng/μL, fortyndes plasmid med elueringsbuffer eller vand til 538 ng/μL. Plasmid kan opbevares ved 4 °C op til et par uger indtil brug.

2. oprettelse af en pulje af umålrettede Genome-Wide gensidige hemizygotes

  1. Fremstilling af hybrid gærceller til omdannelse
    1. Streak out JR507 fra a-80 °C fryselager stamme til enkelt kolonier på en YPD agar plade. Inkuber ved 26 °C i 2 dage, eller indtil kolonierne optræder.
      Bemærk: JR507 er en hybrid stamme lavet gennem en enkelt celle parring af haploide sporer af S. cerevisiae DBVPG1373 og S. paradoksalt US Z1 (ved hjælp af en Tetrad-Dissection mikroskop)3.
    2. 100 mL flydende YPD i en 250 mL glas kolbe med en enkelt koloni JR507 og rystes ved 28 °C, 200 rpm i 24 timer, eller indtil den stationære fase er nået.
    3. Den næste dag, måle den optiske tæthed ved 600 nm (OD600) af natten kultur. Opret en ny kultur ved at tilbage fortynde en del af Kulturnatten med frisk flydende YPD i en ny 1 L glas kolbe til en OD600 af 0,2 og et volumen på 500 ml.
      Bemærk: eksempel beregning af en back-fortynding, hvis natten kultur har en OD600 af 5,0, hvor C er optisk tæthed og V er volumen:
      Equation 1
      20 mL mættet natkultur vil således blive tilsat 480 mL flydende YPD for at kunne lave i alt 500 mL kultur ved en OD600 af 0,2.
    4. Gentag trin 2.1.3 yderligere tre gange for at lave i alt 4 500 mL kulturer ved en OD600 af 0,2 i fire 1 L glaskolber, ved hjælp af samme overnight kultur for alle fire nye kulturer. Inkuber dem alle ved 28 °C i 6 timer (2-3 generationer), som ryster ved 200 rpm.
    5. Kombiner to af de 500 mL kulturer for at skabe en 1 L kultur. Kombiner de resterende 2 500 mL kulturer for at skabe en anden 1 L kultur. På dette tidspunkt er der to 1 L kulturer. Hver af disse 1 L kulturer vil blive genstand for omdannelse med pJR487 i følgende trin.
  2. Omdannelse af pJR487 til hybrid gærceller
    1. Hver af de 1 L kulturer opdeles i 70 mL aliquoter i 20 plastik koniske rør til i alt 40 rør. Sæt 20 rør til side og Udfør følgende trin på 20 rør ad gangen.
    2. Centrifuger hvert af de tyve rør i 3 min ved 1.000 x g for at pille gærcellerne. Kassér supernatanten.
    3. Hver pille opslæmmes med 25 mL steril H2O ved vortexing. Centrifuger i 3 min. ved 1.000 x g. Kassér supernatanten.
    4. Resuspension hver pellet med 5 mL 1x TE, 0,1 M LiOAc buffer ved vortexing. Centrifuger i 3 min. ved 1.000 x g. Kassér supernatanten.
    5. Gentag trin 2.2.4. Mens cellerne centrifugerer, forberedes mindst 120 mL opløsning af 39,52% polyethylenglycol, 0,12 M LiOAc og 1,2 x Tris-EDTA buffer (12 mM Tris-HCl og 1,2 mM EDTA). Opbevares på is.
    6. For at forberede plasmid-DNA til transformation, kog først 4 mL lakse sæddna ved 100 °C i 5 minutter og afkøles straks på is i 5 minutter. Bland derefter 20 mL pJR487 (opnået i punkt 1) i en koncentration på 538 ng/μL med 4 mL afkølet laksæddna for et samlet volumen på 24 mL. Opbevares på is indtil brug.
    7. Tilsæt 600 μL plasmid DNA blandet med laks sperm DNA på toppen af hver celle pellet. Må ikke resuspendere endnu.
    8. Der tilsættes 3 mL PEG-LiOAc-TE-opløsning i trin 2.2.5 til hver pellet. Resuspendere pellet ved pipettering op og ned og vortexing.
    9. Inkuber hvert rør i 10 minutter ved stuetemperatur.
    10. Varmechok hvert rør i 26 min i et vandbad sat til 39 °C.
      Bemærk: hvert par minutter, invertere hvert rør for at forhindre cellerne i at bosætte sig på bunden af røret.
    11. Centrifuger hvert rør i 3 min. ved 1.000 x g. Supernatanten kasseres, og hver pille opslæmmes i 10 mL YPD ved vortexing. Kombiner alle tyve rør i en ny glas kolbe. Den totale mængde af celler bør være ~ 200 mL.
    12. 66,6 mL celler overføres til en ny 1 L glas kolbe, og der fyldes op til et volumen på 500 mL med flydende YPD. Gentag to gange for at bruge hele 200 mL af de transformerede celler. Mål OD600 af hver ny 500 ml kultur (FORVENT en OD600 af ~ 0,35-4).
    13. Ryst alle tre kolber ved 28 °C i 2 timer for at restituere (< 1 generation) ved 200 rpm.
    14. Der tilsættes 0,5 mL 300 mg/mL G418 til hver af de tre kolber, til en endelig koncentration på 300 μg/mL G418 og sættes tilbage til Shake ved 28 °C, 200 rpm.
      Bemærk: forud for dette trin er de transformerede hybridceller blevet genoprettet fra transformation. Ved tilsætning af G418, er tilstedeværelsen af plasmid pJR487 valgt for. Alle celler, der ikke tager op plasmid under omdannelsen vil begynde at dø.
    15. Gentag trin 2.2.2 – 2.2.14 med de resterende 20 koniske rør af celler. På dette tidspunkt skal der være seks 1 L glaskolber, hver med 500 mL celler med G418 tilsat.
    16. Alle seks kolber af celler inkubates ved 28 °C, omrystes med 200 rpm i ca. 2 dage, eller indtil en OD600 på ~ 2,3 nås i hver kolbe. Kombiner alle seks kolber sammen for at skabe en enkelt kultur.
      Bemærk: selv om alle cellerne i denne kultur ikke vil blive brugt i downstream-trin, har målet om at bruge så store mængder været at skabe så mange unikke transformationsbegivenheder som muligt og normalisere alle skævheder over en enkelt transformation ved at samle dem alle Sammen.
    17. Brug kulturen skabt i 2.2.16 til at inokulere to nye 1 L kolber med 500 mL YPD + G418 (300 μg/mL) til en OD600 af 0,2. Der vil være rester kultur, der kan kasseres.
    18. Inkubere begge 1 L kolber ved 28 °C natten over, med omrystning ved 200 rpm, indtil hver når en OD600 på ~ 2,2 (~ 3,5 generationer). Kombiner begge kulturer i en enkelt kultur og måle OD600 af den kombinerede kultur igen.
      Bemærk: på dette tidspunkt, bør kulturen være næsten udelukkende består af celler husly plasmid pJR487. I en del af populationen af celler, vil PiggyBac transponson være blevet omsat fra plasmid til genomet ved transposase udtrykt ud plasmid. Fortsat ekspression af transposase kan imidlertid føre til gennemførelse i løbet af en udvælgelse, hvilket ville sløre forholdet mellem genotype og fænotype. Målet med de næste flere trin er at udføre en modudvælgelse mod tilstedeværelsen af plasmid, for at sikre, at der ikke er mere udtryk for transposase. Den resulterende pulje er en blanding af celler med eller uden gennemførelse integreret i genomet, men kun celler, der indeholder gennemførelse registreres i løbet af de efterfølgende kortlægning trin. Den tid i omdannelsen, hvor transposase udtrykkes, før plasmid kodning er tabt, kan styre chancen for, at en given klon efter mutagenese havne mere end én gennemførelse indsættelse. Hyppigheden af disse, der manifesterer sig som "sekundære" mutationer i analyse af et enkelt gen ad gangen, kan anslås ved at opstiller et defineret antal kolonier efter mutagenese, derefter kombinere deres DNA og sekvens-bekræfter antallet af uafhængige indsættelse Stillinger i puljen.
    19. 25 mL af denne kultur centrifugeres i 3 min. ved 1.000 x g. Beregn antallet af total OD600 enheder af celler, der er i 25 ml (se eksempel beregning nedenfor). Supernatanten kasseres og resuspenderes i nok H2O til at skabe en cellesuspension på 1,85 OD600/ml ved vortexing.
      Bemærk: eksempel beregning for opblanding af celler i vand, hvis OD600 af den kombinerede kultur var 2,2:
      Equation 2
      Så efter spinning 25 mL cellekultur og kassere supernatanten, tilsættes nok H2O til cellerne for at bringe den samlede mængde af celler og vand op til ~ 29,7 ml (da celle pellet også vil have en volumen, tilsæt mindre end 29,7 ml H2O).
    20. Ved hjælp af glasperler, plade 1 mL resuspenderet celler i vand på hver af 12 store firkantede komplette syntetiske agar plader med 5-FOA. Hver plade inkubates ved 28 °C i 1-2 dage, eller indtil der dannes en græsplæne på pladen.
    21. Ved hjælp af små sterile squeegees, skrabe cellerne ud af hver af 6 plader og ind i et rør med 35 mL sterilt vand. Gentag med de andre 6 plader for i alt to rør af celler og vand. Kombiner alle celle suspensioner i et enkelt rør. Mål OD600 af denne suspension, ved hjælp af vand som en blank. Bring OD600/ml koncentrationen af celler til 44,4 OD600 enheder/ml med vand. I vores erfaring, gennemførelse effektivitet (andelen af KAN + celler, der er URA-) er i gennemsnit 50%.
    22. Bestem antallet af-80 °C fryselagre af celler til opbevaring. Hver alikvot kan anvendes i fremtiden til et enkelt eksperiment.
      Bemærk: i betragtning af hvor tidskrævende genereringen af puljen er, Opbevar flere hætteglas i tilfælde af utilsigtet misbrug eller for at udføre replikat eksperimenter. 20-30 bestande er et rimeligt antal.
    23. Hver fryselager vil indeholde 40 OD600 enheder af celler i 1 ml af 10% DMSO. Tilsæt 900 μL af cellerne til 100 μL DMSO. Gentag for det samlede antal oprettede fryselagre. Opbevar hver ved-80 °C til fremtidig brug.

3. udvælgelse af gensidige hemizygotes i et poolet format

  1. Tø fra-80 °C fryser en enkelt alikvot af de samlede gensidige hemizygoter fra afsnit 2 ved stuetemperatur.
    Bemærk: Lad ikke alikvot sidde længe ved stuetemperatur, når det er i brug, med det samme.
  2. Brug hele 1 mL alikvot til at inokulere 150 mL flydende YPD i en 250 mL glas kolbe. Mål OD600 af denne kultur, og derefter inkubere ved 28 °c, ryster ved 200 rpm, for ~ 7 timer, eller indtil kulturen har været igennem 2-3 befolkning doublings. På dette tidspunkt, kulturen er klar til at blive brugt til at inokulere kulturer undergår udvælgelse.
    Bemærk: eksempel beregning: Hvis OD600 af den oprindelige kolbe måler 0,25, inkubatér kulturen, indtil den når en OD600 på mindst 1,0. Hvis nogen prøvepunkter ønskes på "time-Zero" (T-0), som en måde at undersøge hemizygote population før udvælgelse, celle pellets kan tages nu ved at centrifuger 5-10 mL kultur pr pellet ved 1.000 x g for 3 min, kassere supernatanten og Frysning ved-80 °C.
  3. Brug den dyrkede hemizygote pulje til at inokulere kulturer for udvælgelse i en passende replikat ordning, ved både høj temperatur (39 °C) og eftergivende temperatur (28 °C). Som minimum, oprette tre biologiske replikat udvælgelse kulturer ved hver temperatur, for i alt seks udvælgelse kulturer.
    1. Opret hver markerings kultur med 500 mL total i en 2 L glas kolbe med flydende YPD og inokulere til en OD600 af 0,02. Ryst hver markerings kultur ved 100 rpm ved enten 28 °c eller 39 °c, indtil 6-7 populations fordoblinger er forekommet (svarende til en OD600 af ~ 1.28-2.56). Prøv at matche så tæt som muligt den endelige OD600 af alle udvælgelse kulturer.
      Bemærk: markerings kulturer ved 28 °C vil vokse hurtigere end markerings kulturer ved 39 °C. Derfor vil selektions kulturer ved 39 °C tilbringe en længere periode i inkubator. Fortsæt med de følgende trin med hver kolbe, når den bliver klar, uanset det samlede antal timer, der er brugt i inkubator. I vores erfaring, kulturer ved 28 °C eller 39 °C tog ~ 12 eller ~ 18 timer henholdsvis at nå en OD af ~ 2,0. Lange valg kunne have den fordel at forstærke små konditions effekter, men også tillade de Novo baggrunds mutationer at opstå, hvilket ville introducere støj i den endelige fordeling af fitseler på tværs af gennemførelse af mutanter i et hvilket som helst gen/allel. Det er derfor vigtigt at begrænse selektions tiden i et RH-SEQ-eksperiment.
  4. Høst celle pellets fra hver udvælgelse kultur. Beregn den mængde, der kræves for at opnå 7 OD600 enheder af celler og centrifugeres ved 1.000 x g i 3 min. mindst fire pellets af denne mængde fra hver udvælgelses kultur som tekniske replikater til Biblioteks forberedelse og sekvensering (Se afsnit 4 og 5 , nedenfor). Supernatanten kasseres og opbevares ved-80 °C.
    Bemærk: eksempel hvis en markerings kolbe har en endelig OD600 af 2,0:
    Equation 3

4. TN-SEQ Library Construction og Illumina sekventering at bestemme overflod af gennemførelse af mutant hemizygotes

  1. Tø på is hver celle pille fra sektion 3, der skal sorteres.
  2. Isoler totalt genomisk DNA (gDNA) fra hver celle pellet ved hjælp af en gær gDNA rensning kit efter producentens anvisninger. Resuspension af DNA i 50 μL elueringsbuffer opvarmes til 65 °C.
  3. Kvantificere mængden af gDNA fra hver pellet ved hjælp af et fluorimeter. Den mindste samlede mængde gDNA, der kræves for hver celle pellet for at oprette et Next-Generation sekventering Library (NGS) bibliotek for TN-SEQ ved hjælp af følgende procedure er 1 μg.
    Bemærk: mindre end 1 μg gDNA kan bruges til at oprette et bibliotek, men den endelige mængde og kvalitet af biblioteket vil lide.
  4. Følg en etableret protokol til oprettelse af TN-SEQ Libraries7. Bemærk følgende relevante oplysninger, der er entydige for denne protokol:
    1. Efter gDNA klipning, reparation og adapter ligation, amplificere gDNA indeholder gennemførelse via PCR. For denne PCR skal du bruge følgende fremad-og omvendt primer, som er specifikke for henholdsvis PiggyBac-og NGS-adapterne:
      Fremad (N – Random nucleotid)
      5» ATGATACGGCGACCACCOPGAGATCTACACTCTTTCCCTACACGACG
      CTCTTCCGATCTNNNNNNAGCAATATTTCAAGAATGCATGCGTCAAT 3 '
      Omvendt (strækningen af NS repræsenterer et unikt 6-BP-indeks, der bruges til multiplexing. Se nedenfor for yderligere oplysninger om indekser)
      5 ' CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAG
      ACGTGTGCTCTTCCGATCT 3 '
    2. Brug de medfølgende oprydnings trin med størrelsesselektive perler for at minimere andelen af klonede fragmenter i det endelige bibliotek, som ville være for kort til at inkludere omisk sekvens, der kan tilknyttes.
      Bemærk: efter at have fulgt de mindste replikater krav indtil nu for udvælgelse kulturer, vil der være 24 individuelle gDNA prøver til sekvensering. I betragtning af de nuværende omkostninger til sekvensering, er det usandsynligt, at hver prøve vil blive kørt på egen hånd. Hvis du vil kombinere prøver på samme bane, skal du oprette flere omvendte Primers, hver med et unikt 6-basepar-indeks. Prøver med forskellige indekser kan kombineres i den samme sekvensering Lane og adskilles beregningsmæssigt bagefter.
  5. Sekvens single-end 150 BP læser fra hvert bibliotek ved hjælp af NGS-teknologier på tværs af otte baner.
    Bemærk: mængden af sekvens aflæsninger, der kræves, afhænger i høj grad af kvaliteten af bibliotekerne, som er udarbejdet i det foregående trin (dvs. andelen af DNA i biblioteket, der faktisk indeholder gennemført DNA, som repræsenterer DNA fra gensidige hemizygoter). Der er to hovedfaktorer, som bidrager hertil. For det første, da celler uden en integreret gennemførelse ikke er kontra valgt mod under puljen skabelse, vil hver kultur være en blanding af celler med og uden gennemførelsen. For det andet, selv inden for genomer af gennemførelse, der indeholder gensidige hemizygotes, er det meste af genomet ikke gennemførelse, der indeholder sekvens, og denne gDNA vil uundgåeligt være en del af biblioteket forberedelse. Målet med den endelige PCR amplifikation af gennemførelse-holdige DNA er at øge forholdet mellem gennemførelse-holdige DNA til disse to kilder til baggrund gDNA. Jo mere effektiv denne forstærkning er, jo større andel af læsninger vil være i stand til at blive brugt i downstream-analyse. Den lavere kvalitet bibliotekerne er, jo mere sekvensering skal gøres, da en stigende andel af læsninger ikke vil indeholde gennemførelse af DNA og vil ikke være nyttige. I betragtning af ovenstående begrænsninger, otte baner af sekvensering var i stand til at spore gensidige hemizygote overflod i en rimelig grad. Flere sekvensering ville muliggøre en dybere analyse.

5. kortlægning af placeringen af gennemførelser og RH-SEQ-analyse

Bemærk: følgende dataanalyse blev udført med brugerdefinerede python-scripts (findes online på https://github.com/weiss19/rh-seq), men kunne redone ved hjælp af andre scriptsprog. Nedenfor er de vigtigste trin i processen skitseret. Udfør følgende trin på hver enkelt replikat-læse fil, medmindre det er noteret at kombinere dem.

  1. Trim adapter sekvenser ud af læser og adskille hver replikat læser efter indeks.
  2. Find læsninger, der indeholder omskifte-omome-vejkryds. For at opnå dette, Søg inden for hver læst for de sidste 20 base par af gennemførelse, CAGACTATCTTTCTAGGGTTAA. Kassér alle læsninger, der ikke indeholder denne sekvens.
    Bemærk: i vores erfaring, andelen af læsninger kortlægning til slutningen af gennemførelse er 83-95%.
  3. Trim de resterende, gennemfører-holdige læsninger til kun at indeholde sekvensen nedstrøms for den 3 ' ende af gennemførelse søn. Ved at kortlægge denne sekvens til gærgenomet, bestemme den genomiske kontekst af gennemførelse indsættelse for hver læse (trin 5,4 nedenfor).
  4. Brug BLAT eller en tilsvarende mapping værktøj til at kortlægge sekvensen nedstrøms for gennemførelse til S. cerevisiae DBVPG1373 x s. paradoksalt US Z1 hybrid genom (script navn: map_and_pool_BLAT. py).
    1. Kassér alle læsninger, for hvilke der er færre end 50 basis par af brugbar sekvens nedstrøms for 3 ' ende af gennemløbet. Korte sekvenser er svære at kort gøre entydigt.
    2. Hvis du bruger BLAT, skal du bruge følgende parametre: Identity = 95, flise størrelse = 12.
    3. Opret et grundlæggende hybrid genom, der skal bruges til kortlægning, ved at sammenkæde de seneste versioner af reference genomer i S. cerevisiae S288c og S. paradoksalt US CBS432.
      Bemærk: en grundlæggende annoterings fil, der beskriver de genomiske grænser for individuelle gener på tværs af hybrid genomet, kan findes på GitHub-lageret ovenfor (filnavn: YS2 + CBS432 + plasmid_clean). Brug kun læsninger, der er kort til et enkelt sted i hybrid genomet (dvs. er unikke for enten S. cerevisiae eller S. paradoksalt US). Der forventes en ensartet hyppighed af indsættelses hændelser på tværs af genomet. fordelingen af indsætnings positionerne på tværs af genomer rapporteres andetsteds3.
  5. Tal det samlede antal læsninger kortlægning til hver unik gennemførelse indsættelse placering, som vi udleder alle stammer fra celler i en enkelt gennemførelse indsættelse mutant klon. Summen af alle disse værdier fra et enkelt bibliotek kaldes det samlede antal kortlagte læsninger for det pågældende bibliotek.
  6. I tilfælde, hvor der er flere indsættelser kortlægning inden for 3 Base par af hinanden, kombinere dem alle til et enkelt indsætningspunkt, tildele alle de læser til den enkelte placering med det højeste antal læste. Denne værdi, nINSERT, repræsenterer den overflod af den indsatte klon i celle pellet, hvorfra gDNA blev sekvenserede. På dette tidspunkt vil der være lister over nINSERT, hver overflod af en unik kortlagt gennemførelse indsættelse, en liste for hver celle pellet sekvenserede.
    Bemærk: PiggyBac-gennemførelse indsætter på TTAA-sekvenser i Genome, en 4-basepar-sekvens. Således udleder vi, at indsættelser kortlægning inden for 3 Base par af hinanden skal stamme fra den samme TTAA site.
  7. Da der vil være et lidt forskelligt antal samlede læsninger fra hvert sekvenserede bibliotek, skal du normalisere n-indsætnings værdierne på tværs af alle filer, hvis de skal sammenlignes. Gør det ved at tabulere det samlede antal kortlagte læsninger fra hvert enkelt bibliotek, npellet, og tage gennemsnittet af alle npellet på tværs af alle biblioteker, < npellet>. Multiplicere hver nindsætte i et individuelt biblioteksdata med forholdet mellem < npellet>/npellet til at beregne enindsats, den normaliserede overflod af en given gennemførelse indsættelse klon.
    Equation 4
    Alternativt kan Biblioteks størrelsen anslås ved hjælp af tilgængelige værktøjer som DESeq28 (script navn: total_reads_and_normalize. py).
  8. Tabulere sættet af alle indsættelser, der er tilknyttet på tværs af alle biblioteker. For indsættelser, der findes i nogle biblioteker, men ikke i andre, skal du angive enINSERT = 1 for downstream-beregninger.
  9. Filtrer læsninger for at finde de indsættelser, der falder inden for gener i henhold til anmærknings filen (script navn: remove_NC_and_plasmid_inserts. py).
  10. For hver unik indsættelse beregnes den gennemsnitlige overflod på tværs af tekniske replikater af hvert valg (hver kultur ved enten 28 °C eller 39 °C), < enindsats>teknisk (script navn: combine_tech_reps_V2. py).
  11. For hver unik indsættelse beregnes den gennemsnitlige overflod på tværs af biologiske replikater af hver temperatur, < enindsats>Totalved at tage middelværdien af alle < enindsats>teknisk ved hver temperatur. Samtidig beregnes variationskoefficienten for hver indsættelse, CVINSERT, total på tværs af < etskær>teknisk (script navn: combine_bio_reps. py).
    Bemærk: på dette tidspunkt, for hver temperatur, 28 °C og 39 °C, er der en liste over unikke gennemførelser, deres gennemsnits tæthed og variationskoefficienten mellem biologiske replikater for hver. Disse data for vores eksperiment er rapporteret andetsteds3.
  12. Filtrer listen over alle indsættelser for dem, der har, ved enten 28 °C eller 39 °C, < enindsats>Total > 1,1, og CVINSERT,Total ≤ 1,5 (script navn: filter_inserts. py).
  13. For hver unik indsættelse beregnes log2(< enindsats>Total, 28 °c /< enindsættest >i alt, 39 °c). Denne værdi repræsenterer "termo tolerance" af en given gennemførelse indsættelse mutant klon (script navn: fitness_ratios. py).
  14. Sortere alle de unikke indsættelser af genet og af allel (s. cerevisiae eller s. paradoksalt US), og tabulere antallet af indsættelser i hver allel. Filtrer gener, så kun gener, der har mindst 5 indsættelser i hver allel analyseres (script navn: organize_and_filter_genes. py).
    Bemærk: flere unikke indsættelser på tværs af hver allel giver mulighed for en mere præcis måling af den gensidige hemizygote termo tolerance. Det er muligt at sænke antallet af påkrævede indsættelser pr. allel, men det vil kompromittere nøjagtigheden af denne foranstaltning og øge den flere test byrde ved at tillade, at flere gener testes. Derudover vil filtrering ud gener med for få indsættelser per allel bidrage til at reducere virkningen på testresultaterne af enhver individuel hemizygote klon husly en sekundær site mutation, der giver en meget uensartet fænotype.
  15. For hvert gen, der er tilbage i datasættet efter ovenstående filtrering, Sammenlign termo tolerancerne (log2 ratio) med alle indsættelser i s. cerevisiae allelen med dem i s. paradoksalt US allelen ved hjælp af en Mann-Whitney U test. Alternativt kan en regressionsmodel implementeres, tilpasset fra DESeq28 (script navn: mann_whitney_u. py).
  16. Korrekte p-værdier for flere tests ved hjælp af benjamini-Hochberg-metoden.
  17. Gener med signifikante p-værdier (dvs. ≤ 0,01) er kandidater til gener, der er vigtige for forskelle i termo tolerance mellem de to arter.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi parret s. cerevisiae og s. paradoksalt os til at danne en steril hybrid, som vi udsættes for gennemførelse af mutagenese. Hver mutagenicseret klon var en hemizygote, en diploide hybrid, hvor en allel af et gen er forstyrret (figur 1a, figur 2). Vi konkurrerede hemizygotes mod hinanden ved vækst ved 39 °C og, i et separat eksperiment som en kontrol, ved 28 °C (figur 1b), og vi isolerede DNA fra hver kultur. For at rapportere egnethed af hver hemizygote vi kvantificerede overflod via bulk sekvensering, ved hjælp af en protokol, hvor DNA var fragmenteret og ligeret til adaptere, efterfulgt af forstærkning af Transporte indsættelse positioner (figur 1c). Hvis primere til denne forstærkning er forskellig fra, og mindre effektiv end dem, der er fastsat i protokollen, vil baggrunds læsninger dominerer i sekvensering data, hvilket fører til færre brugbare læser og underminerer nøjagtigheden af fitness estimater. Lignende kvalitetsproblemer kan skyldes lavt DNA-input i sekvente Rings bibliotekets forberedelse.

Med resultater i hånden fra vores sekvensering, for et givet gen vi sammenlignede hemizygote rigeligt med de to temperaturer mellem to klasser af hemizygotes: kloner hvor kun S. cerevisiae allel var vild-type og funktionelle, og kloner stole kun på S. paradoksalt US allel (figur 1d). I analysen på dette stadium, hvis den beregningsmæssige efter behandling strategi i protokollen ikke er fulgt, og gener med relativt få gennemførelse mutanter i puljen er inkluderet i analysen, vil den statistiske effekt falde, og ingen betydelige genopkald vil resultere. I vores implementering opdagede vi et stærkt signal ved otte husholdnings gener (figur 3). I hvert tilfælde, gennemførelse indsættelser i S. cerevisiae allel i hybrid kompromitteret vækst ved høj temperatur (figur 3). Disse loci repræsenterede kandidat determinanter for termo tolerance træk, der adskiller s. cerevisiae fra s. paradoksalt US. I separate eksperimenter rapporteret andetsteds, validerede vi virkningen af alleliske variation på hvert sted ved hjælp af standard transgenese metoder uden for rammerne af den nuværende protokol3.

Figure 1
Figur 1. Skematisk af RH-SEQ arbejdsgangen.
A. s. cerevisiae og s. paradoksalt US (henholdsvis blå og gul), er parret at danne en hybrid (grøn), der indeholder en enkelt kopi af hver af forældrenes genomer. På en given locus i hybrid, en Trans port indsættelse (sort boks) i hver art ' allel til gengæld skaber en hemizygote, som er diploide på resten af genomet bortset fra locus af interesse. Sammenligning af fænotyper på tværs af hemizygotes afslører de fænotypiske virkninger af allelisk variation på den manipulerede locus. B. på tværs af mange kloner hemizygous på et givent gen (yfg), nogle nå højere overflod end andre i konkurrencedygtig kultur, som kvantificeret ved sekvensering. C. DNA fra en hemizygote pool er klippet og ligeret til adaptere (rød). For en given klon forstærkes krydset mellem omløbet (TN, sort) og genomet (blå) med en gennemførelse-specifik primer (sort pilespids) og en adapterspecifik primer (rød pilespids). Sekventering læse tæller fra amplikonen rapport klappen egnethed i befolkningen. D. for en RH-SEQ-genet hit, tabulerer andelen af hemizygote kloner (y-aksen) udviser en given kondition efter konkurrence ved høj temperatur (x-aksen) afslører en slående forskel mellem to genotypiske klasser: dem med en gennemførelse indsættelse i s. cerevisiae allel (med s. paradoksalt US allel tilbage, gul) og dem med s. paradoksalt US allel forstyrret (og s. cerevisiae allel resterende; blå). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2. Udvælgelsesordning til generering af en pulje af genomdækkende gensidige hemizygoter med PiggyBac plasmid-båret gennemførelse.
Piggybac plasmid (pJR487) omdannes til en URA3-/- klon af diploide hybrid S. cerevisiae DBVPG1373 x S. paradoksalt US Z1 (JR507). Tilstedeværelsen af plasmid eller gennemførelse er valgt til via vækst i G418, som vælger for tilstedeværelsen af KanMX kassette; overlevende er celler, der har taget op PiggyBac plasmid og/eller havn en integreret gennemførelse. Celler uden sidstnævnte er valgt mod via vækst i 5-FOA, som er giftigt i nærværelse af URA3 kassetten. Da den utransformerede hybrid er URA3-/-, de eneste celler, der vil dø i dette trin er dem, der stadig indeholder piggybac plasmid, som indeholder en URA3 kassette. Resterne er en pulje af hybride mutante celler, der indeholder gennemførelse integreret i genomet. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3. Top hits kortlagt af RH-SEQ.
Hvert panel rapporterer RH-SEQ-data for det angivne gen fra RH-SEQ. X-aksen rapporterer log2 af overflod af en gennemført mutant klon efter udvælgelse ved 39 °c i forhold til den tilsvarende mængde ved 28 °c. Y-aksen rapporterer andelen af alle kloner forsynet med indsættelser i den indikerede allel, der udviste tæthed forholdet på x, som en kerne tæthed skøn. Underliggende læse-og tælle data for indsættelser rapporteres andetsteds3. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Fordelene ved RH-SEQ over tidligere statistiske-genetiske metoder er flere gange. I modsætning til sammenhængen og associerings analysen giver RH-SEQ en enkelt genkort løsning; som sådan vil det sandsynligvis være af betydelig nytte, selv i undersøgelser af træk variation på tværs af individer af en given art, samt interspecifikke forskelle. Også tidligere forsøg på Genome-Wide gensidige hemizygosity analyse brugt samlinger af gendeletion mutanter, hvoraf nogle Harbor sekundære mutationer, der kan føre til falsk positive resultater9,10. RH-SEQ-strategien forbigås dette problem ved at generere og fænotypebestemmelse mange hemizygote mutanter i hvert gen igen, således at baggrunden for enhver individuel mutant klon bidrager kun marginalt til det endelige resultat. I princippet giver RH-SEQ også studiet af Noncoding loci, men i det nuværende arbejde fokuserede vi udelukkende på gener.

Der er et par særheder til RH-SEQ, nogle biologiske og nogle tekniske, at en succesrig praktiserende læge vil beskæftige sig med op foran for at maksimere nytten af tilgangen og accelerere stien til de bedste resultater. Biologisk, RH-SEQ giver kun mening som en teknik, hvis de to målarter kan blive parret at danne en stabil, levedygtig hybrid, der kan genmanipuleres. Således kan vi ikke forestille at anvende RH-SEQ til arter, så divergerende, at de undlader at smelte til en karyotypisk stabil diploid. På den anden side, hvis de to forældre til diploide hybrid er for ens på DNA-niveau, de fleste læser fra gennemførelse indsættelse sekvens ikke kan kortlægges allele-specifikt til blot en af de to overordnede genomer og vil være ubrugelig; således vil en given RH-SEQ eksperiment være mest vellykket, når forældrene har høj kvalitet reference genomer til rådighed og ramte en "sweet spot" af sekvens divergens. I betragtning af et RH-SEQ-projekt, der er formuleret med henblik på at dissekere det genetiske grundlag for en træk forskel mellem Stam arterne, vil resultaterne som et særskilt synspunkt sandsynligvis være langt mere fortolbare, når hybriden af hensyn til interessen tjener som en rimelig repræsentant for forældrene. Ekstreme fænotyper, der er unikke for hybrid (heterosis), kan påvirke eller sløre virkningerne af gener af interesse, der underliggende Fænotypen, da den er forskellig mellem forældrene. Eventuelle gener, der er kortlagt gennem gensidig hemizygosity-analyse, skal valideres af uafhængige allel-swap-eksperimenter med den genetiske baggrund hos de racerene forældre arter.

Med hensyn til tekniske spørgsmål i et RH-SEQ-eksperiment har vores erfaringer fremhævet flere potentielle kilder til støj og tilvejebragt brugbare løsninger. Støj manifesterer sig som uenighed blandt de Sequencing-baserede estimater af egnethed af hemizygotes harkedeligt gennemførelse af indsættelser i en given allel af et givent gen. Dette kan stamme fra forskellige sekundære mutationer i baggrunden for gennemførelse af mutanter (se nedenfor); variabilitet i effektiviteten af PCR forstærker forskellige indsætnings steder; lav repræsentation af en given mutant i bulk-puljen, hvilket fører til lav sekvensering dækning, der svækker præcision; og forskelle i placeringen af gennemførelse indsættelse i genet (f. eks, transposoner indsættelse i en 3 ' gen ende kan have minimal fænotypiske effekt). Af alle disse grunde mener vi, at det er afgørende at generere meget store gennemførelser af mutant puljer og i sidste ende at udelukke alle gener fra afprøvning uden et rimeligt antal mutanter i hver af de to alleler. Vi bemærker, at selv om vi ikke har implementeret det her, en Barcoded gennemførelse system7 kunne yderligere bidrage til at løse problemer med PCR bias og skære ned på omkostningerne og arbejdskraft i en RH-SEQ eksperiment.

Afslutningsvis har vi etableret en ligetil arbejdsgang for RH-SEQ, og har angivet forbehold af tilgangen. Vi finder, at sidstnævnte ikke i væsentlig grad kompromitterer nytten af RH-SEQ; Vi mener, at det rummer store løfter om en høj opløsning af genom-skalaen af de fænotypiske konsekvenser af genetisk variation, herunder forskelle mellem arter, der har været reproduktivt isoleret i millioner af år.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi takker J. Roop, R. Hackley, I. Grigoriev, A. Arkin og J. Skerker for deres bidrag til den oprindelige undersøgelse, F. AlZaben, A. FLURY, G. Geiselman, J. Hong, J. Kim, M. Maurer, og L. Oltrogge for teknisk bistand, D. Savage for hans gavmildhed med mikroskopi ressourcer, og B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson og A. Sasikumar til drøftelse; Vi takker også J. Dueber (Department of Bioengineering, UC Berkeley) for PiggyBac plasmid. Dette arbejde blev støttet af R01 GM120430-a1 og af community Sequencing Project 1460 til RBB på det amerikanske Department of Energy joint Genome Institute, en DOE Office of Science bruger Facility. Det arbejde, der udføres af sidstnævnte blev støttet af Kontoret for videnskab af det amerikanske energiministerium under kontrakt nr. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics