Single cell micro-aspiratie als alternatieve strategie voor de fluorescentie-geactiveerde celsortering voor scheiding van gigantische virus mengsels

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschrijven we een enkele cel micro-aspiratie methode voor de scheiding van geïnfecteerde amoebae. Om virale subpopulaties te scheiden in Vermamoeba vermiformis geïnfecteerd door Faustovirussen en onbekende reus virussen, ontwikkelden we het protocol hieronder beschreven en toonden zijn vermogen om twee laag-overvloed roman reus virussen scheiden.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sahmi-Bounsiar, D., Boratto, P. V., Oliveira, G. P., Bou Khalil, J. Y., La Scola, B., Andreani, J. Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation. J. Vis. Exp. (152), e60148, doi:10.3791/60148 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tijdens het cocultuurproces van amoeba kan meer dan één virus in één put worden geïsoleerd. We hebben dit probleem eerder opgelost door verdunning van het eindpunt en/of fluorescentie geactiveerde celsortering (FACS) toegepast op de virale populatie. Wanneer de virussen in het mengsel echter vergelijkbare morfologische eigenschappen hebben en een van de virussen langzaam vermenigvuldigt, wordt de aanwezigheid van twee virussen ontdekt in het stadium van genoom assemblage en kunnen de virussen niet worden gescheiden voor verdere karakterisering. Om dit probleem op te lossen, ontwikkelden we een eencellige micro-aspiratie procedure die het mogelijk maakt om sterk vergelijkbare virussen te scheiden en te klonen. In het huidige werk presenteren we hoe deze alternatieve strategie ons in staat stelde om de kleine virale subpopulaties van Clandestinovirus ST1 en Usurpativirus LCD7 te scheiden, gigantische virussen die langzaam groeien en niet leiden tot amoebal lysis in vergelijking met de lytische en snelgroeiende Faustovirus. De zuiverheids controle werd beoordeeld door specifieke genamplificatie en virussen werden geproduceerd voor verdere karakterisering.

Introduction

Nucleocytoplasmische grote DNA-virussen (NCLDV) zijn zeer divers, gedefinieerd door vier families die eukaryoten1infecteren. De eerste beschreven virussen met genomen boven 300 KBP waren phydcodnaviridae, waaronder Paramecium bursaria Chlorella virus 1 PBCV12. De isolatie en de eerste beschrijving van Mimivirus, toonde aan dat de grootte van de virussen verdubbeld in termen van zowel de grootte van het deeltje (450 nm) en de lengte van het genoom (1,2 MB)3. Sindsdien zijn veel reusachtige virussen beschreven, meestal geïsoleerd met behulp van een amoeba-co-cultuur procedure. Verschillende reusachtige virussen met verschillende morfologieën en genetische inhoud kunnen worden geïsoleerd uit Acanthamoeba SP. cellen, met inbegrip van Marseillevirussen, Pandoravirussen, Pithovirussen, Mollivirus, Cedratvirussen, Pacmanvirus, tupanvirus, en onlangs Medusavirus4,5,6,7,8,9,10,11,12, 13,14,15,16,17. Parallel, de isolatie van vermamoeba vermiformis toegestaan de isolatie en de beschrijving van de gigantische virussen faustovirus, kaumoebavirus, en orpheovirus18,19,20. Andere reusachtige virussen werden geïsoleerd met hun gastheer protisten, zoals cafetaria roenbergensis21, aureococcus anophagefferens22, Chrysochromulina ericina23, en Bodo saltans 24. Al deze isolaties waren het resultaat van een toenemend aantal teams die werkten aan isolatie en de introductie van een high-throughput strategie updates25,26,27,28, zoals de verbetering van het co-cultuur systeem met het gebruik van flow cytometrie.

In 2016 gebruikten we een strategie die co-cultuur en flow cytometrie aan het koppelen was om gigantische virussen27te isoleren. Deze strategie is ontwikkeld om het aantal geënt monsters te verhogen, om protisten te diversifiëren die worden gebruikt als celondersteuningen, en om snel de lysis van de celsteun te detecteren. Het systeem werd bijgewerkt door een aanvullende stap toe te voegen om voorlopige moleculaire biologie-identificatie en snelle detectie van een onbekende virale populatie te voorkomen, zoals in het geval van Pacmanvirus29. Koppelings stroom cytometrie naar celsortering toegestaan voor scheiding van een mengsel van Mimivirus en Cedratvirus A1130. Echter, we later ondervonden de beperkingen van de scheiding en detectie van deze virale subpopulaties doorstroming cytometrie. Na de sequencing, toen we de genomen van faustovirus ST125 en faustovirus LCD7 (niet-gepubliceerde gegevens) geassembleerd, we verrassend gevonden in elke vergadering twee aanvullende genomen van twee nieuwe virussen niet geïdentificeerd in het openbaar genoom databases. Echter, noch flow flowcytometrieonderzoeken noch transmissie elektronische microscopie (TEM) toonde aan dat de amoebaes werden geïnfecteerd door twee verschillende virussen, clandestinovirus ST1 en usurpativirus LCD7. We hebben specifieke PCR-systemen ontworpen om respectievelijk de markers van Faustovirus, Usurpativirus en Clandestinovirus te versterken op basis van hun Genomes; ons doel was om PCR-gebaseerde systemen te hebben die verificatie mogelijk maken van de zuiverheid van de virussen die worden gescheiden. Eindpunt verdunning en flow cytometrie echter niet om ze te scheiden. De isolatie van deze enkelvoudige virale populatie was moeilijk omdat noch de morfologie noch replicatieve elementen van Clandestinovirus en Usurpativirus populaties zijn gekenmerkt. We hebben slechts één virale populatie doorstroming cytometrie gedetecteerd vanwege de overlapping van de twee populaties (getest na de effectieve scheiding). We probeerden ze te scheiden met behulp van enkelvoudige deeltjes sortering op 96-well-platen, maar we hebben geen cytopathische effecten waargenomen, en we hebben geen Clandestinovirus of Usurpativirus gedetecteerd door PCR-versterking. Tot slot, het was alleen de combinatie van eindpunt verdunning gevolgd door enkele amoeba micro-aspiratie die de scheiding van deze twee laag-overvloed reus virussen van Faustovirussen ingeschakeld. Deze scheidingsmethode is het object van dit artikel.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. amoeba-cultuur

  1. Gebruik Vermamoeba vermiformis (strain CDC19) als een celsteun.
  2. Voeg toe 30 ml protease-peptone-gistextract-glucose medium (pyg) (tabel 1) en 3 ml eencellige in een concentratie van 1 x 106 cellen/ml in een 75 cm2 celkweek kolf.
  3. Behoud de cultuur bij 28 °C.
  4. Na 48 h Kwantificeer je de eencellige met teldia's.
  5. Om te spoelen, oogst de cellen in een concentratie van 1 x 106 cellen/ml en pellet de eencellige door centrifugeren bij 720 x g gedurende 10 min. Verwijder het supernatant en regeer de pellet in de juiste hoeveelheid verhongering medium om 1 x 106 te verkrijgen cellen/ml (tabel 1).

2. voortplanting van het voorraad virus in Amoebae

Opmerking: Vóór verdunning is het belangrijk om het voorraad monster te kweken om voldoende verse cultuur te verkrijgen en vervolgens naar filtratie te gaan.

  1. Gebruik 1 x 106 van de amoeba-cultuur in het verhongering medium.
  2. Inoculeren het mengsel van virussen afgegeven uit de stamoplossing (Faustovirus/Usurpativirus LCD7 of Faustovirus/Clandestinovirus ST1) na het co-cultuur proces op de cel ondersteuning bij een veelheid van infectie (MOI) van 0,01.
    Opmerking: De MOI is belangrijk om de overvloed van de grote virale populatie en het aantal geïnfecteerde cellen te verminderen.
  3. Inincuberen bij 30 °C totdat cytopathische effecten (CPE) worden geïnduceerd, zoals een amoebal afronding of lysis, ongeveer 10 tot 14 h na infectie.
  4. Verzamel de media en het filtraat via een 5 μm filter om cellulair puin te verwijderen.

3. eindpunt verdunning

  1. Voer een seriële verdunning (10-1 tot 10-11) van het virale monster in het verhongering middel (tabel 1).
  2. Inoculeren 2 mL 1 x 106 vermamoeba vermiformis in elke Petri schaal met 100 μL van het inoculum van het mengsel.
  3. Plaats de Petri schaaltjes in een afsluitbare plastic zak op 30 °C.
  4. Begin met het observeren van de Petri schaaltjes met omgekeerde optische microscopie bij 6 h postinfectie en controleer de celmorfologie elke 4 tot 8 uur.
  5. Bij het verschijnen van het cytopathische effect dat wordt gekenmerkt door Afrondings cellen, begint het eencellige micro-aspiratie proces.

4. eencellige micro-aspiratie

  1. Bereid de host voor.
    Opmerking:
    deze voorbereiding is gemaakt voor het vrijkomen van geïnfecteerde afzonderlijke cellen aan een nieuwe cel ondersteuning.
    1. Behandel het eencellige in de cultuur met een antimicrobieel middel dat 10 μg/ml vancomycine, 10 μg/ml imipenem, 20 μg/ml ciprofloxacine, 20 μg/ml doxycycline en 20 μg/ml voriconazol bevat. Dit mengsel wordt gebruikt om bacteriële en schimmel besmetting te voorkomen.
      Opmerking: De procedure vindt plaats op een bank buiten het microbiologische veiligheids station. Voeg toe 2 ml eencellige geconcentreerd op 1 x 106 cellen/ml elk in 15 Petri schalen. Voor de hechting van amoeba, incuberen de cultuur bij 30 °C gedurende 30 minuten.
  2. Selecteer de Petri schaal die wordt gebruikt voor de micro-aspiratie van de grens verdunning volgens de volgende criteria: 1) afwezigheid van zichtbare verontreiniging door schimmel-en bacteriële agentia, 2) bewijs van cytopathisch effect van eencellige als gevolg van de virussen, en 3) prelyse en afrondingsfase van het eencellige (om aspiratie van virale deeltjes te voorkomen).
  3. Stel een werkstation in met de volgende materialen (Zie Figuur 1a, B):
    Micromanipulator, die microcapillaire positionering mogelijk maakt;
    Handmatige controledruk apparaat, gebruikt om aspireren en laat de cellen in de microcapillair;
    Omgekeerde Microscoop;
    Plug en Play motor modules;
    Camera
    Computer module om manipulatie te visualiseren en foto's te maken.
  4. Kies een micro capillair (Zie Figuur 1C).
    Opmerking: De grootte van de cellen, de vervorming en hechting van hun membranen op de oppervlakken, en de cellulaire beweeglijkheid kan invloed hebben op de soepele voortgang van de micro-aspiratie. De microcapillaire diameter kan nauwkeurig worden gekozen en aangepast aan specifieke celtypen, afhankelijk van hun grootte en methoden van aspiratie. Een microcapillair van 20 μm binnendiameter werd gebruikt om een afronding amoeba (diameter ~ 10 μm) te aspireren. Dit maakt het onderhoud van een interne positie en een eenvoudige vrijgave van de cel mogelijk.
  5. Monteer het systeem.
    1. Bevestig de bedrijfs hoek van het aangrijpende systeem op de gemotoriseerde module op 45 °.
    2. Voer een dubbele installatie uit, eerst op het aangrijpende systeem en vervolgens op het micro capillair.
    3. Concentreer u op de cellen na het uitvoeren van een paar druppels olie door het microcapillair.
      Opmerking: De minerale olie met biologische compatibiliteit wordt geleverd door het apparaat.
    4. Volledige montage volgens de aanbevelingen van de fabrikant.
  6. Kloon cellen (Zie afbeelding 2A, B).
    Opmerking:
    deze procedure is vergelijkbaar met die beschreven door Fröhlich en König31.
    1. Plaats de Petri schaal met 2 ml geïnfecteerd eencellige onder de Microscoop.
    2. Focus eerst op de cellen, en vervolgens op de microcapillaire ondergedompeld in de cultuur.
    3. Kies een afgeronde enkele cel en breng de microcapillaire dichter bij de micro manipulator.
    4. Oefenen van zachte aspiratie met handmatige drukregeling op de cel, het nemen van het in het microcapillair. Verwijder de enkele cel uit het eerste voorbeeld en laat deze los in de cellulaire ondersteuning en inincuberen bij 30 °C.
    5. Dagelijkse waarnemingen uitvoeren met een omgekeerde optische Microscoop om het uiterlijk van de cellen te observeren en de opkomst van het cytopathische effect te bewaken.

5. PCR-screening

Opmerking: Na stap 4 is een systematische screening door PCR cruciaal om de scheiding te bevestigen. In zowel Usurpativirus/Faustovirus en Clandestinovirus/Faustovirus, het ontwerp en de toepassing van de specifieke primer en sonde systemen werden gedaan met behulp van primer-BLAST online32 (tabel 2).

  1. Extraheer DNA uit een deel van de positieve kweek monsters (d.w.z. waar een cytopathisch effect wordt waargenomen), met behulp van een geautomatiseerd extractie systeem volgens het Protocol van de fabrikant.
  2. Gebruik de juiste ontworpen primers.
    Opmerking: Hier hebben we primers ontworpen om de kern genen te versterken die zijn geannotiseerd als RpB2 (Faustovirus), LCD7 Major capside-eiwit (Usurpatvirus) en klein capside-eiwit (Clandestinovirus)
  3. Voer een standaard PCR uit met een Thermocycler.
    1. Voer 20 μL PCR-reacties uit met 50 μM van elke primer (tabel 2), 1x Master Mix en RNase vrij water.
    2. Activeer de Taq-DNA-polymerase gedurende 5 minuten bij 95 °C en volg vervolgens 45 cycli van 10 s denaturatie bij 95 °C, gloeien van de primers voor 30 s bij 58 °C en verlenging voor 30 s bij 72 °C.
  4. Voer de PCR-producten uit op een 1,5% agarose-gel, vlek met DNA-gelvlek (tabel met materialen) en visualiseer met UV-straling.

6. virus productie en-zuivering

  1. Zet de rest van de Petri schaalcultuur terug in een kleine kolf.
  2. Voor de virus productie, bereid 15 kolven van 145 cm2, bevattende 40 ml Vermamoeba vermiformis in het verhongering medium en 5 ml van het geïsoleerde virus al overgebracht van de Petri schaal naar kleine kolven.
  3. Behandel met hetzelfde antibioticum en antischimmel mengsel gebruikt in stap 4,1.
  4. Incuberen bij 30 °C. Observeer elke dag met omgekeerde optische microscopie.
  5. Na de volledige infectie, zwembad alle kolven. Gebruik een 0,45 μm filter om vuil te elimineren.
  6. Ultracentrifuge alle supernatanten op 50.000 x g voor 45 min.
  7. Na centrifugeren, verwijder het supernatant van elke buis door aspiratie en regeer de pellet in 1 mL fosfaatgebufferde zoutoplossing (PBS).
  8. Reinig het virus dat wordt geproduceerd met 25% sucrose (27,5 g sucrose in 100 mL PBS, gesteriliseerd door filtratie).
  9. Centrifugeer 8 mL sucrose en 2 mL van de virale suspensie bij 80.000 x g gedurende 30 min. respendeer de virale pellet in 1 ml PBS. Bewaren bij-80 °C.

7. negatieve kleuring en transmissie elektronenmicroscopie

Opmerking: Bou Khalil et al. eerder dit protocol27gepubliceerd.

  1. Breng 5 μL van het supernatant van lysis aan op het gloei rooster. Laat ongeveer 20 minuten bij kamertemperatuur.
    Opmerking: De Glow-discharge stelt ons in staat om een hydrofiele grid te verkrijgen door de plasma toepassing.
  2. Droog het rooster voorzichtig en stort een kleine druppel van 1% ammonium molybdaat erop voor 10 s. laat het rooster 5 min drogen.
  3. Ga verder naar elektronenmicroscopie observaties bij 200 keV.

8. karakterisering van Clandestinovirus ST1 en Usurpativirus LCD7

  1. Karakteriseren zuivere populaties van clandestinovirus ST1 en usurpativirus LCD7 met behulp van genoom sequencing, genoom assemblage, bioinformatica analyses, en studie van hun replicatieve cyclus zoals we hebben gedaan voor andere virussen10,20, 29.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Single cell micro-aspiratie is een Micro manipulatie proces dat is geoptimaliseerd in dit manuscript (Figuur 1). Deze techniek maakt het mogelijk om een afgeronde, geïnfecteerde amoeba (Figuur 2a) en de afgifte ervan in een nieuwe plaat met niet-geïnfecteerde eencellige (Figuur 2) vast te leggen. Het is een functioneel prototype dat van toepassing is op het co-cultuur systeem en heeft met succes geïsoleerde niet-lytische reus virussen. Deze aanpak werd gebruikt voor de eerste keer op het gebied van gigantische virussen en maakte het mogelijk om twee nieuwe laag-overvloed reus virussen isoleren. We noemden de nieuwe virussen Clandestinovirus ST1 en Usurpativirus LCD7, die waren in lage overvloed in vergelijking met de hoge overvloed Faustovirussen. Om de virale aanwezigheid in elke plaat na de micro-aspiratie procedure te analyseren, hebben we PCR toegepast op de 15 micro aspiraties. We observeerden puur Usurpativirus (aanwezigheid van Usurpativirus LCD7 [+] en afwezigheid van Faustovirus [–]) alleen in kloon 7 (Figuur 3). De zuiverheid van de kloon werd bevestigd door PCR met specifieke protocollen gericht op Clandestinovirus ST1 en Usurpativirus LCD7 (tabel 2). Elektronenmicroscopie onthulde het uiterlijk van clandestinovirus ST1 en usurpativirus LCD7 (Figuur 4), die een typische morfologie van icosahedrale hebben zonder fibrillen en een icosahedrale capside van ongeveer 250 nm, respectievelijk. Na de bevestiging van de zuiverheid van de productie, werd het klonale virus geproduceerd en gezuiverd voor gehele genoom volgordebepaling en verdere karakterisering, met name transmissie elektronische microscopie (TEM) voor studies van vermenigvuldiging cyclus. We bevestigden de overlapping van populaties (Faustovirus/novel virus) door Flowcytometrie (Figuur 5).

Figure 1
Figuur 1: materialen voor Micro manipulatie. (A) de werkelijke instelling van het werkstation. B) Schematische illustratie van de onderdelen van het werkstation. C) Schematische illustratie van het microcapillair. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Micro-aspiratie stappen. A) eencellige isolatie procedure (zoom x40). (B) Schematische illustratie van de verschillende stappen van eencellige aspiratie: 1) lokalisatie van de cel. 2) aspiratie van de cel. 3) release stap. De zwarte pijlen tonen de microcapillaire en de witte tonen de enkele cel. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: PCR-screening en bevestiging. Screening van PCR van micro-aspiraties uitgevoerd voor Usurpativirus LCD7 en Faustovirus. Aanwezigheid van Usurpativirus LCD7 DNA (+) en afwezigheid van Faustovirus DNA (–) waargenomen voor kloon 7 na micro-aspiratie procedure. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: negatieve kleurings Micrograph. Negatieve kleuring van de virale suspensie, waarbij zuivere Clandestinovirus ST1 (A) en Usurpativirus LCD7 (B) worden weergegeven. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: representatieve poort plots. A) de superpositie van elke virale populatie die eerder is bevlekt met fluorescerende moleculaire sondes voor virus-DNA-etikettering (na eerder beschreven protocol26,30). Het linker deel van de afbeelding toont de superpositie van vijf stammen van Faustovirus (donkergroen, licht groen, oranje, rood en blauw). Aan de rechterkant, de superpositie van Faustovirus ST1 en Clandestinovirus ST1 (licht paars en donker paars) is zichtbaar. B) de aanwezigheid van twee virale populatie faustovirus en Usurpativirus in dezelfde poort als faustovirus (links).  Een puntplot van pure Usurpativirus toont dezelfde poort eerder gedefinieerd voor Faustovirus (rechts). Klik hier om een grotere versie van dit cijfer te bekijken.

PYG samenstelling Hoeveelheden
Proteose pepton 20 g
Gistextract 20 g
MgSO4· 7h2O 0,980 g
CaCl2 0,059 g
Citraat natrium. Dihydraat 1 g
Fe (NH4) 2 (zo4) 2 x 6h2O 0,02 g
Glucose 18 g
Gedistilleerd water 1 L
PH aanpassen bij 6,8 met HCl of KOH
Autoclaaf 15 min bij 121 °C
Verhongering medium quantites
Gistextract 2 g
Glucose 18 g
Fe (NH4) 2 (zo4) 2 x 6h2O 0,02 g
PAS (hieronder gedetailleerd) 1 L
PAS Solution A quantites
KH2po4 0,136 g
Na2HPO4 0,142 g
PAS Solution B quantites
MgSO4· 7h2O 4,0 mg
CaCl2· 2H2O 4,0 mg
Nacl 0,120 g
10 mL elk van de oplossingen A en B worden toegevoegd in 1 L gedistilleerd water.

Tabel 1: samenstelling van cultuur media.

Virus target Doel gen Foward primer (5-> 3) Omgekeerde primer (5-> 3)
Faustovirus RpB2 RpB2 Een van de meest te gekke TGATTWGCYAATGGNGCYGC
Usurpatvirus LCD7 Major capside gen Belangrijk capside-gen Een van de meest GESMOKKELDE GGGTTGAGGAGGAGTCAACG
Clandestinovirus ST1 minor capside-gen Minor capside-gen Een van de meest GEKKEN Een van de meest GEKKEN

Tabel 2: Primmer sequenties gebruikt voor de PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De duur van de eencellige behandeling met micro-aspiratie en de goede werking ervan is afhankelijk van de exploitant. De verschillende stappen van het experiment vereisen precisie. Het gebruik van de Micro manipulatie-onderdelen van het werkstation moet voortdurend worden bestreden door het proces van micro-aspiratie en het vrijkomen van de cel te observeren. De follow-up door microscopische observatie is noodzakelijk voor het vangen en overbrengen van een cel. Een ervaren operator kan 1 tot 2 uur duren om 10 cellen te isoleren en ze één voor één opnieuw over te brengen, afhankelijk van de overvloed aan virussen die moeten worden geïsoleerd. Het aantal manipulaties kan variëren. We raden aan om te beginnen met 10 manipulaties. Per definitie, we weten niet de intrinsieke kenmerken van het onbekende virus. Zo is het gebruik en de ontwikkeling van verschillende strategieën voor isolatie nodig om het succes van het scheiden van deze virussen te optimaliseren.

Het micro-aspiratie proces wordt uitgevoerd onder niet-steriele omstandigheden (op een bank buiten het microbiologische veiligheids station) en beperkt zo het gebruik ervan en voorkomt de toepassing ervan voor de studie van menselijke pathogenen. Daarom is het gebruik van een mengsel van antibiotica en antischimmelmiddelen om verontreinigingen te beperken verplicht. Een andere beperking van de methode is dat het alleen kan worden uitgevoerd op micro-organismen waarneembaar door Lichtmicroscopie waarop de Micro manipulatie componenten werden gemonteerd, dus, het elimineren van elk werk op micro-organismen niet waarneembaar door licht Microscopie. We waren echter in staat om gigantische virussen van ongeveer 200 nm te scheiden die onzichtbaar blijven onder de lichtmicroscoop door gebruik te maken van een indirecte strategie bestaande uit het scheiden en klonen van de geïnfecteerde hosts.

De ontwikkeling van eencellige micro-aspiratie voor amoebal Capture is een onderdeel van de ontwikkeling van de populatie-sorteermethoden. Single cell micro-aspiratie stond ons te isoleren twee nieuwe reus virussen, Clandestinovirus ST1 en Usurpativirus LCD7, met kenmerken onderscheidend van Faustovirussen. De sterk vergelijkbare morfologische eigenschappen van zowel Clandestinovirus ST1 en Usurpativirus LCD7 naar Faustovirus LCD7 en hun verschil van replicatie toont de limiet van FACS, die meestal wordt gebruikt in Giant virussen sorteren. Het wordt vertegenwoordigd door de superpositie van twee virale populaties, Clandestinovirus ST1 en Faustovirus ST1 (Figuur 5A) en ook door de detectie voor Usupartivirus LCD7 en faustovirus LCD7. Echter, met deze nieuwe methode, de hele manipulatie is onder visuele controle met een zorgvuldige controle van de cel en de integriteit ervan, zelfs na de release. Het gebruik van Flowcytometrie om geïnfecteerde eencellige direct te sorteren zou een alternatieve oplossing kunnen zijn voor het indirect sorteren van nieuwe virussen. Deze methode wordt meestal gevolgd door de screening van de plaat om cytopathische effecten of lysis op te sporen. De aanwezigheid van niet-lytische virussen in de mix kan een limiet voor het sorteren van amoebal vertegenwoordigen. Dit werd echter niet onderzocht bij de totstandkoming van dit protocol en voor deze twee nieuwe isolaties.

Buiten de toepassing van de Micro-manipulatie in de positionering en het houden van cellen in het algemeen en eicellen voor intracytoplasmorische sperma injectie (ICSI)33, heeft eencellige micro-aspiratie bewezen een praktische methode te zijn voor de isolatie van enkelvoudige prokaryotische cellen waarneembaar onder een optische Microscoop31. Andere toepassingen kunnen worden getest, inclusief celsortering op morfologische basis om verschillende zuivere monsters te hebben uit een gemengd monster van micro-organismen. De waarneembare scheiding van micro-organismen kan worden voorgesteld met behulp van de hierboven beschreven strategie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle auteurs hebben niets te onthullen.

Acknowledgments

De auteurs willen zowel Jean-Pierre Baudoin als Olivier Mbarek bedanken voor hun advies en Claire Andréani voor haar hulp in Engelse correcties en aanpassingen. Dit werk werd gesteund door een subsidie van de Franse staat die werd beheerd door het nationaal onderzoeksbureau in het kader van het programma "Investissements d'avenir (Investments for the Future)" met de referentie ANR-10-IAHU-03 (Méditerranée-infectie) en door de regio Provence-Alpes De Côte d'Azur en de Europese financiering FEDER PRIMI.

Materials

Name Company Catalog Number Comments
Agarose Standard Euromedex Unkown Standard PCR
AmpliTaq Gold 360 Master Mix Applied Biosystems 4398876 Standard PCR
CellTram 4r Oil Eppendorf 5196000030 Control the cells during the microaspiration process
Corning cell culture flasks 150 cm2 Sigma-aldrich CLS430825 Culture
Corning cell culture flasks 25 cm2 Sigma-aldrich CLS430639 Culture
Corning cell culture flasks 75 cm2 Sigma-aldrich CLS430641 Culture
DFC 425C camera LEICA Unkown Observation/Monitoring
Eclipse TE2000-S Inverted Microscope Nikon Unkown Observation/Monitoring
EZ1 advanced XL Quiagen 9001874 DNA extraction
Glasstic Slide 10 with Counting Grids Kova International 87144E Cell count
Mastercycler nexus Eppendorf 6331000017 Standard PCR
Microcapillary 20 µm Eppendorf 5175 107.004 Microaspiration and release of cells
Micromanipulator InjectMan NI2 Eppendorf 631-0210 Microcapillary positioning
Nuclease-Free Water ThermoFischer AM9920 Standard PCR
Optima XPN Ultracentrifuge BECKMAN COULTER A94469 Virus purification
Petri dish 35 mm Ibidi 81158 Culture/observation
Sterile syringe filters 5 µm Sigma-aldrich SLSV025LS Filtration
SYBR green Type I Invitrogen unknown Fluorescent molecular probes/flow cytometry
SYBR Safe Invitrogen S33102 Standard PCR; DNA gel stain
Tecnai G20 FEI Unkown Electron microscopy
Type 70 Ti Fixed-Angle Titanium Rotor BECKMAN COULTER 337922 Virus purification
Ultra-Clear Tube, 25 x 89 mm2 BECKMAN COULTER 344058 Virus purification

DOWNLOAD MATERIALS LIST

References

  1. Iyer, L. M., Aravind, L., Koonin, E. V. Common Origin of Four Diverse Families of Large Eukaryotic DNA Viruses. Journal of Virology. 75, (23), 11720-11734 (2001).
  2. Li, Y., et al. Analysis of 74 kb of DNA located at the right end of the 330-kb chlorella virus PBCV-1 genome. Virology. 237, (2), 360-377 (1997).
  3. Scola, B. L. A Giant Virus in Amoebae. Science. 299, (5615), 2033 (2003).
  4. Philippe, N., et al. Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes. Science. 341, (6143), 281-286 (2013).
  5. Antwerpen, M. H., et al. Whole-genome sequencing of a pandoravirus isolated from keratitis-inducing acanthamoeba. Genome Announcements. 3, (2), 00136-00215 (2015).
  6. Legendre, M., et al. Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology. Proceedings of the National Academy of Sciences of the United States of America. 111, (11), 4274-4279 (2014).
  7. Legendre, M., et al. In-depth study of Mollivirus sibericum, a new 30,000-y-old giant virus infecting Acanthamoeba. Proceedings of the National Academy of Sciences of the United States of America. 112, (38), 5327-5335 (2015).
  8. Legendre, M., et al. Diversity and evolution of the emerging Pandoraviridae family. Nature Communications. 9, (1), 2285 (2018).
  9. Aherfi, S., et al. A Large Open Pangenome and a Small Core Genome for Giant Pandoraviruses. Frontiers in Microbiology. 9, 166 (2018).
  10. Andreani, J., et al. Cedratvirus, a Double-Cork Structured Giant Virus, is a Distant Relative of Pithoviruses. Viruses. 8, (11), 300 (2016).
  11. Rodrigues, R. A. L., et al. Morphologic and genomic analyses of new isolates reveal a second lineage of cedratviruses. Journal of Virology. 00372 (2018).
  12. Bertelli, C., et al. Cedratvirus lausannensis- digging into Pithoviridaediversity. Environmental Microbiology. (2017).
  13. Levasseur, A., et al. Comparison of a modern and fossil Pithovirus reveals its genetic conservation and evolution. Genome Biology and Evolution. (2016).
  14. Dornas, F. P., et al. A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae. Viruses. 8, (3), 76 (2016).
  15. Yoshikawa, G., Blanc-Mathieu, R., et al. Medusavirus, a novel large DNA virus discovered from hot spring water. Journal of Virology. (2019).
  16. Legendre, M., et al. Pandoravirus Celtis Illustrates the Microevolution Processes at Work in the Giant Pandoraviridae Genomes. Frontiers in Microbiology. 10, 430 (2019).
  17. Abrahão, J., et al. Tailed giant Tupanvirus possesses the most complete translational apparatus of the known virosphere. Nature Communications. 9, (1), 749 (2018).
  18. Reteno, D. G., et al. Faustovirus, an asfarvirus-related new lineage of giant viruses infecting amoebae. Journal of Virology. 89, (13), 6585-6594 (2015).
  19. Bajrai, L., et al. Kaumoebavirus, a New Virus That Clusters with Faustoviruses and Asfarviridae. Viruses. 8, (12), 278 (2016).
  20. Andreani, J., et al. Orpheovirus IHUMI-LCC2: A New Virus among the Giant Viruses. Frontiers in Microbiology. 8, 779 (2018).
  21. Fischer, M. G., Allen, M. J., Wilson, W. H., Suttle, C. A. Giant virus with a remarkable complement of genes infects marine zooplankton. Proceedings of the National Academy of Sciences of the United States of America. 107, (45), 19508-19513 (2010).
  22. Moniruzzaman, M., et al. Genome of brown tide virus (AaV), the little giant of the Megaviridae, elucidates NCLDV genome expansion and host-virus coevolution. Virology. 466-467, 60-70 (2014).
  23. Gallot-Lavallée, L., Blanc, G., Claverie, J. -M. Comparative genomics of Chrysochromulina Ericina Virus (CeV) and other microalgae-infecting large DNA viruses highlight their intricate evolutionary relationship with the established Mimiviridae family. Journal of Virology. (2017).
  24. Deeg, C. M., Chow, C. -E. T., Suttle, C. A. The kinetoplastid-infecting Bodo saltans virus (BsV), a window into the most abundant giant viruses in the sea. eLife. 7, 235 (2018).
  25. Boughalmi, M., et al. High-throughput isolation of giant viruses of the Mimiviridae and Marseilleviridae families in the Tunisian environment. Environmental Microbiology. 15, (7), 2000-2007 (2013).
  26. Khalil, J. Y. B., et al. High-Throughput Isolation of Giant Viruses in Liquid Medium Using Automated Flow Cytometry and Fluorescence Staining. Frontiers in Microbiology. 7, (120), 26 (2016).
  27. Bou Khalil, J. Y., Andreani, J., Raoult, D., La Scola, B. A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis. Journal of Visualized Experiments : JoVE. (112), e54104 (2016).
  28. Khalil, J. Y. B., Andreani, J., La Scola, B. Updating strategies for isolating and discovering giant viruses. Current Opinion in Microbiology. 31, 80-87 (2016).
  29. Andreani, J., et al. Pacmanvirus, a new giant icosahedral virus at the crossroads between Asfarviridae and Faustoviruses. Journal of Virology. (2017).
  30. Khalil, J. Y. B., et al. Flow Cytometry Sorting to Separate Viable Giant Viruses from Amoeba Co-culture Supernatants. Frontiers in Cellular and Infection Microbiology. 6, 17722 (2017).
  31. Fröhlich, J., König, H. New techniques for isolation of single prokaryotic cells. FEMS Microbiology Reviews. 24, (5), 567-572 (2000).
  32. Ye, J., et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  33. Kimura, Y., Yanagimachi, R. Intracytoplasmic sperm injection in the mouse. Biology of Reproduction. 52, (4), 709-720 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics