Bakteriyel Solgunluk Hastalığının Basit Genetik Analizi için Ralstonia Solanacearum ile Aşılama Takip Domates Kökü Dönüşümü

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, bakteriyel solgunluk hastalığı nın incelenmesi için basit genetik analiz yapmak için Ralstonia solanacearum ile aşılama takip domates kökü dönüşümü için çok yönlü bir yöntem satMaktadır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum, tarım için önemli bir tehdit neden, bitki türlerinin geniş bir yelpazede enfekte olabilir yıkıcı bir toprak kaynaklı vasküler patojendir. Ancak, Ralstonia modeli önemli ölçüde bakteriyel bitki patojenleri içeren diğer modellere göre underexploreed, Arabidopsis Pseudomonas syringae gibi . Ralstonia ve bitki bitkileri arasındaki etkileşimi anlamayı hedefleyen araştırmalar, bakteriyel solgunluk hastalığına karşı mücadele etmek için sürdürülebilir çözümler geliştirmek için gereklidir, ancak şu anda yerli konak bitkilerdeki etkileşimin farklı bileşenlerini karakterize etmek için basit deneysel tahlillerin olmaması engellenmiştir. Bu senaryoda, biz domates Ralstonia enfeksiyonu genetik analizi gerçekleştirmek için bir yöntem geliştirdik, Ralstoniadoğal bir ev sahibi . Bu yöntem, domates köklerinin Agrobacterium rhizogenes-aracılıdönüşümüne dayanır ve bunu ralstonia toprak-ıslatma aşılaması ile ortaya çıkan bitkilerin, ilgi yapısını ifade eden dönüştürülmüş kökleri içeren aşılamaya dayanmaktadır. Kök dönüşüm testinin çok yönlülüğü, rnai aracılığında gen aşırı ekspresyonu veya gen susturma gerçekleştirmeyi sağlar. Kavramın bir kanıtı olarak, domates kökleri Nde SlCESA6 RNAi aracılı susturma Ralstoniadirenç verilen göstermek için bu yöntemi kullandı. Burada, genetik yaklaşımların bakteriyel solgunluk hastalığını nispeten kısa sürede ve küçük ekipman ve bitki büyüme alanı gereksinimleriyle anlamasını sağlayan bu yöntemi ayrıntılı olarak tanımlıyoruz.

Introduction

Ralstonia solanacearum, bakteriyel solgunluk hastalığının nedensel ajan, diğerleri arasında patates, domates, tütün, muz, biber ve patlıcan da dahil olmak üzere bitki türlerinin geniş bir yelpazede enfekte olabilir dünya çapında bir dağıtım ile yıkıcı bir toprak kaynaklı vasküler patojen, diğerleri arasında1,2. Ralstonia'nın neden olduğu verim kayıpları, çeşitlerin, iklimin, toprağın ve diğer faktörlere bağlı olarak domates, patates veya muz üretiminin %80-90'ına ulaşabilir3. Ancak, Ralstonia modeli, Pseudomonas syringae veya Xanthomonas sppgibi bakteriyel bitki patojenlerini içeren diğer modellere kıyasla oldukça az keşfedilmemiştir. Ayrıca, bitki-mikrop etkileşimleri en çalışmalar model bitki Arabidopsis thalianaodaklanmıştır. Bu modelleri kullanarak araştırma büyük ölçüde bitki-bakteri etkileşimleri anlayışımıza katkıda bulunmuş olsa da, onlar ekin bitkilerde bu etkileşimleri anlamak için mevcut gerekliliği ele almamıştır. Araştırma Ralstonia ve bitki bitkileri arasındaki etkileşimi anlamak için bakteriyel solgunluk hastalığı ile mücadele için sürdürülebilir çözümler geliştirmek için gerekli olan ancak şu anda etkileşimin farklı bileşenleri karakterize etmek için basit deneysel tahliller eksikliği engellenir. Özellikle, domates, Ralstoniaiçin doğal bir ev sahibi , dünya çapında ikinci en önemli bitkisel ürün ve hastalıkların bir bolluk etkilenir4, bakteriyel solgunluk hastalığı da dahil olmak üzere. Bu çalışmada, domatesralstonia enfeksiyonu genetik analizi gerçekleştirmek için kolay bir yöntem geliştirdik. Bu yöntem agrobacterium rhizogenesdayanmaktadır -domates köklerinin aracılı dönüşümü, seçim marker olarak DsRed floresan kullanarak5, Ralstonia toprak sırılsıklam aşılama takip ortaya çıkan bitkilerin, dönüştürülmüş kökleri içeren ilgi inşa ifade içeren. Kök dönüşüm testinin çok yönlülüğü, rnai aracılığında gen aşırı ekspresyonu veya gen susturma gerçekleştirmeyi sağlar.

Bu yöntemin potansiyel bir sınırlama dönüştürülmeyen köklerin artık büyüme oluşur. Bu plazmid kullanılan durumlarda özellikle dönüştürülmüş köklerin seçimi sağlayan bir muhabir gen yoksun olduğu durumlarda önemlidir. Bu sorunu çözmek için, antibiyotik seçimine dayalı alternatif bir yöntem geliştirdik, bu da dönüşümsüz köklerin büyümesini engellerken, aynı yandan da antibiyotiğe dirençli dönüştürülmüş köklerin büyümesini sağladı. A. rhizogenes sürgünlerin dönüşümüne neden olmadığından, antibiyotiğe karşı duyarlıdırlar ve bu nedenle antibiyotik içeren ortamdan ayrı tutulmalıdırlar.

Ralstonia karşı bitki direnci iyi anlaşılamamasına rağmen, çeşitli raporlar bakteriyel solgunluk 6 gelişmiş direnç için hücre duvarı değişiklikleri ilişkili var66 ,7,8,9. Bu hücre duvarı değişiklikleri vasküler gelişimi etkilediği ileri sürülmüştür, bitki içinde Ralstonia yaşam tarzı için önemli bir yönü10. Arabidopsis thaliana selüloz sintazları CESA4, CESA7 ve CESA8 kodlama genlerde mutasyonlar ikincil hücre duvar bütünlüğünü bozan gösterilmiştir, Ralstoniagelişmiş direnç neden , Hangi ABA sinyalizasyon bağlı gibi görünüyor8. Bu nedenle, bizim yöntem için kavram kanıtı olarak, biz SlCESA6 RNAi aracılı gen susturma yapıldı(Solyc02g072240),ikincil bir hücre duvarı selüloz synthase, ve AtCESA8 ortolog (At4g18780). Ralstonia ile sonraki toprak sırılsıklam aşılama slCESA6 bakteriyel solgunluk belirtilerine karşı direnci ni artırdı gösterdi, Ralstonia hücre duvar aracılı direnç büyük olasılıkla domates korunmuş olduğunu düşündüren, ve domates kökleribakteriyel solgunluk direnci genetik analizi yürütmek için yöntemimizi doğrulayan. Burada, genetik yaklaşımların bakteriyel solgunluk hastalığını nispeten kısa sürede ve küçük ekipman ve bitki büyüme alanı gereksinimleriyle anlamasını sağlayan bu yöntemi ayrıntılı olarak tanımlıyoruz.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOT: Bu yöntemin önemli bölümleri, bitki malzemelerinin vitro olarak işlenmesini içerir ve bu nedenle DsRed floresanlarının görselleştirilmesi de dahil olmak üzere tüm bu işlemler sırasında steril koşulların tutulması önemlidir. Tüm dönüşüm sürecinde domates fideleri 25−28 °C ve 16 saat açık/koyu (130 μmol foton m-2s-1 ışık) olarak büyür. Plakalar gaz değişimi ve transpirasyonu kolaylaştırmak için mikropore bant ile mühürlenir.

1. Domates bitkileri ve Agrobacterium rhizogenes hazırlanması

  1. Sterilize domates tohumları(Solanum lycopersicum cv. Moneymaker, LA2706, Domates Genetik Kaynak Merkezi, TGRC) ile 5% (v / v) 5 dakika boyunca sodyum hipoklorit. Yıkayın 4-5 kez distile steril su ile ve tohumlar yavaş yavaş steril suda gece boyunca çimlenme kolaylaştırmak için sallayarak tutmak.
  2. Domates tohumlarını yarım güçlü Murashige ve Skoog (1/2 MS) orta sakarozsuz (2,21 g/L MS, %8 w/v agar) aktarın. Tohumları 25−28 °C'de karanlıkta üç günbekletin (Şekil 1A).
    NOT: Her yapı için genellikle yaklaşık 40 tohum gereklidir.
  3. Otoklav 8,5 cm2 kare filtre kağıtları. Kare filtre kağıtlarını 1/2 MS orta içeren 9 cm2 kare petri kapların içine yerleştirin (kağıdı agarın üzerine yerleştirin) ve her tabağa altı tane çimlenmiş domates tohumu yerleştirin(Şekil 1B). Plakayı mikropore bantla kapatın ve çimlenmiş tohumları 25−28 °C'de 3−4 gün kuluçkaya yatırın.
  4. Bitki dönüşümüne iki gün kala 28 °C'de katı LB orta (uygun antibiyotiklerle) Agrobacterium rhizogenes MSU440 yetiştirin.
    NOT: A. rhizogenes Dr Juan Antonio López Ráez, EEZ-CSIC, Granada, İspanya tarafından sağlanmaktadır. Bu makalede açıklanan deneyde, pK7GWIWG2_II-RedRoot içeren A. rhizogenes::CESA6 veya boş bir vektör, kontrol olarak kullanılmıştır. pK7GWIWG2_II-RedRoot bir muhabir gen içerir, DsRed, Arabidopsis thaliana ubiquitin organizatörü tarafından tahrik (pAtUBQ10), ve spectinomycin direnç confers (50 g/mL). 5'iönceden bildirildiği gibi gen ekspresyonu için diğer vektörleri kullanmak mümkündür. Bu çalışmada, SlCESA6 susturma için özel parçanın amplifikasyonu ters transkripsiyon (RT) PCR kullanılarak domatesten izole edilmiş RNA(S. lycopersicum cv. Moneymaker) kullanılarak elde edilmiş ve p-ENTR/D-TOPO vektörüne bağlanmış(Tablo 1). Daha sonra, SlCESA6-RNAi parçası pK7GWIWG2_II-RedRoot ikili vektörü içine klonlandı.

2. Bitki dönüşümü ve seçimi

  1. Steril bir neşter kullanarak, domates fidelerinin hipokotilinin altını ve raküli kesin (Şekil 1C,D).
  2. Hasat A. plastik ipuçları veya neşter bıçak kullanarak LB orta yüzeyinden rhizogenes biyokütle ve dikkatle bakteriyel biyokütle kesilmiş domates fideleri daldırma(Şekil 1E).
  3. A. rhizogenesile aşılama dan sonra, yüksek nem tutmak ve hayatta kalma ve yeni kök gelişimini kolaylaştırmak için 2 cm x 4 cm yarım dairesel filtre kağıdı(Şekil 1F)ile domates fidelerini kaplayın.
  4. Dönüştürülmüş domates fidelerini 6-7 gün saklayın. Daha sonra, yeni ortaya çıkan tüylü kökleri kesmek için steril bir neşter kullanın(Şekil 1G,H; bu adımda, kökleri henüz dönüştürülmüş değildir) ve fideler yeni tüylü kökleri üretmek için izin.
  5. İkinci nesil yeni tüylü kökler ortaya çıktıktan sonra(Şekil 1I),fidelerin üstündeki filtre kağıdını çıkarın ve plakayı tekrar mikropore bantla kapatın.
    NOT: Bu noktada, dsRed floresan belirteci dönüşüm vektörü varlığı yeni köklerde dönüşüm verimliliğini görselleştirmek için izin verir.
  6. DsRed floresansını görselleştirmek için, in vivo görüntüleme tesisi için stereomikroskop veya başka bir ekipman kullanın(Şekil 1J). Pozitif (kırmızı floresan) dönüştürülmüş kökleri işaretleyin ve steril bir neşter kullanarak negatif dönüşümsüz kökleri (kırmızı floresan yok) çıkarın.
  7. Kırmızı floresan gösteren fideleri, ana kök olarak dönüştürülmüş kökün gelişimini kolaylaştırmak amacıyla 1/2 MS orta içeren yeni bir plakaya aktarın (Şekil 1K). Floresan köklerin(Şekil 1L)ortaya çıkışını daha sonraki zaman noktalarında kontrol etmek için aynı plakada kırmızı floresan göstermeyen fideleri saklayın.
  8. Antibiyotik seçimine dayalı alternatif yöntem
    1. Adım 2.5'e alternatif olarak, uygun antibiyotikle 1/2 MS orta içeren yarı dolgulu 9 cm2 kare tabak hazırlayın. Hazırlık işlemi sırasında plakaları yaklaşık 5° eğimli bir şekilde orta olmadan boş bir alan oluşturmak için(Şekil 2A),sürgünlerin antibiyotikle temastan kaçınarak büyümesini sağlar.
    2. 2.6. adıma alternatif olarak, ilk dönüştürülmeyen tüylü kökleri kestikten sonra ortaya çıkan (adım 2.4), kökleri olmayan fideleri uygun büyüklükte filtre kağıtları kullanarak yarı dolgulu plakalara aktarır(Şekil 2B).
      NOT: Pozitif kontrol olarak, aynı antibiyotik direnci ve muhabir geni içeren bir plazmid ile birkaç fide dönüştürmek için tavsiye edilir (Bu protokolde, pK7GWIWG2_II-RedRoot; kanamisin 50 g/mL).
    3. Adım 2.7 alternatif, fideler yeni kıllı kökleri geliştirmek ve bu kökleri antibiyotik seçimi önlemek olabilir, çünkü filtre sandviç kağıtları yüzeyi ile doğrudan temas olmayan bu kökleri kesti.
      NOT: Antibiyotik etkisi nedeniyle kök gelişimi antibiyotiksiz plakalara göre daha yavaş olabilir. Yeni dönüştürülmüş kıllı kökler, kökleri olmayan fideleryarı dolmuş tabaklara (adım 2.8.2) aktardıktan sonra 14−18 gün içinde ortaya çıkar (Şekil 2C-E).
  9. Fidelerin üzerini 2 cm x 4 cm yarım daire filtre kağıdı ile kapatın, tabağı kapatın ve yeni tüylü kökler geliştirmeleri için fideleri kuluçkaya yatırın.
    NOT: Antibiyotik kullanarak A. rizogenlerin ortadan kaldırılmasına gerek yoktur. MS ortamının üstündeki filtre kağıdı ve sakaroz eksikliği5plakaüzerindeki A. rhizogenes'in yayılmasını engeller.
  10. İlk kök seçiminden beş ila yedi gün sonra, yeni dönüştürülmüş kökleri seçmek ve dönüştürülmeyen kökleri kaldırmak için seçim işlemini yineleyin. Dönüştürülmüş kökler içeren fideleri 1/2 MS orta içeren yeni bir plakaya aktarın.

3. Aşılama kaplarına transfer

  1. Köklerin yüzeyinin bakteriyel inoküle maruz kalacakları aşı kapları hazırlayın: aşı kaplarını suyla ıslatın, fazla suyu dökün ve plastik bir ekim tepsisine koyun. Dönüştürülmüş kökleri olan seçili fideleri cımbız kullanarak aşılama kaplarına aktarın(Şekil 3A).
  2. Tepsiyi plastik ambalaj veya şeffaf bir kapakla kaplayın ve 25−28 °C ve %65 nemde (16 saat/8 h ışık/koyu; 130 μmol foton m-2s-1 ışık) yüksek nem seviyesini korumak için saklayın Şekil 3B). Beş ya da altı gün sonra kapağı çıkarın.
    NOT: Dönüştürülmüş domates bitkileri toprağa aktardıktan iki-üç hafta sonra aşılamaya hazırdır (Şekil 3C). Topraktaki büyüme sırasında, domates bitkileri dönüştürülmeyen yeni kökler üretebilir. Bu fenomenin kapsamını belirlemek için kırmızı floresan 3 haftalık dönüştürülmüş domates bitkilerinin köklerinde görselleştirildi. Çoğu kök (%80-%100) kırmızı floresan gösterdi, onlar gerçekten dönüştürülür gösteren(Şekil 3D,E).

4. Toprak-sırılsıklam aşılama

  1. R. solancearum (bu protokolde GMI1000 süzme) phi sıvı ortamda(Tablo 211) bir orbital shaker (200 rpm) 28 °C sabit faza kadar büyümek.
  2. Bakteri kültürünün optik yoğunluğunu 600 nm (OD600)olarak ölçerek bakteri sayılarını belirleyin. Bakteri kültürünü su ile seyrelterek 0.1'in OD600'ü (burada kullanılan koşullarda yaklaşık 108 koloni oluşturan üniteye [CFU]/mL) karşılık gelir.
  3. Dönüştürülmüş domates bitkilerini içeren 16−20 aşılama kabını bir aşılama tepsisine (29 cm x 20 cm; Şekil 4A).
  4. Aşı kaplarını içeren tepsiye 300 mL (bitki başına~15 mL) bakteriyel inokül (OD600 0,1) dökün. Onları 20 dakika boyunca inoculum ıslatın (Şekil 4B).
  5. Çömlekçilik toprak tabakası ile yeni bir tepsi hazırlayın. Aşılanmış kapları yeni tepsiye taşıyın(Şekil 4C)ve tepsileri %75 nem, 26−28 °C ve 12 saat ışık ve 12 saat karanlık (130 μmol foton m-2s-1 ışık) ile bir büyüme odasına yerleştirin.

5. Enfeksiyon parametrelerinin belirlenmesi ve istatistiksel analiz

  1. Daha önce açıklandığı gibi skor hastalığı belirtileri12,13, arasında değişen bir ölçek kullanarak 0 (hiçbir belirti) 4 (tam solma)(Şekil 4D-H), Iki hafta boyunca Ralstonia aşılama sonra her gün.
    NOT: Hastalık indeksi verileri zaman içinde aynı deneysel birimden (her bitki) toplanır.

6. Gen ekspresyonu analizi

NOT: Transgenin ekspresyonu veya hedef genin susturulması RT-PCR veya kantitatif RT-PCR (qRT-PCR) ile belirlenebilir.

  1. Örnekler toplayın ve dönüştürülmüş kök sisteminin temsili bir bölümünden RNA ayıklayın (hedef gen üzerindeki etkisini değerlendirmek için) ve yaprakları (iç kontrol olarak).
  2. Toplam DNase ile tedavi edilen RNA'nın 1 μg'si kullanılarak cDNA sentezleyin.
  3. QRT-PCR ile hedef genlerin gen ekspresyonunu analiz edin. 2-ΔΔCT yöntemi14kullanarak göreli transkripsiyon düzeylerini hesaplayın , temizlik geni15olarak SlEFα-1 kullanarak .
    NOT: Astar dizileri Tablo 1'delistelenmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 5 boş bir vektör (EV) ile dönüştürülmüş kökleri ile domates bitkileri hastalık belirtileri gelişimini gösterir ve kökleri bir RNAi ile dönüştürülmüş bitkiler SlCESA6 hedefleme(Solyc02g072240). Hastalık indeksi verileri(Şekil 5A)zaman içinde aynı deneysel birimden (her bitki) 0'dan 4'e rasgele bir ölçeğe göre toplanır ve parametrik veriler için standart testlerin kullanımını ekarte eden Bir Gauss dağılımını takip etmez. Ayrıca, bu tür deneylerde, kolonizasyon ve enfeksiyon dinamikleri nedeniyle içsel bir bitki-to-bitki varyasyonu vardır. Aşağıda Ralstonia enfeksiyonu ile ilişkili semptomların temsili ve istatistiksel analizi için farklı yöntemler ele alınmalıdır.

Standart bir yaklaşım olarak, u mann-whitney iki kuyruklu olmayan parametrik test hem kontrol karşılaştırmak için (EV) ve SlCESA6-RNAi enfeksiyon eğrileri kullanılmıştır. Bu analize göre, her iki eğrinin ortancaları arasındaki fark anlamlı görünmüyor(P = 0.16).

Ayrıca, birden fazla hastalık ilerlemesinin tek bir değerde birleştirilmesine olanak tanıyan hastalık ilerleme eğrisi (AUDPC) altındaki alanı ölçmek de mümkündür. AUDPC, enfeksiyon sürecinin sonunda slcesa6-RNAi (21.01 ± 4.74) bitkileriile karşılaştırıldığında kontrol tesisleri için daha yüksek bir değer (EV; 28.75 ± 4.75) göstererek, SlCES6-susturulanbitkilerin ralstonia enfeksiyonuna kontrol tesislerinden daha dayanıklı olduğunu göstermiştir(Şekil 5B).

Güven aralıkları (CI), yüksek olasılıklı, belirli bir değişkenin popülasyon değerinin (veya parametresinin) bulunduğu bir değer aralığını tahmin etme yolu sunar. Şekil 5C'degösterildiği gibi, kontrol için %95 CI (EV) ve SlCESA6-RNAi enfeksiyon eğrileri, SlCESA6 susturulduğunda daha yüksek bir direnç şansı tahmin eder.

Hastalık indeksi değerleri, "0"a karşılık gelen 2'den düşük bir hastalık indeksi ve "1"12'yekarşılık gelen 2'den daha yüksek bir hastalık indeksi göz önüne alındığında ikili veriye dönüştürülebilir. Bu Ralstonia aşısı sonrası bir sağkalım eğrisi temsilsağlar. Bu dönüşüm, bitkilerin net semptomlar geliştirmeye başladıklarında (2 hastalık indeksi) "enfekte" olarak kabul edildikleri ve bu enfeksiyonun bir sonucu olarak ölecekleri gözlemine dayanır. EV ve SlCESA6-RNAi bitkileri arasındaki sağkalım oranı arasındaki farklar Gehan-Breslow-Wilcoxon İstatistik testine göre istatistiksel olarak anlamlı değildi(P = 0.13)(Şekil 5D).

İstatistiksel analiz yapmaya ek olarak ve elde edilen P değerlerine bakılmaksızın, bu verileri farklı çoğaltmalar içinde gözlenen eğilimlerin tekrarlanabilirliğine göre yorumlamak gerekir(Ek Şekil 1). Bu düşünceye uygun olarak, bilim adamlarının giderek artan sayıda son zamanlarda sıkı istatistiksel eşikleri (standart P ≤ 0,05 gibi)16aşırı kullanma riskleri hakkında yorum yaptık.

SlCESA6'nın ekspresyonu aşılama adımından önce rastgele seçilmiş iki kökte analiz edilerek Ralstonia'ya karşı gelişmiş direncin SlCESA6'nın azaltılmış ifadesi ile ilişkili olduğunu gösteren(Şekil 5E). Bu yöntem kullanılarak, iki tur seçimden sonra %35−40'lık bir dönüşüm oranı elde edilebilir (Şekil 5F). Bu değer ek seçim turları5gerçekleştirerek artırılabilir.

Figure 1
Şekil 1: Bitki hazırlama, dönüştürme ve seçimi. (A) Yarım güçlü MS (1/2) orta domates tohumları çimlenme. (B) 1/2 MS orta içeren bir tabak üzerinde yatan filtre kağıdıüzerine yerleştirilen çimlenmiş domates tohumları. Domates fideleri önce (C) ve sonra (D) radicle ve hipokotil alt kesme. (E) Domates fidesi bakteriyel biyokütleye dalarak dönüşüm. (F) Nemi korumak için filtre kağıdı ile kaplanmış domates fidelerini dönüştürdü. Yeni (dönüştürülmeyen) kıllı köklerin ortaya çıkışı (G) ve çıkarılması (H) . (I) Dönüştürülmüş kökler. (J) DsRed floresansının görselleştirilmesi ile dönüştürülmüş domates tüylü köklerinin seçimi. Kırmızı oklar, DsRed floresanını ifade eden pozitif dönüştürülmüş kökleri gösterir. (K) Ana kökler olarak dönüştürülmüş köklerin gelişimi. (L) Olgun dönüştürülmüş köklerde DsRed floresansının görselleştirilmesi. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Antibiyotik seçimine dayalı alternatif yöntem. (A) 1/2 MS orta içeren yarım dolgulu kare plaka. (B) Kesme fideler antibiyotik ile 1/2 MS orta yatan filtre kağıt üzerine atılır, ilk dönüştürülmeyen kıllı kökleri çıkarıldıktan sonra. (C) Kökler ek filtre kağıdı ile kaplanır. (D) Domates dönüştürülmüş kökleri antibiyotik ile 1/2 MS orta büyüdü. (E) Fideler pK7GWIWG2_II-RedRoot (kanamisin 50 μg/mL) ile dönüştürülmüştür ve DsRed'i pozitif kontrol olarak ifade eder. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Dönüştürülmüş domatesin aşı kaplarına aktarılması. (A) Köke dönüştürülmüş domatesler tam ıslatılmış aşı kaplarına aktarılır. (B) Yüksek nem seviyesini korumak için plastik kapakla kaplanmış aşı kaplarda domatesleri dönüştürmüştür. (C) İki ila üç haftalık kök dönüştürülmüş domates, aşılama kaplar transferinden sonra, aşılılacak hazır. (D) Üç haftalık domates bitkileri toprak çıkardıktan sonra. (E) 3 haftalık dönüştürülmüş domates bitkileriköklerinde Floresan DsRed. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Ralstonia toprak-sırılsıklam aşılama. (A) R. solanacearum GMI1000 aşısı için gerekli malzemeler. (B) R. solanacearum GMI1000 inoculum ile aşı kaplarında dönüştürülmüş domateslerin toprak-sırılsıklam. (C) Aşılanmış domates çömlekçilik toprak tabakası üzerine yerleştirilir. (D-H) Ralstonia hastalığı belirtileri ölçek arasında değişen 0 (hiçbir belirti) için 4 (tam solma). Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 5
Şekil 5: SlCESA6 susturma R. solanacearumdirencini artırır. (A) RNAi aracılı SlCESA6hastalığı belirtileri -susturuldu(CESA6-RNAi) ve boş vektör (EV) r. solanacearumile aşılama üzerine kök dönüştürülmüş domates bitkileri . Değerler, sekiz bitkinin ± SE anlamına karşılık gelir. (B) Panel A. (C) PanelA gösterilen bitkilerin hastalık ilerleme eğrisi altında alan A. ( D ) Panel A. (E) Gen ekspresyon analizi nde gösterilen bitkilerin yüzdesi RNAi aracılı SlCESA6qRT-PCR tarafından gen ekspresyon analizi -susturuldu (CESA6i) ve KÖKLERDE EV kök-dönüştürülmüş domates bitkiler (1,2) ve ateş (S).E Değerler, üç teknik çoğaltmanın ± SE anlamına karşılık gelir. (F) İki bağımsız deneyden EV ve CESA6-RNAi köke dönüştürülmüş domates bitkilerinin dönüşüm oranı. Değerler, iki tur seçimden sonra ± SE anlamına karşılık gelir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Astar adı Astar dizisi (5'-3')
EFα-1-F GGTGGCGAGCATGATTTTGA
EFα-1-R CGAGCCAACCATGGAAAACAA
qCESA6-F GATCTGGTTCGCTTTCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
CESA6-RNAi-R TTTGAGACTTTGGCACTGGA

Tablo 1: Astar dizileri.

Malzemeler 1 L için
Bacto peptone 10 g
Maya özü 1 g
Casamino asitler 1 g

Tablo 2: Phi (Ø) orta kompozisyon.

Ek Şekil 1: Şekil 5A'da gösterilen sonucun tekrarlanabilirliği. RNAi aracılı SlCESA6hastalık belirtileri -susturuldu(CESA6-RNAi) ve EV kök dönüştürülmüş domates bitkileri R. solanacearumile aşılama üzerine . Değerler, sekiz bitkinin ± SE anlamına karşılık gelir. Gen ekspresyonu analizi, RNAi aracılı SlCESA6-susturulmuş (CESA6i) ve Boş Vektör (EV) köklerinde (1,2) ve shoot (S) köklerinde köke dönüştürülmüş domates bitkilerinin qRT-PCR'si tarafından gerçekleştirildi. Değerler, üç teknik çoğaltmanın ± SE anlamına karşılık gelir. Bu rakamı indirmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia solanacearum tarım için önemli bir tehdit oluşturmaktadır; ancak, tarımsal önemi doğal konakları ile etkileşimi hala diğer bakteriyel patojenler ile karşılaştırıldığında, özellikle bitki türlerinde kötü anlaşılmaktadır. Çoğu durumda, genetik analiz zaman ve giderleri genetik konak bitkiler değiştirmek için gerekli tarafından engellenir. Bu sorunu çözmek ve domateste R. solanacearum enfeksiyonunun genetik analizini kolaylaştırmak için, domates köklerinin Agrobacterium rhizogenes-aracılı dönüşümüne dayalı kolay bir yöntem geliştirdik (Şekil 1), ardından toprak-sırılsıklam aşılama(Şekil 3). Dönüştürülmüş kökler floresan muhabir (Bu protokolde DsRed) kullanılarak seçilir (Şekil 1). Ayrıca, dönüşümsüz hava kısmına zarar vermeyen antibiyotik seçimine dayalı alternatif bir yöntem geliştirdik(Şekil 2).

Dönüşüm protokolü ho-Plágaro ve ark.5tarafından açıklanan dayanmaktadır , çeşitli değişiklikler ile. Bu yöntemin çok yönlülüğü, bitki fizyolojisini analiz etmek, kimyasal tedavilere yanıt vermek ve/veya farklı biyotik ve abiyotik streslere verilen tepkiler gibi dönüştürülmüş köklerde birden fazla ek tahlil yapılmasına olanak tanır.

Dönüştürülmüş bitkileri toprağa aktardıktan sonra, bitkilerin dönüştürülemeyecek yeni kökler geliştirme olasılığını göz önünde bulduk. Bu olasılığı, DsRed'in floresanını toprağa aktardıktan iki hafta sonra dönüştürülmüş bitkilerin kök sisteminde (Ralstonia aşısından önce) gözlemleyerek araştırdık. Sonuçlar köklerin çoğunda kırmızı floresan olduğunu göstermiştir(Şekil 3D).

Agrobacterium tarafından T-DNA transferi rasgele bir şekilde konak genom entegre edilir, ve bu nedenle, bu yöntem hedef genin farklı ifade düzeyi ile domates bitkileri heterojen bir popülasyon oluşturur. R. solanacearum enfeksiyonu normalde bitkilerin ölümüne neden olur, bu da daha sonra her bitkinin gen ekspresyonunu analiz etmek için deneyden sonra kök örneklerinin toplanmasını engeller. Deneyler sırasında hedef genin ifade düzeyini analiz etmek için, aşılama adımından önce, aşılanacak popülasyonun temsili örneği olarak, kökten dönüştürülmüş iki ya da üç bitki seçeriz. Şekil 5, domates bitkilerindeki hastalık semptomlarının azalmasının aşılama adımından önce SlCESA6 susturma etkinliği ile ilişkili olduğunu göstermektedir. Bu nedenle, ve protokolün sınırlamalarına rağmen, temsili sonuçlarımız bu yöntemin domateste R. solanacearum'a karşı direnç veya duyarlılıkla ilgili aday genleri incelemek için güçlü bir araç olduğunu açıkça göstermektedir. Bu makalede gösterilen örnek bize, ikincil hücre duvarı ile ilgili selüloz sintaz, r. solanacearumtarafından enfeksiyona karşı direnci ni artıran, onun ortholog AtCESA8 kullanarak önceki gözlemleri andıran (At4g18780) Arabidopsis thaliana8gelen devirme-aşağı SlCESA6belirlemek için izin verdi .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Macho laboratuvarının tüm laboratuvar üyelerine yararlı tartışmalar için, alvaro López-García'ya istatistiksel tavsiyeler için ve Xinyu Jian'a bu çalışma sırasında teknik ve idari yardım için teşekkür ederiz. Biz floresan görüntüleme ile yardım için PSC Hücre Biyolojisi çekirdek tesisi teşekkür Bu çalışma Çin Bilimler Akademisi Stratejik Öncelik Araştırma Programı (hibe XDB27040204), Şangay Merkezi Bitki Stres Biyolojisi (Çince) tarafından desteklendi Bilimler Akademisi) ve Çince 1000 Talents programı.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics