Single Cell Micro-aspirasjon som en alternativ strategi for å fluorescens-aktivert Cell sortering for Giant virus blanding separasjon

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en enkelt celle mikro-aspirasjon metode for separasjon av infiserte amøber. For å skille viral subpopulasjoner i Vermamoeba vermiformis smittet av Faustoviruses og ukjente gigantiske virus, utviklet vi protokollen detaljert nedenfor og demonstrerte sin evne til å skille to lav-overflod romanen gigantiske virus.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sahmi-Bounsiar, D., Boratto, P. V., Oliveira, G. P., Bou Khalil, J. Y., La Scola, B., Andreani, J. Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation. J. Vis. Exp. (152), e60148, doi:10.3791/60148 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Under Amoeba co-kultur prosessen, mer enn ett virus kan være isolert i en enkelt brønn. Vi har tidligere løst dette problemet ved sluttpunkt fortynning og/eller fluorescens aktivert celle sortering (FACS) brukes til viral befolkningen. Men når virus i blandingen har lignende morfologiske egenskaper og en av virusene multipliserer langsomt, er tilstedeværelsen av to virus oppdaget på scenen av Genova montering og virus kan ikke skilles for videre karakterisering. For å løse dette problemet, utviklet vi en enkelt celle mikro-aspirasjon prosedyre som gjør det mulig for separasjon og kloning av svært like virus. I dagens arbeid, presenterer vi hvordan denne alternative strategien tillot oss å skille de små viral subpopulasjoner av Clandestinovirus ST1 og Usurpativirus LCD7, gigantiske virus som vokser langsomt og ikke fører til amoebal lyse i forhold til lytisk og raskt voksende Faustovirus. Renhet kontroll ble vurdert av spesifikke gen forsterkning og virus ble produsert for videre karakterisering.

Introduction

Nucleocytoplasmic store DNA virus (NCLDV) er svært mangfoldig, definert av fire familier som infisere Landplantenes1. Det for det første beskrevet viruser med genomer over 300 KBP var Phydcodnaviridae, inkluderer amøbehjerne bursaria chlorella virus 1 PBCV12. Isolasjonen og den første beskrivelsen av Mimivirus, viste at størrelsen på viruset doblet i forhold til både størrelsen på partikkel (450 nm) og lengden på Genova (1,2 MB)3. Siden da har mange gigantiske virus blitt beskrevet, vanligvis isolert ved hjelp av en Amoeba co-kultur prosedyre. Adskillige giganten viruser med annerledes morfologier og genetisk innholdet kan isolere fra Acanthamoeba Sp. celler, inkluderer Marseilleviruses, Pandoraviruses, Pithoviruses, Mollivirus, Cedratviruses, Pacmanvirus, Tupanvirus, og i den seneste tid Medusavirus4,5,6,7,8,9,10,11,12, 13,14,15,16,17. Parallelt var isolasjonen av Vermamoeba vermiformis tillatt isolasjonen og beskrivelsen av de gigantiske virusene Faustovirus, Kaumoebavirus og Orpheovirus18,19,20. Andre gigantiske virus ble isolert med verts protister, som kafeteria roenbergensis21, Aureococcus anophagefferens22, Chrysochromulina ericina23og Bodø saltans 24. Alle disse isolasjoner var resultatet av et økende antall lag som jobbet med isolasjon og innføringen av strategi oppdateringer med høy gjennomstrømming25,26,27,28, slik som forbedring av co-kulturen systemet med bruk av Flow flowcytometri.

I 2016, vi brukte en strategi knytte co-kultur og flyt flowcytometri å isolere gigantiske virus27. Denne strategien ble utviklet for å øke antall prøver inokulert, å diversifisere protister brukt som celle støtter, og for raskt å oppdage lyse av cellen støtte. Systemet ble oppdatert ved å legge til et supplerende skritt for å unngå foreløpige molekylærbiologi identifisering og rask påvisning av en ukjent viral befolkning som i tilfelle av Pacmanvirus29. Koblings flyt flowcytometri til celle sortering som er tillatt ved separasjon av en blanding av Mimivirus og Cedratvirus A1130. Men vi senere møtte begrensningene av separasjon og påvisning av disse viral subpopulasjoner ved flyt flowcytometri. Etter sekvensering, når vi samlet genomer av Faustovirus ST125 og Faustovirus LCD7 (upubliserte data), vi overraskende funnet i hver forsamling to supplerende genomer av to romanen virus ikke identifisert i offentlige Genova databaser. Imidlertid viste verken flyt flowcytometri eller overføring av elektroniske mikroskopi (TEM) at amoebaes ble infisert av to forskjellige virus, Clandestinovirus ST1 og Usurpativirus LCD7. Vi utformet spesifikke PCR-systemer for å forsterke Faustovirus, Usurpativirus, og Clandestinovirus markører henholdsvis basert på deres genomer; vårt formål var å ha PCR-baserte systemer som muliggjør verifisering av renheten av virusene blir separert. Imidlertid klarte ikke ende punkts fortynning og strømnings flowcytometri å skille dem. Isolasjonen av denne ene viral befolkningen var vanskelig fordi verken morfologi eller replicative elementer av Clandestinovirus og Usurpativirus befolkninger har blitt karakterisert. Vi oppdaget bare en viral befolkning av flyte flowcytometri på grunn av det overlappe av det to befolkninger (testet etter det effektiv atskillelse). Vi prøvde å skille dem ved hjelp av én partikkel sortering på 96-brønn plater, men vi observerte ingen Cytopathic effekter, og vi oppdaget verken Clandestinovirus eller Usurpativirus av PCR-forsterkning. Til slutt var det bare kombinasjonen av endepunktet fortynning etterfulgt av singel Amoeba mikro-aspirasjon som aktiverte separasjon av disse to lav-overflod gigantiske virus fra Faustoviruses. Denne metoden for separasjon er gjenstand for denne artikkelen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Amoeba kultur

  1. Bruk Vermamoeba vermiformis (stamme CDC19) som en celle støtte.
  2. Tilsett 30 mL protease-peptone-gjærekstrakt-glukose medium (PYG) (tabell 1) og 3 ml av amøber ved en konsentrasjon på 1 x 106 celler/ml i en 75 cm2 cellekultur kolbe.
  3. Oppretthold kulturen ved 28 ° c.
  4. Etter 48 h, kvantifisere amøber ved hjelp av telling lysbilder.
  5. For å skylle, høste cellene ved en konsentrasjon på 1 x 106 celler/ml og pellet amøber ved sentrifugering ved 720 x g for 10 min. Fjern supernatanten og resuspend pellet i riktig volum av sult medium for å få 1 x 106 celler/ml (tabell 1).

2. forplantning av Stock virus i amøber

Merk: Før fortynning, er det viktig å kultur aksjen prøven for å få nok frisk kultur, og deretter gå videre til filtrering.

  1. Bruk 1 x 106 av Amoeba kultur i sult medium.
  2. Vaksinere blandingen av virus utstedt fra aksjen løsning (Faustovirus/Usurpativirus LCD7 eller Faustovirus/Clandestinovirus ST1) etter co-kulturen prosessen på cellen støtte på et mangfold av smitte (MOI) av 0,01.
    Merk: Den MOI er viktig å redusere overflod av de store viral befolkning og antall infiserte celler.
  3. Ruge ved 30 ° c til Cytopathic effekter (CPE) er indusert, slik som amoebal avrunding eller lyse, ca 10 til 14 h etter smitte.
  4. Samle mediene og Filtrer gjennom et 5 μm filter for å fjerne mobilnettet rusk.

3. sluttpunkt fortynning

  1. Utfør en seriell fortynning (10-1 til 10-11) av viral prøven i sult medium (tabell 1).
  2. Vaksinere 2 mL 1 x 106 Vermamoeba vermiformis som finnes i hver Petri rett med 100 μL av blandingen inokulum.
  3. Plasser Petri-rettene i en sealable plastpose ved 30 ° c.
  4. Begynn å observere Petri retter med invertert optiske mikroskopi ved 6 h postinfection og sjekk celle morfologi hver 4 til 8 h.
  5. Ved utseendet på Cytopathic effekten karakterisert ved avrunding celler, begynner enkelt celle mikro-aspirasjon prosessen.

4. enkelt celle mikro-aspirasjon

  1. Forbered verten.
    Merk:
    dette preparatet er laget for utgivelsen av infiserte enkeltceller til en frisk celle støtte.
    1. Behandle amøber i kulturen med et antimikrobielle middel som inneholder 10 μg/mL Vancomycin, 10 μg/mL imipenem, 20 μg/mL av Ciprofloxacin, 20 μg/mL av Doxycycline og 20 μg/mL vorikonazol. Denne blandingen brukes for å unngå bakteriell og sopp forurensning.
      Merk: Prosedyren finner sted på en benk utenfor mikrobiologisk sikkerhets stasjon. Tilsett 2 mL amøber konsentrert til 1 x 106 celler/ml hver i 15 Petri retter. For Amoeba overholdelse ruge kulturen ved 30 ° c i 30 min.
  2. Velg Petri parabolen brukes for mikro-aspirasjon fra grensen fortynning i henhold til følgende kriterier: 1) fravær av noen synlig forurensning av sopp og bakterielle midler, 2) bevis for Cytopathic effekten av amøber på grunn av virus, og 3) prelysis og avrunding fase av amøber (for å unngå aspirasjon av viral partikler).
  3. Sett opp en arbeidsstasjon med følgende materialer (se figur 1a, B):
    Micromanipulator, som tillater microcapillary posisjonering;
    Manuell kontroll trykk anordning, brukes til å aspirer og slipp cellene inn i microcapillary;
    Invertert mikroskop;
    Plug and Play motor moduler;
    Kamera
    Computer modul for å visualisere manipulasjon og ta bilder.
  4. Velg en microcapillary (se figur 1C).
    Merk: Størrelsen på cellene, deformasjon og vedheft av sine membraner til overflater, og mobilnettet motilitet kan påvirke jevn fremgang av mikro-aspirasjon. Den microcapillary diameter kan velges nøyaktig og tilpasses bestemte celletyper avhengig av deres størrelser og metoder for aspirasjon. En microcapillary på 20 μm indre diameter ble brukt til å aspirer en avrundings Amoeba (diameter ~ 10 μm). Dette gjør at vedlikehold av en intern posisjon og en enkel utgivelse av cellen.
  5. Monter systemet.
    1. Fest drifts vinkelen på det gripende systemet på den motoriserte modulen ved 45 °.
    2. Utfør en dobbel installasjon, først på det gripende systemet, og deretter på microcapillary.
    3. Fokuser på cellene etter å ha kjørt noen få dråper olje gjennom microcapillary.
      Merk: Mineral oljen med biologisk kompatibilitet leveres av enheten.
    4. Komplett montering etter produsentens anbefalinger.
  6. Klon celler (se figur 2A, B).
    Merk:
    denne fremgangsmåten ligner på den som er beskrevet av Fröhlich og König31.
    1. Plasser Petri-fatet som inneholder 2 mL infiserte amøber under mikroskopet.
    2. Fokuser først på cellene, og deretter på microcapillary nedsenket i kulturen.
    3. Velg en avrundet enkelt celle og bringe microcapillary nærmere micromanipulator.
    4. Utøve myk aspirasjon med manuell trykk kontroll på cellen, tar den inne i microcapillary. Fjern enkeltcellen fra den første prøven og slipp den i mobil støtten, og ruge den deretter ved 30 ° c.
    5. Utføre daglige observasjoner med en invertert optisk mikroskop for å observere utseendet på cellene og å overvåke fremveksten av Cytopathic effekt.

5. PCR-screening

Merk: Etter trinn 4 er en systematisk screening av PCR avgjørende for å bekrefte separasjon. I både Usurpativirus/Faustovirus og Clandestinovirus/Faustovirus, design og anvendelse av de spesifikke primer og sonde systemer ble gjort ved hjelp av primer-BLAST online32 (tabell 2).

  1. Ekstrakt DNA fra en del av den positive kulturen prøvene (dvs. hvor en Cytopathic effekt er observert), ved hjelp av en automatisert ekstraksjon system i henhold til produsentens protokoll.
  2. Bruk hensiktsmessig utformet primere.
    Merk: Her har vi designet primere for å forsterke kjernen gener kommentert som RpB2 (Faustovirus), LCD7 store kapsid protein (Usurpatvirus) og mindre kapsid protein (Clandestinovirus)
  3. Utfør standard PCR ved hjelp av en thermocycler.
    1. Gjennomfør 20 μL PCR-reaksjoner med 50 μM av hver primer (tabell 2), 1X Master mix og RNase fritt vann.
    2. Aktiver Taq DNA-polymerase i 5 min ved 95 ° c, og følg deretter med 45 sykluser på 10 s denaturering ved 95 ° c, annealing av primere for 30 s ved 58 ° c, og utvidelse for 30 s ved 72 ° c.
  4. Kjør PCR-produktene på en 1,5% agarose gel, beis med DNA gel flekken (tabell av materialer), og VISUALISERE med UV.

6. virus produksjon og rensing

  1. Sett resten av Petri parabolen kulturen tilbake i en liten kolbe.
  2. For virus produksjonen klargjør du 15 flasker med 145 cm2, som inneholder 40 ml Vermamoeba vermiformis i sult medium og 5 ml av det isolerte viruset som allerede er overført fra Petri-fatet til små flasker.
  3. Behandle med samme antibiotika og Antifungal blanding som brukes i trinn 4,1.
  4. Ruge ved 30 ° c. Observer hver dag med invertert optisk mikroskopi.
  5. Etter den komplette infeksjonen, bassenget alle flasker. Bruk et filter på 0,45 μm for å eliminere rusk.
  6. Ultracentrifuge alle supernatanter på 50 000 x g for 45 min.
  7. Etter sentrifugering, Fjern supernatanten fra hvert rør ved aspirasjon og resuspend pellet i 1 mL fosfat bufret saltvann (PBS).
  8. Rens viruset som produseres ved hjelp av 25% sukrose (27,5 g sukrose i 100 mL av PBS, sterilisert ved filtrering).
  9. Sentrifuger 8 mL sukrose og 2 mL av viral suspensjonen ved 80 000 x g i 30 min. Resuspend viral pellet i 1 ml PBS. Oppbevar det ved-80 ° c.

7. negative farging og Transmission Electron mikroskopi

Merk: Bou Khalil et al. tidligere publisert denne protokollen27.

  1. Sett 5 μL av lyse supernatanten på det lyse nettet. La virke i ca 20 min ved romtemperatur.
    Merk: Gløden-utslippet tillater oss å få en hydrofile rutenett ved plasma søknad.
  2. Tørk rutenettet nøye og sett inn en liten dråpe på 1% ammonium molybdat på den i 10 s. la rutenettet tørke i 5 minutter.
  3. Fortsett til elektron mikroskopi observasjoner på 200 keV.

8. karakterisering av Clandestinovirus ST1 og Usurpativirus LCD7

  1. Karakterisere ren befolkninger av Clandestinovirus ST1 og Usurpativirus LCD7 benytter Genova sekvensering, Genova samlingen, bioinformatikk analyserer, og studere av deres replicative syklus idet vi har gjort for annet viruser10,20, 29.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Enkelt celle mikro-aspirasjon er en mikromanipulering prosess optimalisert i dette manuskriptet (figur 1). Denne teknikken gjør det mulig å fange opp en avrundet, infisert Amoeba (figur 2a) og dens utgivelse i en roman plate som inneholder infisert amøber (figur 2). Det er en funksjonell prototype som gjelder for co-kulturen systemet og har lykkes isolert ikke-lytisk gigantiske virus. Denne tilnærmingen ble brukt for første gang i feltet av gigantiske virus og gjorde det mulig å isolere to nye lav-overflod gigantiske virus. Vi kalte den nye virus Clandestinovirus ST1 og Usurpativirus LCD7, som var i lav overflod i forhold til høy overflod Faustoviruses. For å analysere viral tilstedeværelse i hver plate etter mikro-aspirasjon prosedyren, søkte vi PCR på 15 mikro-ambisjoner. Vi observerte ren Usurpativirus (tilstedeværelsen av Usurpativirus LCD7 [+] og fravær av Faustovirus [–]) bare i klone 7 (Figur 3). Renheten av klone ble bekreftet av PCR med bestemte protokoller rettet mot Clandestinovirus ST1 og Usurpativirus LCD7 (tabell 2). Electron mikroskopi avslørte utseendet til Clandestinovirus ST1 og Usurpativirus LCD7 (Figur 4), som har en typisk icosahedral morfologi uten fibrils og en icosahedral kapsid på ca 250 NM, henholdsvis. Etter bekreftelse av produksjonen renhet, klonal viruset ble produsert og renset for hele Genova sekvensering og videre karakterisering, spesielt overføring elektronisk mikroskopi (TEM) for multiplikasjon syklus studier. Vi bekreftet overlapping av populasjoner (Faustovirus/Novel virus) av Flow flowcytometri (figur 5).

Figure 1
Figur 1: materialer for mikromanipulering. (A) faktisk oppsett av arbeidsstasjonen. (B) skjematisk illustrasjon av arbeidsstasjonens komponenter. (C) skjematisk illustrasjon av microcapillary. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: mikro-aspirasjon trinn. (A) isolasjons prosedyre for enkelt celle (Zoom-x40). (B) skjematisk illustrasjon av de ulike trinnene av enkelt celle aspirasjon: 1) lokalisering av cellen. 2) aspirasjon av cellen. 3) slipp trinn. De svarte pilene viser microcapillary og de hvite viser enkeltcellen. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: PCR screening og bekreftelse. Screening av PCR av mikro-ambisjoner utført for Usurpativirus LCD7 og Faustovirus. Tilstedeværelsen av Usurpativirus LCD7 DNA (+) og fravær av Faustovirus DNA (-) observert for klone 7 etter mikro-aspirasjon prosedyre. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: negative farging mikroskop. Negative flekker av viral suspensjon, viser ren Clandestinovirus ST1 (A) og Usurpativirus LCD7 (B). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: representative gate tomter. (A) superimposition av hver enkelt viral befolkning tidligere farget med fluorescerende molekylære sonder for virus DNA merking (følgende tidligere beskrevet protokoll26,30). Den venstre delen av bildet viser superposisjon av fem stammer av Faustovirus (mørk grønn, lys grønn, oransje, rød og blå). På høyre side er superposisjon av Faustovirus ST1 og Clandestinovirus ST1 (lys lilla og mørk lilla) synlig. (B) tilstedeværelsen av to viral befolkning på Faustovirus og Usurpativirus i samme gate som Faustovirus (venstre).  En prikk plott av ren Usurpativirus viser samme gate definert tidligere for Faustovirus (høyre). Vennligst klikk her for å se en større versjon av dette tallet.

PYG sammensetning Mengder
Proteose peptone 20 g
Gjærekstrakt 20 g
MgSO4· 7H2O 0,980 g
CaCl2 0,059 g
Citrate natrium. Dinatriumfosfatdihydrat 1 g
Fe (NH4) 2 (so4) 2 x 6h2O 0,02 g
Glukose 18 g
Destillert vann 1 den andre
Juster pH på 6,8 med HCl eller KOH
Autoklav 15 min ved 121 ° c
Sult medium quantites
Gjærekstrakt 2 gram med
Glukose 18 g
Fe (NH4) 2 (so4) 2 x 6h2O 0,02 g
PAS (detaljert nedenfor) 1 den andre
PAS-løsning A quantites
KH2PO4 0,136 g
Na2HPO4 0,142 g
PAS løsning B quantites
MgSO4· 7H2O 4,0 mg
CaCl2· 2h2O 4,0 mg
Nacl 0,120 g
10 mL hver av oppløsningen A og B tilsettes i 1 L av destillert vann.

Tabell 1: sammensetning av kultur Media.

Virus mål Mål genet Foward primer (5-> 3) Omvendt primer (5-> 3)
Faustovirus RpB2 RpB2 CWCAATCHGCYGATACHGGTGA TGATTWGCYAATGGNGCYGC
Usurpatvirus LCD7 Major kapsid genet Major kapsid genet GGGCAAGAAGCTCCAAGCTA GGGTTGAGGAGGAGTCAACG
Clandestinovirus ST1 Minor kapsid genet Mindre kapsid gen AAAATGAACGCGTTGGAGGC ACCGGCGAATGTTCCTATGG

Tabell 2: Primmer sekvenser som brukes for PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Varigheten av enkelt celle mikro-aspirasjon håndtering og god funksjon er operatøravhengig. De ulike trinnene i eksperimentet krever presisjon. Bruken av de mikromanipulering komponentene i arbeidsstasjonen må være under konstant kontroll ved å observere prosessen med mikro-aspirasjon og utgivelsen av cellen. Oppfølgingen av mikroskopisk observasjon er nødvendig for fangst og overføring av en celle. En erfaren operatør kan ta 1 til 2 t for å isolere 10 celler og skrivermodeller dem en etter en, avhengig av overflod av virus som skal isoleres. Antallet manipulasjoner kan variere. Vi anbefaler at du begynner med 10 manipulasjoner. Per definisjon vet vi ikke de iboende egenskapene til det ukjente viruset. Således, bruk og utvikling av ulike strategier for isolasjon er nødvendig for å optimalisere suksessen til å skille disse virusene.

Mikro-aspirasjon prosessen utføres under unsterile forhold (på en benk utenfor mikrobiologisk sikkerhets stasjon) og dermed begrenser bruken og hindrer dens anvendelse for studiet av menneskelige patogener. Derfor er bruken av en blanding av antibiotika og antifungals for å begrense forurensninger obligatorisk. En annen begrensning av metoden er at den bare kan utføres på mikroorganismer synlig ved lys mikroskopi som mikromanipulering komponenter ble montert, og dermed konseptuelt eliminere noe arbeid på mikroorganismer ikke synlig ved lys mikroskopi. Men vi var i stand til å skille gigantiske virus på ca 200 NM som forblir usynlig under lyset mikroskop ved hjelp av en indirekte strategi bestående av skille og kloning av infiserte verter.

Utviklingen av enkelt celle mikro-aspirasjon for amoebal fangst er en del av utviklingen av befolkningen-sortering metoder. Enkelt celle mikro-aspirasjon tillot oss å isolere to nye gigantiske virus, Clandestinovirus ST1 og Usurpativirus LCD7, med egenskaper karakteristisk fra Faustoviruses. Den svært tilsvarende morfologiske egenskaper av både Clandestinovirus ST1 og Usurpativirus LCD7 til Faustovirus LCD7 og deres forskjell på replikering viser grensen for FACS, som vanligvis brukes i gigantiske virus sortering. Det er representert ved superposisjon av to virale populasjoner, Clandestinovirus ST1 og Faustovirus ST1 (figur 5A) og også av påvisning for USUPARTIVIRUS LCD7 og Faustovirus LCD7. Men med denne nye metoden, hele manipulasjon er under visuell kontroll med nøye overvåking av cellen og dens integritet selv etter utgivelsen. Bruken av Flow flowcytometri å direkte sortere infiserte amøber kan være en alternativ løsning for indirekte sortere romanen virus. Denne metoden er vanligvis etterfulgt av screening av platen for å oppdage Cytopathic effekter eller lyse. Tilstedeværelsen av ikke-lytisk virus i miksen kan representere en grense for amoebal sortering. Men dette ble ikke utforsket i etableringen av denne protokollen og for disse to romanen isolasjoner.

Utover anvendelsen av mikromanipulering i posisjonering og Holding av celler generelt og oocytter for Intracytoplasmatisk sperm injeksjon (ICSI)33, enkelt celle mikro-aspirasjon har vist seg å være en praktisk metode for isolering av enkelt prokaryote celler synlig under et optisk mikroskop31. Andre programmer kan testes, inkludert celle sortering på morfologiske grunnlag for å ha forskjellige rene prøver fra et blandet utvalg av mikroorganismer. Den Observer separasjon av mikroorganismer kan være seg ved hjelp av strategien beskrevet ovenfor.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle forfattere har ingenting å avsløre.

Acknowledgments

Forfatterne vil gjerne takke både Jean-Pierre Baudoin og Olivier Mbarek for deres råd og Claire Andréani for hennes hjelp på engelsk rettelser og modifikasjoner. Dette arbeidet ble støttet av en bevilgning fra den franske staten forvaltes av National Research Agency under "Investissements d'avenir (investeringer for fremtiden)" program med referanse ANR-10-IAHU-03 (Méditerranée infeksjon) og ved Région Provence Alpes Côte d'Azur og europeisk finansiering FEDER PRIMI.

Materials

Name Company Catalog Number Comments
Agarose Standard Euromedex Unkown Standard PCR
AmpliTaq Gold 360 Master Mix Applied Biosystems 4398876 Standard PCR
CellTram 4r Oil Eppendorf 5196000030 Control the cells during the microaspiration process
Corning cell culture flasks 150 cm2 Sigma-aldrich CLS430825 Culture
Corning cell culture flasks 25 cm2 Sigma-aldrich CLS430639 Culture
Corning cell culture flasks 75 cm2 Sigma-aldrich CLS430641 Culture
DFC 425C camera LEICA Unkown Observation/Monitoring
Eclipse TE2000-S Inverted Microscope Nikon Unkown Observation/Monitoring
EZ1 advanced XL Quiagen 9001874 DNA extraction
Glasstic Slide 10 with Counting Grids Kova International 87144E Cell count
Mastercycler nexus Eppendorf 6331000017 Standard PCR
Microcapillary 20 µm Eppendorf 5175 107.004 Microaspiration and release of cells
Micromanipulator InjectMan NI2 Eppendorf 631-0210 Microcapillary positioning
Nuclease-Free Water ThermoFischer AM9920 Standard PCR
Optima XPN Ultracentrifuge BECKMAN COULTER A94469 Virus purification
Petri dish 35 mm Ibidi 81158 Culture/observation
Sterile syringe filters 5 µm Sigma-aldrich SLSV025LS Filtration
SYBR green Type I Invitrogen unknown Fluorescent molecular probes/flow cytometry
SYBR Safe Invitrogen S33102 Standard PCR; DNA gel stain
Tecnai G20 FEI Unkown Electron microscopy
Type 70 Ti Fixed-Angle Titanium Rotor BECKMAN COULTER 337922 Virus purification
Ultra-Clear Tube, 25 x 89 mm2 BECKMAN COULTER 344058 Virus purification

DOWNLOAD MATERIALS LIST

References

  1. Iyer, L. M., Aravind, L., Koonin, E. V. Common Origin of Four Diverse Families of Large Eukaryotic DNA Viruses. Journal of Virology. 75, (23), 11720-11734 (2001).
  2. Li, Y., et al. Analysis of 74 kb of DNA located at the right end of the 330-kb chlorella virus PBCV-1 genome. Virology. 237, (2), 360-377 (1997).
  3. Scola, B. L. A Giant Virus in Amoebae. Science. 299, (5615), 2033 (2003).
  4. Philippe, N., et al. Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes. Science. 341, (6143), 281-286 (2013).
  5. Antwerpen, M. H., et al. Whole-genome sequencing of a pandoravirus isolated from keratitis-inducing acanthamoeba. Genome Announcements. 3, (2), 00136-00215 (2015).
  6. Legendre, M., et al. Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology. Proceedings of the National Academy of Sciences of the United States of America. 111, (11), 4274-4279 (2014).
  7. Legendre, M., et al. In-depth study of Mollivirus sibericum, a new 30,000-y-old giant virus infecting Acanthamoeba. Proceedings of the National Academy of Sciences of the United States of America. 112, (38), 5327-5335 (2015).
  8. Legendre, M., et al. Diversity and evolution of the emerging Pandoraviridae family. Nature Communications. 9, (1), 2285 (2018).
  9. Aherfi, S., et al. A Large Open Pangenome and a Small Core Genome for Giant Pandoraviruses. Frontiers in Microbiology. 9, 166 (2018).
  10. Andreani, J., et al. Cedratvirus, a Double-Cork Structured Giant Virus, is a Distant Relative of Pithoviruses. Viruses. 8, (11), 300 (2016).
  11. Rodrigues, R. A. L., et al. Morphologic and genomic analyses of new isolates reveal a second lineage of cedratviruses. Journal of Virology. 00372 (2018).
  12. Bertelli, C., et al. Cedratvirus lausannensis- digging into Pithoviridaediversity. Environmental Microbiology. (2017).
  13. Levasseur, A., et al. Comparison of a modern and fossil Pithovirus reveals its genetic conservation and evolution. Genome Biology and Evolution. (2016).
  14. Dornas, F. P., et al. A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae. Viruses. 8, (3), 76 (2016).
  15. Yoshikawa, G., Blanc-Mathieu, R., et al. Medusavirus, a novel large DNA virus discovered from hot spring water. Journal of Virology. (2019).
  16. Legendre, M., et al. Pandoravirus Celtis Illustrates the Microevolution Processes at Work in the Giant Pandoraviridae Genomes. Frontiers in Microbiology. 10, 430 (2019).
  17. Abrahão, J., et al. Tailed giant Tupanvirus possesses the most complete translational apparatus of the known virosphere. Nature Communications. 9, (1), 749 (2018).
  18. Reteno, D. G., et al. Faustovirus, an asfarvirus-related new lineage of giant viruses infecting amoebae. Journal of Virology. 89, (13), 6585-6594 (2015).
  19. Bajrai, L., et al. Kaumoebavirus, a New Virus That Clusters with Faustoviruses and Asfarviridae. Viruses. 8, (12), 278 (2016).
  20. Andreani, J., et al. Orpheovirus IHUMI-LCC2: A New Virus among the Giant Viruses. Frontiers in Microbiology. 8, 779 (2018).
  21. Fischer, M. G., Allen, M. J., Wilson, W. H., Suttle, C. A. Giant virus with a remarkable complement of genes infects marine zooplankton. Proceedings of the National Academy of Sciences of the United States of America. 107, (45), 19508-19513 (2010).
  22. Moniruzzaman, M., et al. Genome of brown tide virus (AaV), the little giant of the Megaviridae, elucidates NCLDV genome expansion and host-virus coevolution. Virology. 466-467, 60-70 (2014).
  23. Gallot-Lavallée, L., Blanc, G., Claverie, J. -M. Comparative genomics of Chrysochromulina Ericina Virus (CeV) and other microalgae-infecting large DNA viruses highlight their intricate evolutionary relationship with the established Mimiviridae family. Journal of Virology. (2017).
  24. Deeg, C. M., Chow, C. -E. T., Suttle, C. A. The kinetoplastid-infecting Bodo saltans virus (BsV), a window into the most abundant giant viruses in the sea. eLife. 7, 235 (2018).
  25. Boughalmi, M., et al. High-throughput isolation of giant viruses of the Mimiviridae and Marseilleviridae families in the Tunisian environment. Environmental Microbiology. 15, (7), 2000-2007 (2013).
  26. Khalil, J. Y. B., et al. High-Throughput Isolation of Giant Viruses in Liquid Medium Using Automated Flow Cytometry and Fluorescence Staining. Frontiers in Microbiology. 7, (120), 26 (2016).
  27. Bou Khalil, J. Y., Andreani, J., Raoult, D., La Scola, B. A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis. Journal of Visualized Experiments : JoVE. (112), e54104 (2016).
  28. Khalil, J. Y. B., Andreani, J., La Scola, B. Updating strategies for isolating and discovering giant viruses. Current Opinion in Microbiology. 31, 80-87 (2016).
  29. Andreani, J., et al. Pacmanvirus, a new giant icosahedral virus at the crossroads between Asfarviridae and Faustoviruses. Journal of Virology. (2017).
  30. Khalil, J. Y. B., et al. Flow Cytometry Sorting to Separate Viable Giant Viruses from Amoeba Co-culture Supernatants. Frontiers in Cellular and Infection Microbiology. 6, 17722 (2017).
  31. Fröhlich, J., König, H. New techniques for isolation of single prokaryotic cells. FEMS Microbiology Reviews. 24, (5), 567-572 (2000).
  32. Ye, J., et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  33. Kimura, Y., Yanagimachi, R. Intracytoplasmic sperm injection in the mouse. Biology of Reproduction. 52, (4), 709-720 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics