Modulation der subzellulären Lokalisierung von Tau als Werkzeug zur Untersuchung der Expression krankheitsbedingter Gene

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Tau ist ein neuronales Protein, das sowohl im Zytoplasma, wo es Mikrotubuli bindet, als auch im Kern, wo es unkonventionelle Funktionen wie die Modulation von Alzheimer-Gene ausübt. Hier beschreiben wir eine Methode zur Untersuchung der Funktion von nuklearem Tau unter Ausschluss von Interferenzen, die von zytoplasmatischem Tau kommen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Siano, G., Caiazza, M. C., Varisco, M., Calvello, M., Quercioli, V., Cattaneo, A., Di Primio, C. Modulation of Tau Subcellular Localization as a Tool to Investigate the Expression of Disease-related Genes. J. Vis. Exp. (154), e59988, doi:10.3791/59988 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tau ist ein Mikrotubuli-bindendes Protein, das in Neuronen exprimiert wird und seine wichtigste bekannte Funktion mit der Aufrechterhaltung der Zytoskelettstabilität zusammenhängt. Jüngste Erkenntnisse deuten jedoch darauf hin, dass Tau auch in anderen subzellulären Kompartimenten vorhanden ist, einschließlich des Kerns, in dem er in den DNA-Schutz, in die rRNA-Transkription, in die Mobilität von Retrotransposons und in die strukturelle Organisation der Nukleolus. Wir haben vor kurzem gezeigt, dass nukleare Tau an der Expression des VGluT1-Gens beteiligt ist, was auf einen molekularen Mechanismus hindeutet, der die pathologische Zunahme der Glutamatfreisetzung in den frühen Stadien der Alzheimer-Krankheit erklären könnte. Bis vor kurzem war die Beteiligung von Nuclear Tau an der Modulation der Expression von Zielgenen aufgrund technischer Einschränkungen, die den Ausschluss des Beitrags von zytoplasmatischem Tau oder die Wirkung anderer nachgeschaltete Faktoren, die nicht mit dem nuklearen Tau zusammenhängen. Um diese Ungewissheit zu überwinden, entwickelten wir eine Methode, um die Expression von Zielgenen zu untersuchen, die speziell durch das nukleare Tau-Protein moduliert werden. Wir verwendeten ein Protokoll, das die Verwendung von Lokalisationssignalen und der subzellulären Fraktionierung koppelt, was den Ausschluss der Interferenz von den zytoplasmatischen Tau-Molekülen ermöglicht. Vor allem ist das Protokoll einfach und besteht aus klassischen und zuverlässigen Methoden, die allgemein anwendbar sind, um die kernnukleare Funktion von Tau in anderen Zelltypen und zellulären Bedingungen zu untersuchen.

Introduction

Die Funktionen des Tau-Proteins im Zellkern haben in den letzten Jahren großes Interesse geweckt, da es nachweislich eng mit Nukleinsäuren1,2,3,4,5,6verbunden ist. Tatsächlich hat eine kürzlich durchgeführte genomweite Studie gezeigt, dass Tau in vivo7genic- und intergene DNA-Sequenzen bindet. Eine Rolle in der nukleolaren Organisation wurde vorgeschlagen8,9,10,11. Darüber hinaus wurde vorgeschlagen, Tau in den DNA-Schutz vor oxidativem und hyperthermischem Stress5,10,12,13, zu beteiligen, während mutierte Tau mit Chromosomeninstabilität und Aneuploidie14,15,16verbunden wurde.

Bisher blieben die Herausforderungen bei der Untersuchung der Funktionen von Tau im Nuklearbereich aufgrund der Schwierigkeiten, den spezifischen Beitrag der nuklearen Tau aus dem Beitrag der zytoplasmatischen Tau zu sezieren, nahezu ungelöst. Darüber hinaus sind die Funktionen, die Tau-Molekülen im Kernraum zugeschrieben werden, bisher nur korrelativ, weil sie keine eindeutige Demonstration der direkten Beteiligung nuklearer Tau-Proteine haben. Die Beteiligung von Tau an der Mobilität von Retrotransposons oder an der rRNA-Transkription oder am DNA-Schutz11,12,17,18,19 könnte auch durch den Beitrag von zytoplasmatischem Tau oder durch die Wirkung anderer nachgelagerter Faktoren, die nicht mit nuklearem Tau zusammenhängen, erklärt werden.

Hier bieten wir eine Methode, die dieses Problem lösen kann, indem wir ein klassisches Verfahren nutzen, um das Kernfach in Kombination mit der Verwendung von Tau-Konstrukten 0N4R mit der T-Flagge für nukleare Lokalisierung (NLS) oder nukleare Exportsignale (NES) zu isolieren. Dieser Ansatz beseitigt die komplexen Probleme im Zusammenhang mit möglichen Artefakten aufgrund des Spillovers von Tau-Molekülen aus dem zytoplasmatischen Fach. Darüber hinaus induzieren Tau-NLS- und Tau-NES-Konstrukte die Anreicherung bzw. den Ausschluss von Tau-Molekülen aus dem Kernraum und bieten positive und negative Kontrollen für die Beteiligung nuklearer Tau-Moleküle an einer bestimmten Funktion. Das Protokoll ist technisch einfach und besteht aus klassischen und zuverlässigen Methoden, die allgemein anwendbar sind, um die kernnukleare Funktion von Tau in anderen Zelltypen zu untersuchen, differenziert oder nicht, wie Krebszellen, die den Tau-Ausdruck20,21reaktivieren. Darüber hinaus könnte es auch auf andere Proteine angewendet werden, die sowohl im Zytoplasma als auch im Zellkern vorhanden sind, um biologische Funktionen im Zusammenhang mit verschiedenen Kompartimenten zu sezieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Zellkultur

  1. Kultur SH-SY5Y-Zellen (menschliche Neuroblastom-Zelllinie, CRL-2266) in vollständigem Medium (Dulbeccos modifiziertes Eagle-Medium:Nährstoff-Mischung F12 [DMEM/F-12] ergänzt durch 10% fetales Rinderserum [FBS], 2 mM L-Glutamin, 100 U/mL Penicillin und 100 g/ml Streptomycin). Bewahren Sie die Zellen in einem Inkubator bei 37 °C und 5%CO2auf. Zellen in 10 cm Platten wachsen und beim Zusammenfluss aufteilen.

2. Zelldifferenzierung

  1. Um SH-SY5Y-Zellen zu unterscheiden, fügen Sie am Tag nach der Beschichtung 10 M Retinsäure (RA) hinzu, um das Medium für 5 Tage zu vervollständigen.
  2. Der sechste Tag ersetzen Medium durch Differenzierungsmedium: DMEM/F-12 ergänzt durch 50 ng/mL BDNF, 2 mM L-Glutamin. Fügen Sie keine FBS oder Antibiotika hinzu.
  3. Wachsen Sie die Zellen in Differenzierungsmedium für 3 Tage.

3. Chimeric Konstrukte Klonen

  1. Generieren Sie Tau-NLS-Konstrukt durch Klonen durch Restriktionsenzymverdauung im Rahmen am 3' Ende der Tau-Sequenz 0N4R (383aa) die 3xNLS(SV40NLS):5'-CCAAAAAAAAGGTAGATCCAAAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAGAGAAGAGAAAGAGAAAAGAAGAAGAAGAAGAAGA
    HINWEIS: Das 3xNLS am 3' Ende von Tau wird in das pCMV-Tau Plasmid für die Säugetierexpression geklont, indem die XhoI- und BamHI-Beschränkungsstandorte in die Multikloning Site (MCS) ausgenutzt werden.
  2. Generieren Sie Tau-NES-Konstrukt durch Klonen durch Restriktionsenzymverdauung im Rahmen am 3' Ende der Tau-Sequenz 0N4R (383aa) die NES-Sequenz: 5'-AGTGAGCTGCAGAACAAGCTGGAAGAGTTGGCTCTCTCTCGTACAAA-3'.
    HINWEIS: Das NES am 3' Ende von Tau wird in das pCMV-Tau Plasmid geklont, um die EcoRI- und BamHI-Beschränkungsstandorte in das MCS auszunutzen.
  3. Transformieren Sie den DH5alpha E.coli-Stamm mit 100 ng DNA aus Schritt 3.1 oder 3.2 und Plattenzellen auf LB-Agar-Platten mit 100 mg/ml Ampicillin. Lassen Sie über Nacht bei 37 °C wachsen.
  4. Wählen Sie eine einzelne Kolonie und spike die Zellen in 5 ml LB mit Ampicillin. Lassen Sie die Zellen bei 37 °C in Agitation über Nacht wachsen.
  5. Extrahieren Sie Plasmid mit einem DNA-Miniprep (Materialtabelle) und Sequenz, um die Konstrukte zu überprüfen.
  6. Transformieren Sie den DH5alpha E. coli-Stamm mit den sequenzverifizierten Konstrukten und Plattenzellen auf LB-Agar-Platten mit Ampicillin. Lassen Sie über Nacht bei 37 °C wachsen.
  7. Wählen Sie eine einzelne Kolonie und spike die Zellen in 5 ml LB mit Ampicillin. Lassen Sie die Zellen bei 37 °C in Agitation für 2 h wachsen.
  8. Setzen Sie die Zellen aus Schritt 3,7 in 200 ml LB mit Ampicillin. Lassen Sie über Nacht bei 37 °C wachsen.
  9. Pellet die Zellen bei 3.500 x g für 10 min bei 4 °C.
  10. Extrakt-Plasmid mit einem DNA-Maxiprep (Materialtabelle).

4. Zelltransfektion

  1. Samen 400.000 Zellen aus Schritt 1.1 in 6-Well-Platten oder 20.000 Zellen in 8-Well-Kammer-Dias. Platte vier Proben: Kontrollzellen, die mit einem leeren Vektor transfiziert werden sollen, Zellen, die mit nicht markiertem Tau transfiziert werden sollen, Zellen, die mit Tau-NLS transfiziert werden sollen, und Zellen, die mit Tau-NES transfiziert werden sollen.
  2. Am Tag nach der Aussaat transfekieren 400 ng DNA für jeden Brunnen mit den kationischen Lipiden (Tabelle der Materialien) in 6-Well-Platten oder 200 ng DNA für jeden Brunnen für 8-Well-Kammer-Dias, nach den Anweisungen des Herstellers.
    1. Inkubieren Sie die DNA und die kationischen Lipide getrennt in 250 l (für 6-Well-Platten) oder 25 l (für 8-Well-Kammer-Dias) des reduzierten Serummediums für 5 min bei RT. Dann kombinieren Sie sie, um den DNA-Lipid-Komplex zu erzeugen und für 20 min zu brüten.
    2. Ersetzen Sie das Kulturmedium durch 2 ml (für 6-Well-Platten) oder 250 l (für 8-Well-Kammerrutschen) eines frischen Kompletten Kulturmediums. Fügen Sie den DNA-Lipid-Komplex zu den Zellen hinzu und inkubieren Sie bei 37 °C über Nacht.
  3. Alternativ kann die DNA mit dem kationischen Reagenz Polyethylenimin (PEI) transfekt werden.
    1. Mischen Sie 2 g DNA und 6 l PEI mit 200 l vollständigem Kulturmedium (für jeden Brunnen in 6-Well-Platten) oder 1 g DNA und 3 l PEI mit 100 l komplettem Kulturmedium (für jeden Brunnen in 8-Well-Kammer-Dias) , Wirbel und inkubieren für 10 min bei RT.
    2. Fügen Sie die Mischung zu den Zellen hinzu und fügen Sie 1,8 ml komplettes Kulturmedium pro Brunnen in 6-Well-Platten oder 150 l komplettes Kulturmedium pro Brunnen in 8-Well-Kammerrutschen hinzu, um das Beschichtungsvolumen zu erreichen.
  4. Ändern Sie das Medium am Tag nach der Transfektion und fügen Sie die Differenzierungsmedien hinzu, wie in Schritt 2.2 beschrieben.

5. Immunfluoreszenz

  1. Entfernen Sie das Kulturmedium und spülen Sie Zellen mit 1x PBS. Fix Zellen mit 100% eiskaltem Methanol für 3 min ohne schütteln. Entfernen Sie die Befestigungslösung und waschen Sie sie kurz mit 1x PBS.
  2. Permeabilisieren Sie mit 0,1% nichtionischem Tensid in 1x PBS für 5 min bei Raumtemperatur (RT). Kurz mit 1x PBS waschen, 3 mal.
  3. Inkubieren Sie Zellen mit Sperrpuffer (0,1% Tween 20 und 1% BSA in PBS) für 30 min bei RT auf einem Orbitalshaker.
  4. Inkubieren Sie mit geeigneten primärantikörpern (z. B. Mausmonoklonaler Anti-Tau13-Antikörper) verdünnt 1:500 im Sperrpuffer über Nacht bei 4 °C auf einem Orbitalshaker. Entfernen Sie die Antikörperlösung und waschen Sie kurz mit 1x PBS.
  5. Inkubieren Sie mit sekundären Antikörpern, die mit Fluorophor konjugiert sind (z. B. Ziegenanti-Maus-Antikörper konjugiert mit Alexa Fluor 633) verdünnt 1:500 im Sperrpuffer für 1 h bei RT. Entfernen Sie die Antikörperlösung und waschen Sie sie kurz mit 1x PBS 3 mal.
  6. Um Kerne zu färben, mit DAPI verdünnt 1:20,000 in Sperrpuffer für 10 min bei RT. Waschen Sie mit 1x PBS 3 mal. Montieren Sie Abdeckungen auf einem Dia mit Antifade-Montagemedium.

6. Western Blot

  1. Um das Zellpellet aus Schritt 4.4 zu sammeln, entfernen Sie das Medium und waschen Sie Zellen mit PBS. Inkubieren Sie mit 500 l 0,1% Trypsin für 4 min bei 37 °C. Fügen Sie ein gleiches Volumen vollständiger Medien hinzu, und setzen Sie Zellen erneut aus.
  2. Sammeln Sie Zellen in einem Rohr und Zentrifuge bei 500 x g für 5 min. Am Ende der Zentrifugation vorsichtig entfernen Sie den Überstand. 1 ml PBS, Zentrifuge bei 500 x g für 5 min hinzufügen und den Überstand vorsichtig entfernen. Zellpellets zur sofortigen Verwendung auf Eis lagern oder bei -80 °C einfrieren, um sie langfristig zu lagern.
  3. Für Proteinextrakte insgesamt das Zellpellet für 30 min auf Eis im Lysepuffer (20 mM Tris-HCl pH 8, 20 mM NaCl, 10% Glycerin, 1% Octylphenoxy poly(ethyleneoxy)ethanol, verzweigt (Materialtabelle),10 mM EDTA) ergänzt mit Protease- und Phosphataseinhibitoren. Verwenden Sie entsprechend der Häufigkeit des Pellets einen Lysepuffer von 50 bis 100 l.
    1. Zentrifugieren Sie den Extrakt bei 16.000 x g für 15 min. Sammeln Sie den Überstand und quantifizieren Sie die Proteinkonzentration durch einen Standard-Quantifizierungstest. Bereiten Sie die Proteinproben für die SDS-PAGE vor, indem Sie 20 g Proteine mit 5 l 4x Laemmli Puffer in einem Gesamtvolumen von 20 'L mischen und bei 100 °C für 5 min kochen.
      HINWEIS: Die Probe kann bei -20 °C gelagert werden.
  4. Für subzelluläre Fraktionen, setzen Sie Zellen aus Schritt 6.2 in vollständigem Medium, und sammeln 1 x 106 Zellen pro Probe. Zentrifuge bei 500 x g für 10 min, um Zellpellets für die folgenden Schritte zu erhalten.
    1. Um subzelluläre Fächer zu isolieren, fraktionieren Sie nach Denkit-Spezifikationen. Um jede Fraktion zu isolieren, inkubieren Sie das Zellpellet aus Schritt 6.4 mit dem entsprechenden Puffer, Zentrifuge, sammeln Sie den Überstand und fügen Sie den nächsten Puffer zum Pellet hinzu, wie in 6.4.1.1-6.4.1.5 beschrieben. Fügen Sie in der Reihenfolge zytoplasmatische Extraktionspuffer, Membranextraktionspuffer, Kernextraktionspuffer, Kernextraktionspuffer ergänzt mit 5 mM CaCl2 und 3 U/ L Mikrokokken-Nuklease und Zytoskelettextraktionspuffer hinzu.
      HINWEIS: Alle Puffer müssen mit Proteasehemmern ergänzt werden. Skalieren Sie Puffervolumes entsprechend dem Volumen des Zellpellets.
      1. Um die zytosolische Fraktion zu isolieren, inkubieren Sie Zellpellets in 100 l eiskalten zytoplasmatischen Extraktionspuffer, ergänzt mit Proteasehemmern bei 4 °C mit sanfter Mischung für 10 min. Zentrifugieren bei 500 x g bei 4 °C für 5 min und übertragen Sie den Überstand in vorgekühlte Röhrchen.
      2. 100 l eiskalten Membranextraktionspuffer mit Proteaseinhibitoren ergänzt in das Pellet ab Schritt 6.4.1.1 geben und bei 4 °C mit sanfter Mischung für 10 min inkubieren. Zentrifuge bei 3.000 x g bei 4 °C für 5 min und das Überstand sammeln.
      3. Für die lösliche Kernfraktion 50 L Kernextraktionspuffer, ergänzt mit Proteasehemmern, zum Pellet ab Schritt 6.4.1.2 und Wirbel hinzufügen. Bei 4 °C 30 min zentrieren, bei 5.000 x g bei 4 °C für 5 min zentrieren und den Überstand einsammeln.
      4. Für die unlösliche Kernfraktion 50 L kernionischen Extraktionspuffer s, ergänzt mit Proteasehemmern, CaCl2 und Mikrokokken-Nuklease, zum Pellet ab Schritt 6.4.1.3 und Wirbel hinzufügen. Bei 37 °C 5 min inkubieren und dann wieder wirbeln. Zentrifuge bei 16.000 x g bei RT für 5 min und den Überstand sammeln.
      5. Für die Zytoskelettfraktion 50 L Zytoskelettextraktionspuffer, ergänzt mit Proteasehemmern, zum Pellet ab Schritt 6.4.1.4 und Wirbel hinzufügen. 10 min bei RT inkubieren. Zentrifugieren Sie das Rohr bei 16.000 x g für 5 min, sammeln Sie den Überstand und entsorgen Sie das Pellet.
        HINWEIS: Skalieren Sie Puffervolumes entsprechend dem Zellenvolumen, wie im Kit-Protokoll angegeben. Weitere Informationen zur Inkubations- und Zentrifugationszeit und Temperatur22,23,24,25,26,27,28,29finden Sie im Kit-Protokoll. Alternativ können Sie auch alle Standardmethoden30 anwenden, die durch die Verwendung von Reinigungsmitteln und durch Erhöhung der Ionenstärke und Zentrifugationsgeschwindigkeit die zytosolischen, membrangebundenen, zytoskelettalen und nuklearen Fraktionen trennen. Trennen Sie die lösliche Kernfraktion und die unlösliche Kernfraktion, indem Sie Standardpuffer für die nukleare Extraktion nutzen. Die Probe kann bei -20 °C gelagert werden.
    2. Fügen Sie für den SDS-PAGE 7 l 4x Laemmli-Puffer zu 20 L subzellulären Fraktionen hinzu, die aus den Schritten 6.4.1.1-6.4.1.5 gewonnen werden, bei 100 °C für 5 min kochen.
  5. Proben auf ein Acrylamid-Gel laden und Elektrophorese bei einer konstanten Spannung von 120 V durchführen. Übertragen Sie Proteine bei 250 mA für 90 min.
  6. Überprüfen Sie die richtige Protein-Gel-Elektrophorese und erfolgreiche Slotting durch Inkubation der Membran für 5 min in Ponceau Färbung Lösung. Spülen Sie die Membran in destilliertem Wasser, bis der Hintergrund sauber ist. Entfernen Sie den Fleck durch fortgesetztes Waschen mit Tris gepufferter Salinmitin mit Tween 20 (TBST) für 10 min auf einem Shaker.
  7. Inkubieren Sie die Membran mit Blockierlösung (5% Milch in TBST) für 1 h bei RT auf Shaker. Waschen Sie 3 mal mit TBST für 5 min.
  8. Hybridisieren Sie die Membran mit dem Primärantikörper in Blockierlösung (1% Milch in TBST) über Nacht bei 4 °C. Waschen Sie 3 mal mit TBST für 5 min.
  9. Hybridisieren Sie die Membran mit dem HRP-konjugierten Sekundärantikörper in Blockierlösung für 1 h bei RT. 3 mal mit TBST für 5 min waschen.
  10. Erkennen Sie das Proteinband mit Chemilumineszenz. Quantifizieren Sie die Intensität von Western Blot Bands von ImageJ. Normalisieren Sie die Proteinexpression auf das Produkt eines Haushaltsgens: Histon H2B für die kernlösliche und unlösliche Fraktion, GAPDH für die zytoplasmatische Fraktion und für Gesamtextrakte.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die Strategie zur Sezieren der Auswirkungen von nuklearem Tau in der Genexpression unter Vermeidung des Beitrags von zytoplasmatischen Tau-Proteinen wurde in Abbildung 1dargestellt. Kurz gesagt, Werden Tau-Proteine, die mit NLS oder NES markiert sind, im nuklearen Fach angesammelt bzw. aus dem Nuklearfach ausgeschlossen. Die funktionelle Wirkung dieses Ungleichgewichts ist die Veränderung der Genexpression, gemessen als Produkt des VGluT1-Gens.

Nach der Protokollbeschreibung wurden SH-SY5Y-Zellen 5 Tage lang mit RA und dann 3 Tage lang mit BDNF behandelt, um post-mitotische neuronähnliche Zellen zu erhalten (Abbildung 2). In Ermangelung von RA und BDNF nehmen undifferenzierte SH-SY5Y-Zellen eine rundere Morphologie an und bilden Zellklumpen. Wie erwartet, ab dem Differenzierungsprotokoll, lösen sich Klumpen ab und Zellen breiten Neuriten aus; am Ende der Differenzierung werden die Zellen gleichmäßig verteilt und über ein Netz verzweigter Neuriten miteinander verbunden.

Am Tag nach der Aussaat wurden Zellen mit Tau-NLS- oder Tau-NES-Plasmiden (Abschnitt 4.2) mit kationischen Lipiden transfiziert. Bei Zellen, die Tau-NLS- oder Tau-NES-Konstrukte exdrücken, kann die subzelluläre Lokalisation von Tau durch Immunfluoreszenz mit Anti-Tau-Antikörpern nachgewiesen werden. Je nach Effizienz der Transfektion zeigen Zellen eine starke kerntechnische Färbung, die mit dem DAPI-Signal verschmilzt, oder eine zytoplasmatische Färbung mit leeren Kernen, wenn sie erfolgreich mit Tau-NLS bzw. Tau-NES transfiziert werden (Abbildung 3). Das Fehlen dieser spezifischen Signale deutet auf eine ineffiziente Transfektion hin.

Um die in verschiedenen subzellulären Kompartimenten angereicherten Proteine zu analysieren, wurden Zellen gesammelt und gezählt, um gleiche Mengen von Zellen pro Probe zu verarbeiten. Jede Standardfraktionierungsmethode, die die Erhöhung der Waschmittel- und Ionenstärke und die Erhöhung der Zentrifugationsgeschwindigkeit nutzt, kann verwendet werden, um die Zellkompartimente voneinander zu trennen und so das zytosolierische, membrangebundene, zytoskelettale und die kerntechnischen Fraktionen.

Sobald die Kerne isoliert wurden, wurden die kernlösliche Fraktion und die chromatingebundene Fraktion durch Zugabe von 3 U/L Mikrokokken-Nuklease und 5 mM CaCl2getrennt.

Für die Western Blot-Analyse wurden gleiche Volumina von zytoplasmatischen und Membranfraktionen und halbvokte Der anderen Fraktionen auf ein Gradienten-Acrylamid-Gel geladen, um die unterschiedliche Puffermenge zu korrigieren, die bei jedem Schritt hinzugefügt wurde.

Um die effiziente Trennung verschiedener Fraktionen zu überprüfen, wurde der Western Blot, der die folgenden Antikörper ausnutzt, durchgeführt: Anti-GADPH (in allen Fraktionen mit Ausnahme des Zytoskeletts vorhanden und besonders angereichert in der zytoplasmatischen Fraktion); Anti-Actin (besonders angereichert in der Zytoskelettfraktion); Anti-Tubulin (besonders angereichert mit zytoplasmatischen und zytoskelettalen Fraktionen); Anti-H2B (angereichert in den Kernfraktionen) (Abbildung 4).

Eine Anreicherung dieser Marker in verschiedenen subzellulären Fraktionen zeigt an, dass die Fraktionierung nicht gut durchgeführt wird. Es ist zu beachten, dass jedes Protokoll für die subzelluläre Fraktionierung eine Kontamination zwischen 10-15% zwischen den Fraktionen aufweisen kann.

Nach der Überprüfung der erfolgreichen Fraktionierung der Probe wurde der Western Blot durchgeführt, um das Signal von Tau im Kernraum und das VGluT1-Signal im Gesamtextrakt zu überprüfen (Abbildung 5). Während Tau nicht markiert in allen Fraktionen nachweisbar ist, ist Tau-NLS im Kernraum stark angereichert und in der zytoplasmatischen Fraktion schlecht nachweisbar. Im Gegenteil, Tau-NES ist in der zytoplasmatischen Fraktion angereichert und in der Kernfraktion weniger nachweisbar. Das Vorhandensein einer kleinen Menge Tau-NES in die lösliche Kernfraktion ist zu erwarten, da sie wie die endogene Tau in den Kern transloziert wird und das nukleare Exportsignal, sobald es in den Kernraum gelangt, seine Translokation in das Zytoplasma ermöglicht. Der Nachweis einer anderen Anreicherung für diese beiden Fusionsproteine könnte auf ein Problem in der Effizienz der Transfektion oder beim Klonen von Konstrukten oder bei der Fraktionierung hindeuten.

Quantitative Analysen von Western Blot können mit ImageJ durchgeführt werden. Die Werte werden für das Haushaltsgen spezifisch für jede Fraktion normalisiert (GAPDH für zytoplasmatische Fraktion; Histon H2B für lösliche Kern- und Chromatin-gebundene Fraktionen).

Das Diagramm in Abbildung 5B zeigt das Verhältnis von Tau in der löslichen Kernfraktion und der zytoplasmatischen Fraktion, um hervorzuheben, dass Tau-NLS in der löslichen Kernfraktion (SNF) stark angereichert ist, während Tau-NES verringert wird. Darüber hinaus wird Tau-NLS in der Chromatin-gebundenen Fraktion (CBF) in Bezug auf die zytoplasmatische Fraktion (CF) angereichert, während Tau-NES verringert wird. SNF/CF = 1 und CBF/CF = 1 entsprechen dem Tau-Verhältnis in Steuerzellen. Der endogene Tau ist erwartungsgemäß in allen Fraktionen schwach nachweisbar. Das Diagramm in Abbildung 5C zeigt die Quantifizierung der VGluT1-Expression in den Gesamtextrakten von Proben, die unterschiedliche Mengen an nuklearem Tau exdrücken. In Zellen, die Tau-NES exdrücken, ist die VGluT1-Expression mit der Basisausdrucksexpression in Kontrollzellen vergleichbar. Im Gegenteil, in Zellen, die nicht markierte Tau oder Tau-NLS exdrücken, ist der Ausdruck von VGluT1 mehr als verdoppelt.

Figure 1
Abbildung 1: Grafische Darstellung der Strategie, die verwendet wird, um eine nukleare oder eine zytoplasmatische Akkumulation von Tau zu ermöglichen. Tau-NLS wird im Nuklearen Fach angesammelt, während Tau-NES ausgeschlossen ist. Die experimentelle Auslesung ist die Modulation des VGluT1-Ausdrucks. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Repräsentative undifferenzierte und differenzierte Zellkultur. Bild von undifferenziertem SH-SY5Y (links), Zellen differenziert durch RA (Mitte) und differenziert durch RA und BDNF (rechts). Maßstabsleiste = 100 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Repräsentatives Bild der subzellulären Tau-Anreicherung durch Immunfluoreszenz. Bild von Zellen, die nicht transfiziert sind oder nicht markierte Tau-, Tau-NES- oder Tau-NLS-Konstrukte exzellen exzessen. Tau-Signal wurde durch Immunfluoreszenz (rot) erhalten, Kerne Signal wurde durch DAPI Färbung (blau) erhalten, zusammengeführte Bilder werden berichtet. Maßstabsleiste = 10 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Repräsentativer Nachweis von Proteinen, die durch Western Blot in subzellulären Fraktionen angereichert sind. Westlicher Fleck subzellulärer Fraktionen aus SH-SY5Y-Zellen. CF = zytoplasmatische Fraktion; MF = Membranfraktion; SNF = lösliche Kernfraktion; CBF = Chromatin gebundene Fraktion; CKF = Zytoskelettfraktion. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: Repräsentativer Nachweis von nuklearen Tau- und VGluT1-Proteinen. (A) Westlicher Fleck Tau-Protein, der in den kerntechnischen und zytoplasmatischen Fraktionen nachgewiesen wurde. (B) Das Diagramm zeigt das Verhältnis von Tau in den Kernfraktionen und der zytoplasmatischen Fraktion. Die Werte wurden auf der endogenen Tau normalisiert. SNF/CF = 1 und CBF/CF = 1 entspricht dem endogenen Tau-Verhältnis in Kontrollzellen. (C) Westlicher Fleck VGluT1-Protein. (D) Das Diagramm berichtet über die Quantifizierung des VGluT1-Ausdrucks in den Gesamtextrakten von Proben, die unterschiedliche Mengen an nuklearem Tau exdrücken. Kruskal-Wallis ANOVA und Mann-Whitney Test; p < 0,001, **** p < 0,0001, n.s. p > 0,05. Alle Ergebnisse werden als Mittelwert -SEM aus mindestens drei unabhängigen Experimenten dargestellt. Diese repräsentative Zahl wurde von Siano et al.31geändert. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Wir beschreiben eine Methode, um die Auswirkungen des nuklearen Tau-Proteins auf die Genexpression zu messen. Mit diesem Protokoll ist der Beitrag der zytoplasmatischen Tau stark begrenzt. Kritische Schritte dieses Protokolls sind die folgenden: die Differenzierung der menschlichen Neuroblastom-SH-SY5Y-Zellen, die subzelluläre Fraktionierung und die Lokalisierung von Tau-Protein im Kernraum.

Erstens, wie im repräsentativen Ergebnisabschnitt gezeigt, ist die Differenzierung von SH-SY5Y-Zellen durch Zugabe von RA und BDNF entscheidend, um eine gute Präparation neuronähnlicher Zellen in der Kultur zu erhalten. Die Dichte der ausgesäten Zellen ist besonders wichtig, da eine geringere Dichte die Zellproliferation beeinflussen könnte. Darüber hinaus ist es für Experimente, die eine hohe Anzahl von Zellen benötigen, wie zelluläre Fraktionierung und Western Blot, wichtig zu beachten, dass der BDNF-Differenzierungsschritt die zelluläre Proliferation blockiert, um die terminale Differenzierung zu ermöglichen, wodurch die Anzahl der Zellen in der Kultur begrenzt wird. Alternative Differenzierungsprotokolle verwenden nur RA oder NGF anstelle von BDNF. Während jedoch die Zugabe von BDNF nach RA eine bessere morphologische Differenzierung erreichen kann32,33, induziert NGF ein schwächeres Neuritenwachstum in SH-SY5Y-Zellen34. Darüber hinaus wurde ausgiebig nachgewiesen, dass die Kombination von RA und BDNF eine homogene neuronale Population mit Expression neuronaler Marker und verminderter Proliferation35ermöglicht. Aus diesem Grund kombiniert das hier ausgenutzte Differenzierungsprotokoll RA und BDNF.

Das Verfahren zur Zersezieren der Rolle von Tau in verschiedenen subzellulären Kompartimenten kann jedoch auch für undifferenzierte Zellen oder für verschiedene Zelltypen verwendet werden.

Die subzelluläre Fraktionierung ist ein sehr kritischer Schritt und es ist entscheidend, genügend Ausgangsmaterial zu haben: Ein kommerzielles Kit benötigt nur 1 x 106 Zellen, während andere Verfahren möglicherweise eine viel höhere Ausgangsmenge benötigen. Darüber hinaus garantiert die Verwendung eines Kits mit Standardpuffern und -schritten die Unvermeidbare und wesentliche Reproduzierbarkeit des Experiments. Da die Zusammensetzung der Puffer jedoch oft proprietär ist, können sie Detergenzien enthalten, die die Funktion des Proteins von Interesse verändern können und es schwierig sein könnte, die Isolierung der Fraktionen zu optimieren. Darüber hinaus kann es auch im besten Zustand zu einer Kontamination zwischen den Fraktionen von 10-15% führen. Eine schlechte Ausbeute aus jeder Fraktion könnte überwunden werden, indem die Inkubationszeit in Extraktionspuffern bestimmter Fraktionen erhöht wird.

Da die Funktionen von Nuclear Tau in den letzten Jahren ein erhebliches Interesse gewonnen haben, ist es besonders wichtig, eine zuverlässige Methode zur Sezieren der Funktion von Tau in verschiedenen Zellkompartimenten bereitzustellen. Die Kopplung der subzellulären Fraktionierung mit dem Ausdruck von Tau-Konstrukten, die speziell vom Kern gesteuert oder ausgeschlossen sind, ermöglicht es, die Tau-Menge in verschiedenen Fächern fein zu stimmen.

Ein kritischer Schritt in diesem Teil des Protokolls ist das Klonen von Tau mit nuklearem Lokalisierungssignal oder mit dem nuklearen Exportsignal. Die Effizienz des NLS wird durch das Vorhandensein einer 3XNLS Konsenssequenz aus dem SV40-Virus gewährleistet. Die kernnukleare Translokation des Proteins kann leicht durch Immunfluoreszenz überprüft werden, und das Fehlen von Signal in den Kern kann auf ein falsches Klonen oder eine ineffiziente Transfektion zurückzuführen sein. Im Gegenteil, der Nuklearexport wird durch die NES-Konsensfolge garantiert. In diesem Fall ermöglicht die Immunfluoreszenz die Kontrolle des Exports von Tau aus dem Kern. Ein schwaches Kernsignal ist jedoch nicht auszuschließen, da Tau-NES-Protein in den Kern gelangt und dann aufgrund der NES-Sequenz in das Zytosol exportiert wird.

Bisher wurde die Funktion der nuklearen Tau nur durch korrelative Ansätze untersucht, die ihre direkte Beteiligung nicht gewährleisten. Das hier beschriebene Protokoll bietet den ersten Ansatz, der es ermöglicht, die spezifische Funktion von Tau im nuklearen Kompartiment klar zu unterscheiden. Wie bereits gezeigt, hat die endogene Tau keinen Einfluss auf die Ergebnisse dieses Protokolls. Tatsächlich führt das gleiche Experiment, das in nicht-neuronalen Zellen durchgeführt wird, die keine endogene Tau exprimieren, zu einer vGluT1-veränderten Expression. Wir haben dieses Protokoll angewendet, um die Expression von krankheitsbedingten Genen zu untersuchen31. Wie dem auch sei, könnte es auch genutzt werden, um andere nukleare Tau-Funktionen zu untersuchen, wie die Beteiligung an DNA-Schäden, die Interaktion mit nuklearen Kofaktoren oder mit dem Chromatin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Diese Arbeit wurde durch Zuschüsse der Scuola Normale Superiore (SNS14_B_DIPRIMIO; SNS16_B_DIPRIMIO).

Materials

Name Company Catalog Number Comments
Alexa Fluor 633 goat anti-mouse IgG Life Technologies A21050 IF 1:500
anti Actin Antibody BETHYL LABORATORIE A300-485A anti-rabbit WB 1:10,000
anti GAPDH Antibody Fitzgerald Industries International 10R-G109a anti-mouse WB 1:10,000
anti H2B Antibody Abcam ab1790 anti-rabbit WB 1:15,000
anti Tau-13 Antibody Santa Cruz Biotechnology sc-21796 anti-mouse WB 1:1,000; IF 1:500
anti Tubulin alpha Antibody Thermo Fisher Scientific PA5-16891 anti-mouse WB 1:5,000
anti VGluT1 Antibody Sigma-Aldrich AMAb91041 anti-mouse WB 1:500
BCA Protein Assay Kit Euroclone EMPO14500
BDNF Alomone Labs B-250
Blotting-Grade Blocker Biorad 1706404 Non-fat dry milk
BOVIN SERUM ALBUMIN Sigma-Aldrich A4503-50g
cOmplete Mini Roche 11836170001 protease inhibitor
Criterion TGX 4-20% Stain Free, 10 well Biorad 5678093
DAPI Thermo Fisher Scientific 62247
DMEM/F-12 GIBCO 21331-020
Dulbecco's Modified Eagle's Medium Low Glucose Euroclone ECM0060L
EDTA Sigma-Aldrich 0390-100ml pH = 8, 0.5 M
Foetal Bovine Serum Euroclone EC50182L
Glycerol Sigma-Aldrich G5516-500ml
Goat anti-mouse IgG-HPR Santa Cruz Biotechnology sc-2005 WB 1:1,000
Goat anti-rabbit IgG-HPR Santa Cruz Biotechnology sc-2004 WB 1:1,000
IGEPAL CA-630 Sigma-Aldrich I8896-50ml Octylphenoxy poly(ethyleneoxy)ethanol
Immobilon Western MERCK WBKLS0500
Lab-Tech Chamber slide 8 well glass slide nunc 177402
L-glutamine Euroclone ECB3000D 100X
Lipofectamine 2000 transfection reagent Thermo Fisher Scientific 12566014 cationic lipid
Methanol Sigma-Aldrich 322415-6X1L
MgCl2 Sigma-Aldrich M8266-100G
NaCl Sigma-Aldrich S3014-1kg
Opti-MEM reduced serum medium Gibco 31985070
PEI Sigma-Aldrich 40,872-7
Penicillin/Streptomycin Thermo Fisher Scientific 15140122 10,000 U/mL, 100 mL
Phosphate Buffered Saline (Dulbecco A) OXOID BR0014G
PhosStop Roche 4906837001 phosphatase inhibitor
QIAGEN Plasmid Maxi Kit Qiagen 12163 Step 3.10
Retinoic acid Sigma-Aldrich R2625-100mg
Subcellular Protein Fractionation Kit for cultured cells Thermo Fisher Scientific 78840
Supported Nitrocellulose membrane Biorad 1620097
TC-Plate 6well SARSTEDT 833,920
TCS SP2 laser scanning confocal microscope Leica N/A
Triton x-100 Sigma-Aldrich X100-500ml Non-ionic surfactant
Trypsin-EDTA Thermo Fisher Scientific 15400054 0.50%
Tween-20 Sigma-Aldrich P9416-100ml
VECTASHIELD antifade mounting medium Vector Laboratories H-1000
Wizard Plus SV Minipreps DNA Purification Systems Promega A1330 Step 3.5

DOWNLOAD MATERIALS LIST

References

  1. Padmaraju, V., Indi, S. S., Rao, K. S. J. New evidences on Tau-DNA interactions and relevance to neurodegeneration. Neurochemistry International. 57, (1), 51-57 (2010).
  2. Rady, R. M., Zinkowski, R. P., Binder, L. I. Presence of tau in isolated nuclei from human brain. Neurobiology of Aging. 16, (3), 479-486 (1995).
  3. Krylova, S. M., Musheev, M., Nutiu, R., Li, Y., Lee, G., Krylov, S. N. Tau protein binds single-stranded DNA sequence specifically - The proof obtained in vitro with non-equilibrium capillary electrophoresis of equilibrium mixtures. FEBS Letters. 579, (6), 1371-1375 (2005).
  4. Vasudevaraju, P., Guerrero, E., Hegde, M. L., Collen, T. B., Britton, G. B., Rao, K. S. New evidence on α-synuclein and Tau binding to conformation and sequence specific GC* rich DNA: Relevance to neurological disorders. Journal of Pharmacy & Bioallied Sciences. 4, (2), 112-117 (2012).
  5. Wei, Y., et al. Binding to the minor groove of the double-strand, Tau protein prevents DNA damage by peroxidation. PLoS ONE. 3, (7), (2008).
  6. Qi, H., et al. Nuclear Magnetic Resonance Spectroscopy Characterization of Interaction of Tau with DNA and Its Regulation by Phosphorylation. Biochemistry. 54, (7), 1525-1533 (2015).
  7. Benhelli-Mokrani, H., et al. Genome-wide identification of genic and intergenic neuronal DNA regions bound by Tau protein under physiological and stress conditions. Nucleic Acids Research. 1, 1-18 (2018).
  8. Sotiropoulos, I., et al. Atypical, non-standard functions of the microtubule associated Tau protein. Acta Neuropathologica Communications. 5, (1), 91 (2017).
  9. Lu, J., Li, T., He, R. Q., Bartlett, P. F., Götz, J. Visualizing the microtubule-associated protein tau in the nucleus. Science China Life Sciences. 57, (4), 422-431 (2014).
  10. Sultan, A., et al. Nuclear Tau, a key player in neuronal DNA protection. Journal of Biological Chemistry. 286, (6), 4566-4575 (2011).
  11. Sjöberg, M. K., Shestakova, E., Mansuroglu, Z., Maccioni, R. B., Bonnefoy, E. Tau protein binds to pericentromeric DNA: a putative role for nuclear tau in nucleolar organization. Journal of cell science. 119, (10), 2025-2034 (2006).
  12. Violet, M., et al. A major role for Tau in neuronal DNA and RNA protection in vivo under physiological and hyperthermic conditions. Frontiers in Cellular Neuroscience. 8, 1-11 (2014).
  13. Hua, Q., He, R. Q. Tau could protect DNA double helix structure. Biochimica et Biophysica Acta - Proteins and Proteomics. 1645, (2), 205-211 (2003).
  14. Rossi, G., et al. A new function of microtubule-associated protein tau: Involvement in chromosome stability. Cell Cycle. 7, (12), 1788-1794 (2008).
  15. Rossi, G., et al. Mutations in MAPT gene cause chromosome instability and introduce copy number variations widely in the genome. Journal of Alzheimer's Disease. 33, (4), 969-982 (2013).
  16. Rossi, G., et al. Mutations in MAPT give rise to aneuploidy in animal models of tauopathy. neurogenetics. 15, (1), 31-40 (2014).
  17. Sun, W., Samimi, H., Gamez, M., Zare, H., Frost, B. Pathogenic tau-induced piRNA depletion promotes neuronal death through transposable element dysregulation in neurodegenerative tauopathies. Nature Neuroscience. 21, (8), 1038-1048 (2018).
  18. Guo, C., et al. Tau Activates Transposable Elements in Alzheimer's Disease. Cell Reports. 23, (10), 2874-2880 (2018).
  19. Maina, M. B., et al. The involvement of tau in nucleolar transcription and the stress response. Acta Neuropathologica Communications. 6, (1), 70 (2018).
  20. Bonneau, C., Gurard-Levin, Z. A., Andre, F., Pusztai, L., Rouzier, R. Predictive and prognostic value of the Tau protein in breast cancer. Anticancer Research. 35, (10), 5179-5184 (2015).
  21. Vanier, M. T., Neuville, P., Michalik, L., Launay, J. F. Expression of specific tau exons in normal and tumoral pancreatic acinar cells. Journal of Cell Science. 111, (1), 1419-1432 (1998).
  22. Liao, A., et al. Therapeutic efficacy of FTY720 in a rat model of NK-cell leukemia. Blood. 118, (10), 2793-2800 (2011).
  23. Cascio, S., Zhang, L., Finn, O. J. MUC1 protein expression in tumor cells regulates transcription of proinflammatory cytokines by forming a complex with nuclear factor-κB p65 and binding to cytokine promoters: Importance of extracellular domain. Journal of Biological Chemistry. 286, (49), (2011).
  24. Costello, D. A., et al. Long Term Potentiation Is Impaired in Membrane Glycoprotein CD200-deficient Mice. Journal of Biological Chemistry. 286, (40), 34722-34732 (2011).
  25. Roy, G., Placzek, E., Scanlan, T. S. ApoB-100-containing lipoproteins are major carriers of 3-iodothyronamine in circulation. Journal of Biological Chemistry. 287, (3), 1790-1800 (2012).
  26. Loo, L. H., et al. Heterogeneity in the physiological states and pharmacological responses of differentiating 3T3-L1 preadipocytes. Journal of Cell Biology. 187, (3), 375-384 (2009).
  27. Draker, R., Sarcinella, E., Cheung, P. USP10 deubiquitylates the histone variant H2A.Z and both are required for androgen receptor-mediated gene activation. Nucleic Acids Research. 39, (9), 3529-3542 (2011).
  28. Richard, D. J., et al. HSSB1 rapidly binds at the sites of DNA double-strand breaks and is required for the efficient recruitment of the MRN complex. Nucleic Acids Research. 39, (5), 1692-1702 (2011).
  29. Roger, L., Jullien, L., Gire, V., Roux, P. Gain of oncogenic function of p53 mutants regulates E-cadherin expression uncoupled from cell invasion in colon cancer cells. Journal of Cell Science. 123, (8), (2010).
  30. ten Have, S., Hodge, K., Lamond, A. I. Dynamic Proteomics: Methodologies and Analysis. Functional Genomics. Intechopen. (2012).
  31. Siano, G., et al. Tau Modulates VGluT1 Expression. Journal of Molecular Biology. 431, (4), 873-884 (2019).
  32. Serdar, B. S., Koçtürk, S., Akan, P., Erkmen, T., Ergür, B. U. Which Medium and Ingredients Provide Better Morphological Differentiation of SH-SY5Y Cells? Proceedings. 2, (25), 1577 (2018).
  33. Forster, J. I., et al. Characterization of differentiated SH-SY5Y as neuronal screening model reveals increased oxidative vulnerability. Journal of Biomolecular Screening. 21, (5), 496-509 (2016).
  34. Dwane, S., Durack, E., Kiely, P. A. Optimising parameters for the differentiation of SH-SY5Y cells to study cell adhesion and cell migration. BMC Research Notes. 6, (1), 1 (2013).
  35. Encinas, M., et al. Sequential Treatment of SH-SY5Y Cells with Retinoic Acid and Brain-Derived Neurotrophic Factor Gives Rise to Fully Differentiated, Neurotrophic Factor-Dependent, Human Neuron-Like Cells. Journal of Neurochemistry. 75, (3), 991-1003 (2002).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics