تحويل جذر الطماطم متبوعاً بالتلقيح مع Ralstonia Solanacearum للتحليل الوراثي المباشر لمرض الذبول البكتيري

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا ، نقدم طريقة متعددة الاستخدامات لتحويل جذر الطماطم تليها التطعيم مع Ralstonia solanacearum لإجراء تحليل وراثي مباشر لدراسة مرض الذبول البكتيري.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum هو التربة المدمرة التي تحملها مسببات الأمراض الوعائية التي يمكن أن تصيب مجموعة كبيرة من الأنواع النباتية، مما تسبب تهديدا هاما للزراعة. ومع ذلك ، فإن نموذج Ralstonia غير مستكشف إلى حد كبير بالمقارنة مع النماذج الأخرى التي تنطوي على مسببات الأمراض النباتية البكتيرية ، مثل Pseudomonas syringae في أرابيدوبسيس. البحوث التي تستهدف فهم التفاعل بين Ralstonia ونباتات المحاصيل أمر ضروري لتطوير حلول مستدامة لمكافحة مرض الذبول البكتيري ولكن يعوقها حاليا عدم وجود اختبارات تجريبية مباشرة لتوصيف المكونات المختلفة للتفاعل في النباتات المضيفة الأصلية. في هذا السيناريو، قمنا بتطوير طريقة لإجراء التحليل الجيني للعدوى Ralstonia من الطماطم، مضيف طبيعي من Ralstonia. وتستند هذه الطريقة على Agrobacterium rhizogenesبوساطة التحول من جذور الطماطم، تليها تطعيم Ralstonia التربة منقوع من النباتات الناتجة، التي تحتوي على جذور متحولة التعبير عن بناء الفائدة. براعة من تحليل تحويل الجذر يسمح أداء إما الإفراط في التعبير الجيني أو الجين إسكات بوساطة RNAi. كدليل على المفهوم، استخدمنا هذه الطريقة لإظهار أن إسكات RNAi بوساطة SlCESA6 في جذور الطماطم منح المقاومة لRalstonia. هنا ، نصف هذه الطريقة بالتفصيل ، مما يتيح النهج الوراثية لفهم مرض الذبول البكتيري في وقت قصير نسبيًا ومع متطلبات صغيرة من المعدات ومساحة نمو النباتات.

Introduction

Ralstonia solanacearum، العامل السببي لمرض الذبول البكتيري ، هو ممرض الأوعية الدموية المدمرة التي تنتقل عن طريق التربة مع توزيع عالمي يمكن أن تصيب مجموعة كبيرة من أنواع النباتات ، بما في ذلك البطاطا والطماطم والتبغ والموز والفلفل والباذنجان ، من بين أمور أخرى1،2. خسائر الغلة الناجمة عن Ralstonia يمكن أن تصل إلى 80-90٪ من الإنتاج في الطماطم والبطاطا أو الموز، اعتمادا على الأصناف والمناخ والتربة وغيرها من العوامل3. ومع ذلك ، فإن نموذج Ralstonia غير مستكشف إلى حد كبير بالمقارنة مع النماذج الأخرى التي تنطوي على مسببات الأمراض النباتية البكتيرية ، مثل Pseudomonas syringae أو Xanthomonas spp. بالإضافة إلى ذلك ، تركز معظم الدراسات في التفاعلات النباتية والميكروبات على نموذج النبات Arabidopsis thaliana. على الرغم من أن الأبحاث التي تستخدم هذه النماذج قد ساهمت إلى حد كبير في فهمنا للتفاعلات النباتية والبكتيريا ، إلا أنها لا تعالج الضرورة الحالية لفهم هذه التفاعلات في نباتات المحاصيل. البحوث التي تستهدف فهم التفاعل بين Ralstonia ونباتات المحاصيل أمر ضروري لتطوير حلول مستدامة لمكافحة مرض الذبول البكتيري ولكن يعوقها حاليا عدم وجود اختبارات تجريبية مباشرة لتوصيف المكونات المختلفة للتفاعل. على وجه الخصوص ، الطماطم ، مضيف طبيعي لRalstonia، هو ثاني أهم محصول نباتي في جميع أنحاء العالم ويتأثر بعدد كبير من الأمراض4، بما في ذلك مرض الذبول البكتيري. في هذا العمل، قمنا بتطوير طريقة سهلة لإجراء التحليل الجيني لعدوى رالستونيا من الطماطم. ويستند هذا الأسلوب على Agrobacterium rhizogenesبوساطة التحول من جذور الطماطم، وذلك باستخدام DsRed fluorescence كعلامة الاختيار تليها تطعيم Ralstonia التربة منقوع من النباتات الناتجة، التي تحتوي على جذور متحولة التعبير عن بناء الفائدة. براعة من تحليل تحويل الجذر يسمح أداء إما الإفراط في التعبير الجيني أو الجين إسكات بوساطة RNAi.

ويتمثل أحد القيود المحتملة لهذه الطريقة في النمو المتبقي للجذور غير المتحولة. هذا مهم بشكل خاص في الحالات التي يفتقر فيها البلازميد المستخدم إلى جين مراسل يسمح باختيار الجذور المتحولة. ولحل هذه المشكلة، قمنا بتطوير طريقة بديلة تعتمد على اختيار المضادات الحيوية، والتي تمنع نمو الجذور غير المتحولة مع السماح بنمو الجذور المتحولة المقاومة للمضادات الحيوية. نظرًا لأن A. rhizogenes لا تحفز على تحويل البراعم ، فهي عرضة للمضادات الحيوية ، وبالتالي ، يجب أن تبقى منفصلة عن الوسط المحتوي على المضادات الحيوية.

على الرغم من أن مقاومة النبات ضد Ralstonia ليست مفهومة جيدا، وقد ارتبطت العديد من التقارير تعديلات جدار الخلية لتعزيز المقاومة للذبول البكتيري,,,9. وقد اقترح أن هذه التعديلات جدار الخلية تؤثر على تطور الأوعية الدموية، وهو جانب أساسي لنمط حياة Ralstonia داخل النبات10. وقد ثبت الطفرات في الجينات ترميز synthases السليلوز CESA4، CESA7 وCESA8 في Arabidopsis thaliana لإضعاف سلامة جدار الخلية الثانوية ، مما تسبب في تعزيز المقاومة لRalstonia، والتي يبدو أن ترتبط ABA الإشارات8. لذلك ، كدليل على مفهوم طريقتنا ، قمنا بإجراء إسكات الجينات بوساطة RNAi من SlCESA6 (Solyc02g072240)، وهو خلية جدار ثانوي cellulosease ، وتقويم العظام من AtCESA8 (At4g18780). أظهرت التطعيمات اللاحقة التي تغمر التربة مع Ralstonia أن إسكات SlCESA6 عزز المقاومة لأعراض الذبول البكتيري ، مما يشير إلى أن المقاومة بوساطة جدار الخلية لRalstonia من المرجح أن يتم الحفاظ عليها في الطماطم ، والتحقق من صحة طريقتنا لإجراء التحليل الوراثي لمقاومة الذبول البكتيري في جذور الطماطم. هنا ، نصف هذه الطريقة بالتفصيل ، مما يتيح النهج الوراثية لفهم مرض الذبول البكتيري في وقت قصير نسبيًا ومع متطلبات صغيرة من المعدات ومساحة نمو النباتات.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

ملاحظة: تتضمن أجزاء هامة من هذه الطريقة مناولة المواد النباتية في المختبر، وبالتالي من المهم الحفاظ على الظروف المعقمة خلال جميع هذه الإجراءات، بما في ذلك تصور الفلورسة DsRed. خلال جميع عملية التحول، تنمو شتلات الطماطم عند 25-28 درجة مئوية و16 ساعة/8 ساعة فاتح/داكن (130 ميكرومول فوتونم م-2s-1 ضوء). يتم ختم لوحات مع شريط micropore من أجل تسهيل تبادل الغاز والنتح.

1. إعداد نباتات الطماطم وجذور الجذور الزراعية

  1. تعقيم بذور الطماطم(Solanum lycopersicum السيرة الذاتية. صانع المال، LA2706، مركز موارد علم الوراثة الطماطم، TGRC) مع 5٪ (v/v) هيبوكلوريت الصوديوم لمدة 5 دقيقة. غسل 4-5 مرات مع الماء المعقم المقطر والحفاظ على البذور تهتز ببطء في الماء المعقم أكثر من ليلة لتسهيل الإنبات.
  2. نقل بذور الطماطم إلى نصف قوة موراشيج وسكوغ (1/2 MS) المتوسطة دون السكروز (2.21 غرام / لتر MS، 8٪ ث / v أجار). حافظ على البذور في الظلام عند 25-28 درجة مئوية لمدة ثلاثة أيام(الشكل 1A).
    ملاحظة: عادة ما تكون هناك حاجة إلى حوالي 40 البذور لكل بناء.
  3. أوتوكلاف 8.5 سم2 أوراق تصفية مربع. ضع أوراق التصفية المربعة داخل 9 سم2 أطباق بتري مربعة تحتوي على 1/2 MS متوسطة (ضع الورق فوق أجار) ووضع ستة بذور طماطم منبتة على كل طبق(الشكل 1B). ختم لوحة مع شريط micropore واحتضان البذور المنبتة في 25-28 درجة مئوية لمدة 3-4 أيام.
  4. تنمو Agrobacterium rhizogenes MSU440 في وسط LB الصلبة (مع المضادات الحيوية المناسبة) في 28 درجة مئوية قبل يومين من التحول النباتي.
    ملاحظة: يتم توفير A. rhizogenes من قبل الدكتور خوان أنطونيو لوبيز ريز، EEZ-CSIC، غرناطة، إسبانيا. في التجربة الموصوفة في هذه المقالة، تم استخدام A. rhizogenes التي تحتوي على pK7GWIWG2_II-RedRoot::CESA6 أو متجه فارغ، كتحكم. pK7GWIWG2_II-RedRoot يحتوي على جين مراسل، DsRed،مدفوعا مروج Arabidopsis thaliana ubiquitin(pAtUBQ10)،ويمنح مقاومة لspectinomycin (50 ميكروغرام/مل). من الممكن استخدام ناقلات أخرى للتعبير المفرط للجينات ، كما تم الإبلاغ عنها قبل5. في هذا العمل ، تم الحصول على تضخيم جزء محدد لإسكات SlCESA6 عن طريق النسخ العكسي (RT) PCR باستخدام الحمض النووي الريبي المعزول عن الطماطم(S. lycopersicum cv. Moneymaker) وligated إلى p-ENTR /D-TOPO ناقلات(الجدول 1). وفي وقت لاحق، استُنسخت شظية SlCESA6-RNAi في متجه ثنائي pK7GWIWG2_II-RedRoot.

2- تحويل النباتات واختيارها

  1. باستخدام مشرط معقم ، قطع شعاع والجزء السفلي من هيبوثيل شتلات الطماطم(الشكل 1C ، D).
  2. حصاد A. rhizogenes الكتلة الحيوية من سطح المتوسطة LB باستخدام نصائح من البلاستيك أو شفرة مشرط وتراجع بعناية شتلات الطماطم قطع في الكتلة الحيوية البكتيرية(الشكل 1E).
  3. بعد التطعيم مع A. rhizogenes، تغطية شتلات الطماطم مع ورقة تصفية 2 سم × 4 سم نصف دائرية (الشكل 1F) ، من أجل الحفاظ على رطوبة عالية وتسهيل البقاء على قيد الحياة وتطوير الجذر الجديد.
  4. تخزين شتلات الطماطم المحولة لمدة 6-7 أيام. ثم، استخدم مشرط معقم لقطع الجذور الجديدة الناشئة شعر(الشكل 1G, H;في هذه الخطوة، لا يتم تحويل الجذور حتى الآن) والسماح للشتلات لإنتاج جذور جديدة شعر.
  5. مرة واحدة في الجيل الثاني من جذور جديدة شعر تظهر(الشكل 1I)،إزالة ورقة تصفية على رأس الشتلات، وختم لوحة مع شريط micropore مرة أخرى.
    ملاحظة: عند هذه النقطة، وجود علامة الفلورسنت DsRed في متجه التحويل يسمح لتصور كفاءة التحويل في الجذور الجديدة.
  6. لتصور DsRed fluorescence ، استخدم المجسم أو أي معدات أخرى للمصنع في التصوير في الجسم الحي(الشكل 1J). وضع علامة على الجذور الإيجابية (الفلورية الحمراء) المتحولة وإزالة الجذور السلبية غير المتحولة (لا مضان أحمر) باستخدام مشرط معقم.
  7. نقل الشتلات التي تظهر الفلورسينس الأحمر إلى لوحة جديدة تحتوي على 1/2 MS المتوسطة، من أجل تسهيل تطوير الجذر المحول ة كجذر رئيسي(الشكل 1ك). الحفاظ على الشتلات التي لا تظهر الفلورسينس الأحمر في نفس اللوحة للتحقق من ظهور جذور الفلورسنت(الشكل 1L)في نقاط وقت لاحق.
  8. طريقة بديلة تعتمد على اختيار المضادات الحيوية
    1. بديل للخطوة 2.5، إعداد نصف مملوءة 9 سم2 لوحات مربعة تحتوي على 1/2 متوسط MS مع المضادات الحيوية المناسبة. تميل لوحات ما يقرب من 5 درجة خلال عملية التحضير لتوليد مساحة فارغة دون المتوسطة(الشكل 2A)،مما يسمح يطلق النار على النمو تجنب الاتصال مع المضادات الحيوية.
    2. بديل للخطوة 2.6 ، بعد قص الجذور الأولى غير المحولة شعر ظهرت (الخطوة 2.4) ، ونقل الشتلات دون جذور إلى لوحات نصف مملوءة باستخدام أوراق التصفية مع الحجم المناسب(الشكل 2باء).
      ملاحظة: كتحكم إيجابي، يوصى بتحويل العديد من الشتلات مع البلازميد الذي يحتوي على نفس مقاومة المضادات الحيوية وجين المراسل (في هذا البروتوكول، pK7GWIWG2_II-RedRoot؛ kanamycin 50 ميكروغرام/مل).
    3. بديل للخطوة 2.7، والسماح للشتلات تطوير جذور جديدة شعر وقطع تلك الجذور التي ليست على اتصال مباشر مع سطح أوراق ساندويتش مرشح، لأن هذه الجذور قد تجنب اختيار المضادات الحيوية.
      ملاحظة: بسبب تأثير المضادات الحيوية، قد يكون تطور الجذر أبطأ مما هو عليه في لوحات بدون المضادات الحيوية. تظهر جذور جديدة مشعرة متحولة في غضون 14-18 يومًا بعد نقل الشتلات بدون جذور إلى الأطباق نصف المملوءة (الخطوة 2.8.2)(الشكل 2C-E).
  9. تغطية الشتلات مع 2 سم × 4 سم ورقة تصفية نصف دائرة، ختم لوحة واحتضان الشتلات للسماح لهم تطوير جذور جديدة شعر.
    ملاحظة: ليس من الضروري القضاء على رهيزوجينات A. باستخدام المضادات الحيوية. ورقة تصفية على رأس المتوسطة MS وعدم وجود السكروز تمنع انتشار رهيزوجينات A. على لوحة5.
  10. خمسة إلى سبعة أيام بعد اختيار الجذر الأول، كرر عملية الاختيار لتحديد جذور جديدة متحولة وإزالة الجذور غير المحولة. نقل الشتلات التي تحتوي على جذور متحولة إلى لوحة جديدة تحتوي على 1/2 وسيطة MS.

3. نقل إلى الأواني التلقيح

  1. إعداد أواني التطعيم حيث سوف يتعرض سطح الجذور للتلقيح البكتيري: نقع الأواني التطعيم بالماء، صب قبالة أي المياه الزائدة، ووضعها في صينية زرع البلاستيك. نقل الشتلات المختارة ذات الجذور المحولة إلى أواني التطعيم باستخدام الملقط(الشكل 3A).
  2. غطي الدرج بغلاف بلاستيكي أو غطاء شفاف وحافظ على درجة الحرارة 25-28 درجة مئوية والرطوبة 65% (16 ساعة/8 ساعة فاتح/داكن؛ 130 ميكرومول فوتونات م-2s-1 ضوء)، للحفاظ على مستوى عال ٍ من الرطوبة الشكل 3B). إزالة الغطاء بعد خمسة أو ستة أيام.
    ملاحظة: نباتات الطماطم المحولة جاهزة للتلقيح بعد أسبوعين إلى ثلاثة أسابيع من نقلها إلى التربة(الشكل 3C). خلال النمو على التربة، قد تنتج نباتات الطماطم جذور جديدة لا تتحول. لتحديد مدى هذه الظاهرة ، تم تصور الفلورسينس الأحمر في جذور نباتات الطماطم المتحولة منذ 3 أسابيع. معظم الجذور (80٪-100٪ ) أظهرت الفلورسينس الأحمر، مشيرا إلى أنها تحولت في الواقع(الشكل 3D، E).

4. تلقيح التربة المنقوعة

  1. تنمو R. solancearum (سلالة GMI1000 في هذا البروتوكول) في وسط السائل فاي(الجدول 211)في شاكر المداري (200 دورة في الدقيقة) في 28 درجة مئوية حتى مرحلة ثابتة.
  2. تحديد الأرقام البكتيرية عن طريق قياس الكثافة البصرية للثقافة البكتيرية في 600 نانومتر (OD600). تمييع الثقافة البكتيرية بالماء إلىOD 600 من 0.1 (في الظروف المستخدمة هنا ، وهذا يتوافق مع ما يقرب من 108 وحدات تشكيل مستعمرة [CFU] / mL).
  3. ضع 16-20 أواني تلقيح تحتوي على نباتات طماطم متحولة في صينية تلقيح (29 سم × 20 سم؛ الشكل 4أ).
  4. صب 300 مل (~ 15 مل لكل مصنع) من التلقيح البكتيري (OD600 من 0.1) في صينية تحتوي على الأواني التلقيح. السماح لهم نقع في التلقيح لمدة 20 دقيقة(الشكل 4B).
  5. إعداد صينية جديدة مع طبقة من التربة بوتينغ. حرك الأواني المنوّثة إلى الدرج الجديد(الشكل 4C)واضع الصواني في غرفة نمو مع رطوبة 75% و26-28 درجة مئوية وفترة تصوير من 12 ساعة ضوئية و12 ساعة ظلام (130 ميكرومول فوتونيات م-2s-1 ضوء).

5 - تحديد بارامترات العدوى والتحليل الإحصائي

  1. تسجيل أعراض المرض كما سبق وصفه12،13، باستخدام مقياس يتراوح من 0 (لا توجد أعراض) إلى 4 (الذبول الكامل)(الشكل 4D-H)، كل يوم بعد تلقيح Ralstonia لمدة أسبوعين.
    ملاحظة: يتم جمع بيانات مؤشر المرض من نفس الوحدة التجريبية (كل نبات) مع مرور الوقت.

6- تحليل التعبير الجيني

ملاحظة: يمكن تحديد تعبير الترانسجين أو إسكات الجين المستهدف عن طريق RT-PCR أو بواسطة RT-PCR الكمي (qRT-PCR).

  1. جمع العينات واستخراج الحمض النووي الريبي من جزء تمثيلي من نظام الجذر المحول (لتقييم التأثير على الجين المستهدف) والأوراق (كرقابة داخلية).
  2. تجميع cDNA باستخدام 1 ميكروغرام من مجموع الحمض النووي الريبي DNase المعالجة.
  3. تحليل التعبير الجيني للجينات المستهدفة بواسطة qRT-PCR. حساب مستويات النسخ النسبي باستخدام طريقة 2-ΟCt14 ، وذلك باستخدام SlEFα-1 كجين التدبير المنزلي15.14
    ملاحظة: يتم سرد تسلسل التمهيدي في الجدول 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

يوضح الشكل 5 تطور أعراض مرض نباتات الطماطم ذات الجذور التي تم تحويلها مع ناقل فارغ (EV) ، والنباتات ذات الجذور المحولة مع بناء RNAi يستهدف SlCESA6 (Solyc02g072240). يتم جمع بيانات مؤشر المرض(الشكل 5A)من نفس الوحدة التجريبية (كل نبات) مع مرور الوقت وفقًا لمقياس تعسفي من 0 إلى 4 ، ولا تتبع توزيعًا غاوسيًا ، مما يستبعد استخدام الاختبارات القياسية للبيانات المكافئة. وعلاوة على ذلك، هناك تباين جوهري من النبات إلى النبات في هذا النوع من التجارب، وذلك بسبب ديناميات الاستعمار والعدوى. أدناه نظرنا في طرق مختلفة للتمثيل والتحليل الإحصائي للأعراض المرتبطة بعدوى رالستونيا.

كنهج قياسي، تم استخدام اختبار U Mann-Whitney غير المكافئ ذي الذيل لمقارنة كل من التحكم (EV) ومنحنيات العدوى SlCESA6-RNAi. وفقا لهذا التحليل، يبدو أن الفرق بين متوسطي كلا المنحنيات غير مهم(P = 0.16).

من الممكن أيضًا تحديد المساحة تحت منحنى تقدم المرض (AUDPC) ، والذي يسمح بالجمع بين الملاحظات المتعددة لتقدم المرض في قيمة واحدة. وأظهرت شركة AUDPC قيمة أعلى لمصانع التحكم (EV؛ 28.75 ± 4.75) مقارنة بنباتات SlCESA6-RNAi (21.01 ± 4.74) في نهاية عملية العدوى، مما يشير إلى أن النباتات الإسكاتة SlCES6أكثر مقاومة لعدوى رلستونيا من نباتات المكافحة(الشكل 5B).

توفر فواصل الثقة (CI) طريقة لتقدير نطاق القيم التي توجد فيها قيمة المحتوى (أو المعلمة) لمتغير معين، مع احتمال كبير. كما هو مبين في الشكل 5C، فإن مساحة CI 95٪ للسيطرة (EV) ومنحنيات العدوى SlCESA6-RNAi تقدر فرصة أعلى للمقاومة عندما يتم إسكات SlCESA6.

يمكن تحويل قيم مؤشر المرض إلى بيانات ثنائية ، مع الأخذ في الاعتبار مؤشر المرض أقل من 2 مقابل "0" ، ومؤشر المرض يساوي أو أعلى من 2 مقابل "1"12. وهذا يسمح بتمثيل منحنى البقاء على قيد الحياة بعد تلقيح Ralstonia. ويستند هذا التحول على ملاحظة أنه بمجرد أن تبدأ النباتات في ظهور أعراض واضحة (مؤشر المرض من 2) ، فإنها تعتبر "مصابة" وستموت نتيجة لهذه العدوى. لم تكن الاختلافات في معدل البقاء على قيد الحياة بين EV وSlCESA6-RNAi النباتات ذات دلالة إحصائية وفقا لاختبار جيهان-بريسلو-ويلكوكسون الإحصائية(P = 0.13)(الشكل 5D).

بالإضافة إلى إجراء التحليل الإحصائي، وبغض النظر عن قيم P التي تم الحصول عليها، يجدر تفسير هذه البيانات على أساس تكرار الاتجاهات الملاحظة داخل نسخ متماثلة مختلفة(الشكل التكميلي 1). وتمشيا مع هذه الفكرة، قام عدد متزايد من العلماء مؤخرا بالتعليق على مخاطر الإفراط في استخدام عتبات إحصائية صارمة (مثل المعيار P ≤ 0.05)16.

تم تحليل تعبير SlCESA6 في اثنين من الجذور المتحولة المختارة عشوائيا قبل خطوة التلقيح، مما يدل على أن المقاومة المعززة لRalstonia يرتبط مع انخفاض التعبير من SlCESA6 (الشكل 5E). باستخدام هذه الطريقة، يمكن الحصول على معدل تحويل 35-40٪ بعد جولتين من الاختيار(الشكل 5واو). يمكن زيادة هذه القيمة عن طريق تنفيذ جولات اختيار إضافية5.

Figure 1
الشكل 1: إعداد النباتات وتحويلها واختيارها. (أ)إنبات بذور الطماطم في نصف قوة ماجستير (1/2) المتوسطة. (ب)بذور الطماطم المنبتة وضعت على ورقة مرشح ملقاة على لوحة تحتوي على 1/2 متوسط MS. شتلات الطماطم قبل(ج)وبعد(D)قطع شعاع والجزء السفلي من نقص الفيكوثيل. (E)تحويل شتلة الطماطم عن طريق غمس في الكتلة الحيوية البكتيرية. (واو)تحويل شتلات الطماطم المغطاة بورق التصفية للحفاظ على الرطوبة. ظهور (G) وإزالة(H)من جذور جديدة (غير متحولة) شعر. (ط)الجذور المحولة. (J)اختيار الجذور الطماطم شعر تحويلها عن طريق تصور من الفلورDRed. تشير الأسهم الحمراء إلى جذور إيجابية متحولة تعبر عن الفلورسة DsRed. (ك)تطوير الجذور المتحولة كجذور رئيسية. (L)تصور الفلور DsRed في جذور ناضجة تحول. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: طريقة بديلة تستند إلى اختيار المضادات الحيوية. (أ) نصف لوحة مربعة مملوءة تحتوي على 1/2 وسيطة MS. (ب)قطع الشتلات التخلص منها على ورقة مرشح الكذب على 1/2 MS المتوسطة مع المضادات الحيوية، بعد إزالة الجذور الأولى غير المحولة شعر. (C)جذور مغطاة بورق مرشح إضافي. (د)الطماطم الجذور المحولة نمت على 1/2 MS المتوسطة مع المضادات الحيوية. (E)الشتلات التي تحولت مع pK7GWIWG2_II-RedRoot (kanamycin 50 ميكروغرام/مل)، معبرا عن DsRed، كتحكم إيجابي. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: نقل الطماطم المحولة إلى أواني التلقيح. (أ)الطماطم المتحولة من الجذر المنقولة إلى الأواني التطعيم كامل غارقة. (ب)تحويل الطماطم في أواني التطعيم المغطاة بغطاء بلاستيكي للحفاظ على مستوى عال من الرطوبة. (C)سنتين إلى ثلاثة أسابيع من العمر الجذر تحول الطماطم، بعد نقلها إلى الأواني التلقيح، وعلى استعداد للتلقيح. (د)نباتات الطماطم منذ ثلاثة أسابيع بعد إزالة التربة. (E)DsRed الفلورسينس في جذور نباتات الطماطم المتحولة منذ 3 أسابيع. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: تلقيح التربة المنقوعة في رالستونيا. (أ)المواد اللازمة لتطعيم R. solanacearum GMI1000. (ب)التربة منقوع من الطماطم المحولة في الأواني التطعيم مع R. solanacearum GMI1000 التلقيح. (ج)الطماطم المعينة وضعت على طبقة من التربة بوتينغ. (D-H) مقياس أعراض مرض رالستونيا يتراوح من 0 (لا توجد أعراض) إلى 4 (الذبول الكامل). يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 5
الشكل 5: إسكات SlCESA6 يعزز المقاومة لR. solanacearum. (أ)أعراض المرض من الحمض النووي الريبي بوساطة SlCESA6-إسكات(CESA6-RNAi)وناقلات فارغة (EV) جذور تحول نباتات الطماطم عند التطعيم مع R. solanacearum. قيم تتوافق مع وسائل ± SE من ثمانية نباتات. (ب)منطقة تحت منحنى تقدم المرض من النباتات المبينة في لوحة A.(C)95٪ فاصل الثقة من النباتات هو مبين في لوحة A.(D)في المئة من النباتات الباقية على قيد الحياة هو مبين في لوحة A.(E)تحليل التعبير الجيني من قبل qRT-PCR من الحمض النووي الريبي بوساطة SlCESA6-صامتة (CESA6i) وEV الجذر تحويل نباتات الطماطم في الجذور (1،2) واطلاق النار (S). القيم تتوافق مع الوسائل ± SE من ثلاثة يكرر التقنية. (واو)معدل التحول من EV وCESA6-RNAi الجذر تحول نباتات الطماطم من تجربتين مستقلتين. القيم تتوافق مع الوسائل ± SE، بعد جولتين من التحديد. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

اسم التمهيدي تسلسل التمهيدي (5'-3')
EFα-1-F GGTGGCGACATGATTTTGA
EFα-1-R CGAGCCAACCAGGAAAACAA
qCESA6-F جاتكتجتجتCGCTCTTCTCGT
qCESA6-R TCCCTCCCTCATACCTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGTTTAG
CESA6-RNAi-R TTTGAGACTTGGCACTGGA

الجدول 1: تسلسل التمهيدي.

المكونات ل1 لتر
باكتو بيبتوني 10 غرام
استخراج الخميرة 1 غرام
أحماض كاسامينو 1 غرام

الجدول 2: تكوين متوسط لفاي (Ø).

الشكل التكميلي 1: استنساخ النتيجة المبينة في الشكل 5ألف. أعراض المرض من الحمض النووي الريبي بوساطة SlCESA6-إسكات(CESA6-RNAi)وEV الجذر تحول نباتات الطماطم عند التطعيم مع R. solanacearum. قيم تتوافق مع وسائل ± SE من ثمانية نباتات. تم إجراء تحليل التعبير الجيني من قبل qRT-PCR من SLCESA6بوساطة RNAi -إسكات (CESA6i) وناقلات فارغة (EV) نباتات الطماطم المتحولة من الجذر في الجذور (1،2) واطلاق النار (S). القيم تتوافق مع الوسائل ± SE من ثلاثة يكرر التقنية. يرجى الضغط هنا لتحميل هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia solanacearum يشكل تهديدا هاما للزراعة; ومع ذلك ، فإن تفاعلها مع المضيفين الطبيعيين ذوي الأهمية الزراعية لا يزال غير مفهوم جيد ًا مقارنة بمسببات الأمراض البكتيرية الأخرى ، خاصة في أنواع النباتات الزراعية. وفي معظم الحالات، يعوق الوقت والنفقات اللازمة لتعديل النباتات المضيفة وراثيا التحليل الوراثي. لمعالجة هذه المشكلة وتسهيل التحليل الوراثي للعدوى R. solanacearum في الطماطم، وضعنا طريقة سهلة على أساس Agrobacterium rhizogenesبوساطة التحول من جذور الطماطم(الشكل 1)،تليها تلقيح التربة منقوع(الشكل 3). يتم اختيار الجذور المحولة باستخدام مراسل الفلورسنت (DsRed في هذا البروتوكول)(الشكل 1). بالإضافة إلى ذلك ، قمنا أيضًا بتطوير طريقة بديلة تعتمد على اختيار المضادات الحيوية التي لا تضر الجزء الجوي غير المحول(الشكل 2).

ويستند بروتوكول التحويل إلى البروتوكول الذي وصفه هو - بلاغارو وآخرون5، مع عدة تعديلات. يسمح براعة هذه الطريقة بالعديد من الاختبارات الإضافية في الجذور المتحولة ، مثل تلك لتحليل فسيولوجيا النبات ، والاستجابة للعلاجات الكيميائية ، و / أو الاستجابات لمختلف الضغوط الحيوية واللاأحيائية.

بعد نقل النباتات المحولة إلى التربة، نظرنا في إمكانية أن النباتات قد تتطور جذور جديدة قد لا تتحول. استكشفنا هذا الاحتمال من خلال مراقبة الفلورسينس من DsRed في النظام الجذري للنباتات المتحولة بعد أسبوعين من نقلها إلى التربة (قبل تلقيح رالستونيا). وأظهرت النتائج الفلورية الحمراء في معظم الجذور(الشكل 3D).

يتم دمج نقل T-DNA بواسطة Agrobacterium في الجينوم المضيف بطريقة عشوائية ، وبالتالي ، تولد هذه الطريقة مجموعة غير متجانسة من نباتات الطماطم مع مستوى تعبير مختلف للجين المستهدف. R. عدوى سولاناسياروم يسبب عادة وفاة النباتات، والتي، في وقت لاحق، يعوق جمع عينات الجذر بعد التجربة لتحليل التعبير الجيني لكل نبات. لتحليل مستوى التعبير للجين المستهدف أثناء التجارب، نختار اثنين إلى ثلاثة نباتات محولة إلى الجذر قبل خطوة التلقيح، كعينة تمثيلية للسكان الذين سيتم تلقيحهم. ويبين الشكل 5 أن الحد من أعراض المرض في نباتات الطماطم يرتبط بكفاءة إسكات SlCESA6 قبل خطوة التطعيم. لذلك ، وعلى الرغم من القيود المفروضة على البروتوكول ، فإن نتائجنا التمثيلية تثبت بوضوح أن هذه الطريقة هي أداة قوية لدراسة الجينات المرشحة المشاركة في المقاومة أو التعرض لR. solanacearum في الطماطم. المثال المبين في هذه المقالة سمح لنا بتحديد أن طرق أسفل SlCESA6، خلية ثانوية ذات صلة السليلوز synthase، يعزز مقاومة العدوى من قبل R. solanacearum، تشبه الملاحظات السابقة باستخدام تقويم العظام AtCESA8 (At4g18780)من Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وليس لدى صاحبي البلاغ ما يكشفان عنه.

Acknowledgments

ونشكر جميع أعضاء مختبر ماتشو على المناقشات المفيدة، وألفارو لوبيز - غارسيا على المشورة الإحصائية، وسينيو جيان على المساعدة التقنية والإدارية خلال هذا العمل. نشكر PSC الخلية البيولوجيا مرفق الأساسية للمساعدة في التصوير الفلوري ة تم دعم هذا العمل من قبل برنامج البحوث ذات الأولوية الاستراتيجية للأكاديمية الصينية للعلوم (منحة XDB27040204), مركز شنغهاي لبيولوجيا الإجهاد النباتي (الصينية أكاديمية العلوم) وبرنامج المواهب الصينية 1000.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics