Tomatenwurzeltransformation gefolgt von Impfung mit Ralstonia Solanacearum für einfache genetische Analyse der bakteriellen Wilt-Krankheit

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier präsentieren wir eine vielseitige Methode zur Tomatenwurzeltransformation, gefolgt von der Impfung mit Ralstonia solanacearum, um eine einfache genetische Analyse für die Untersuchung von bakteriellen Wilt-Erkrankungen durchzuführen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum ist ein verheerender, durch den Boden übertragener Vasoren, der eine Große Auswahl an Pflanzenarten infizieren kann und eine wichtige Bedrohung für die Landwirtschaft darstellt. Allerdings ist das Ralstonia-Modell im Vergleich zu anderen Modellen mit bakteriellen Pflanzenpathogenen, wie Pseudomonas syringae in Arabidopsis,erheblich untererforscht. Forschung auf das Verständnis der Wechselwirkung zwischen Ralstonie und Pflanzen ist wichtig, um nachhaltige Lösungen zur Bekämpfung der bakteriellen Wilt-Krankheit zu entwickeln, wird aber derzeit durch das Fehlen von einfachen experimentellen Assays behindert, um die verschiedenen Komponenten der Interaktion in einheimischen Wirtspflanzen zu charakterisieren. In diesem Szenario haben wir eine Methode entwickelt, um eine genetische Analyse der Ralstonie-Infektion von Tomaten durchzuführen, einem natürlichen Wirt von Ralstonien. Diese Methode basiert auf Agrobacterium rhizogenes-vermittelte Umwandlung von Tomatenwurzeln, gefolgt von Ralstonia Boden-drenching Inokulation der resultierenden Pflanzen, die transformierte Wurzeln, die das Konstrukt des Interesses auszudrücken. Die Vielseitigkeit des Wurzeltransformationstests ermöglicht die Durchführung von Genüberexpression oder Gen-Silencing, die von RNAi vermittelt wird. Als Proof of Concept haben wir diese Methode verwendet, um zu zeigen, dass RNAi-vermitteltes Silencing von SlCESA6 in Tomatenwurzeln RalstonieResistenzverleiht. Hier beschreiben wir diese Methode im Detail, die es genetischen Ansätzen ermöglicht, bakterielle Wildeskrankheiten in relativ kurzer Zeit und mit geringen Anforderungen an Ausrüstung und Pflanzenwachstumsraum zu verstehen.

Introduction

Ralstonia solanacearum, der Erreger der bakteriellen Wilt-Krankheit, ist ein verheerender bodenübertragener Vasor mit einer weltweiten Verbreitung, die eine große Auswahl an Pflanzenarten infizieren kann, darunter Kartoffeln, Tomaten, Tabak, Banane, Pfeffer und Auberginen, unter anderem1,2. Ertragsverluste durch Ralstonie können 80-90% der Produktion in Tomaten, Kartoffeln oder Bananen erreichen, abhängig von Sorte, Klima, Boden und anderen Faktoren3. Allerdings ist das Ralstonia-Modell im Vergleich zu anderen Modellen mit bakteriellen Pflanzenpathogenen, wie Pseudomonas syringae oder Xanthomonas spp,erheblich untererforscht. Darüber hinaus konzentrieren sich die meisten Studien in Pflanzen-Mikroben-Wechselwirkungen auf die Modellpflanze Arabidopsis thaliana. Obwohl die Forschung, die diese Modelle verwendet, weitgehend zu unserem Verständnis von Pflanzen-Bakterien-Wechselwirkungen beigetragen hat, gehen sie nicht auf die aktuelle Notwendigkeit ein, diese Wechselwirkungen in Kulturpflanzen zu verstehen. Forschung, die auf das Verständnis der Wechselwirkung zwischen Ralstonie und Pflanzen ausgerichtet ist, ist wichtig, um nachhaltige Lösungen zur Bekämpfung der bakteriellen Wilt-Krankheit zu entwickeln, wird aber derzeit durch das Fehlen von einfachen experimentellen Assays behindert, um die verschiedenen Komponenten der Interaktion zu charakterisieren. Insbesondere Tomate, ein natürlicher Wirt für Ralstonie,ist die zweitwichtigste Gemüsepflanze weltweit und wird von einer Vielzahl von Krankheiten4, einschließlich bakterieller Wilt-Krankheit betroffen. In dieser Arbeit haben wir eine einfache Methode entwickelt, um genetische Analysen der Ralstonie-Infektion von Tomaten durchzuführen. Diese Methode basiert auf Agrobacterium rhizogenes-vermittelte Transformation von Tomatenwurzeln, mit DsRed Fluoreszenz als Selektionmarker5, gefolgt von Ralstonia Boden-drenching Inokulation der resultierenden Pflanzen, enthält transformierte Wurzeln, die das Konstrukt des Interesses. Die Vielseitigkeit des Wurzeltransformationstests ermöglicht die Durchführung von Genüberexpression oder Gen-Silencing, die von RNAi vermittelt wird.

Eine mögliche Einschränkung dieser Methode besteht in dem Restwachstum nicht transformierter Wurzeln. Dies ist besonders wichtig in den Fällen, in denen das verwendete Plasmid kein Reportergen hat, das die Auswahl transformierter Wurzeln ermöglicht. Um dieses Problem zu lösen, haben wir eine alternative Methode entwickelt, die auf der Antibiotikaauswahl basiert, die das Wachstum nicht transformierter Wurzeln hemmt und gleichzeitig das Wachstum gesunder antibiotikaresistenter transformierter Wurzeln ermöglicht. Da A. rhizogenes die Umwandlung von Trieben nicht induziert, sind sie anfällig für das Antibiotikum, und daher sollten sie vom antibiotikahaltigen Medium getrennt gehalten werden.

Obwohl die Pflanzenresistenz gegen Ralstonie nicht gut verstanden wird, haben mehrere Berichte Zellwandveränderungen mit einer verbesserten Resistenz gegen bakterielle swilt6,7,8,9. Es wurde vorgeschlagen, dass diese Zellwandveränderungen die Gefäßentwicklung beeinflussen, ein wesentlicher Aspekt für den Lebensstil von Ralstonia innerhalb der Pflanze10. Mutationen in Genen, die für die Cellulose-Synthasen CESA4, CESA7 und CESA8 in Arabidopsis thaliana kodieren, haben gezeigt, dass sie die sekundäre Zellwandintegrität beeinträchtigen und eine erhöhte Resistenz gegen Ralstoniaverursachen, die mit der ABA-Signalisierung8verbunden zu sein scheint. Daher haben wir als Proof of Concept für unsere Methode RNAi-vermittelte Gen-Silencing von SlCESA6 (Solyc02g072240), einer sekundären Zellwand-Zellulose-Synthase und einem Ortholog von AtCESA8 (At4g18780) durchgeführt. Die anschließende bodendurchflutete Impfung mit Ralstonie zeigte, dass das Silencing SlCESA6 die Resistenz gegen bakterielle Wilt-Symptome erhöhte, was darauf hindeutet, dass die zellwandvermittelte Resistenz gegen Ralstonie wahrscheinlich in Tomaten konserviert wird, und unsere Methode zur Durchführung genetischer Analysen der bakteriellen Wilkresistenz in Tomatenwurzeln validiert. Hier beschreiben wir diese Methode im Detail, die es genetischen Ansätzen ermöglicht, bakterielle Wildeskrankheiten in relativ kurzer Zeit und mit geringen Anforderungen an Ausrüstung und Pflanzenwachstumsraum zu verstehen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

HINWEIS: Wichtige Teile dieser Methode umfassen den Umgang mit Pflanzenmaterialien in vitro, und daher ist es wichtig, während all dieser Verfahren sterile Bedingungen beizubehalten, einschließlich der Visualisierung der DsRed-Fluoreszenz. DsRed Während des gesamten Transformationsprozesses wachsen Tomatensämlinge bei 25 bis 28 °C und 16 h/8 h hell/dunkel (130 mol Photonen m-2s-1 Licht). Die Platten sind mit Mikroporenband versiegelt, um den Gasaustausch und die Transpiration zu erleichtern.

1. Zubereitung von Tomatenpflanzen und Agrobacterium-Rhizogenen

  1. Sterilisieren Sie Tomatensamen(Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) mit 5% (v/v) Natriumhypochlorit für 5 min. 4-5 mal mit destilliertem sterilem Wasser waschen und die Samen langsam in sterilem Wasser über Nacht schütteln lassen, um die Keimung zu erleichtern.
  2. Tomatensamen ohne Saccharose (2,21 g/L MS, 8% w/v Agar) auf halbfestes Murashige- und Skoog-Medium (1/2 MS) übertragen. Halten Sie die Samen drei Tage lang bei 25 bis 28 °C im Dunkeln(Abbildung 1A).
    HINWEIS: In der Regel werden für jedes Konstrukt etwa 40 Samen benötigt.
  3. Autoklav 8,5 cm2 quadratische Filterpapiere. Legen Sie die quadratischen Filterpapiere in 9 cm2 quadratische Petrischalen mit 1/2 MS Medium (legen Sie das Papier auf den Agar) und legen Sie sechs gekeimte Tomatensamen auf jeden Teller (Abbildung 1B). Versiegeln Sie die Platte mit Mikroporenband und bebrüten Sie die gekeimten Samen bei 25 bis 28 °C für 3 bis 4 Tage.
  4. Agrobacterium rhizogenes MSU440 in festem LB-Medium (mit geeigneten Antibiotika) bei 28 °C zwei Tage vor der Pflanzentransformation anbauen.
    HINWEIS: A. rhizogenes wird von Dr. Juan Antonio Lépez Réez, AEZ-CSIC, Granada, Spanien, zur Verfügung gestellt. In dem in diesem Artikel beschriebenen Experiment wurden A. rhizogenes verwendet, die pK7GWIWG2_II-RedRoot::CESA6 oder einen leeren Vektor als Kontrolle enthalten. pK7GWIWG2_II-RedRoot enthält ein Reportergen, DsRed, angetrieben vom Arabidopsis thaliana ubiquitin Promoter (pAtUBQ10), und verleiht eine Resistenz gegen Spektinomycin (50 g/ml). Es ist möglich, andere Vektoren für die Genüberexpression zu verwenden, wie vor5berichtet. In dieser Arbeit wurde die Verstärkung des spezifischen Fragments für SlCESA6-Silencing durch Reverse Transkription (RT) PCR mit RNA aus Tomaten isoliert (S. lycopersicum cv. Moneymaker) und in p-ENTR/D-TOPO Vektor(Tabelle 1) ligiert. Anschließend wurde das SlCESA6-RNAi-Fragment in den pK7GWIWG2_II-RedRoot-Binärvektor geklont.

2. Pflanzenumwandlung und -auswahl

  1. Schneiden Sie mit einem sterilen Skalpell das Radikel und den Boden des Hypocotyls von Tomatensämlingen (Abbildung 1C,D).
  2. Ernte A. rhizogenes Biomasse von der Oberfläche des LB-Mediums mit Plastikspitzen oder einer Skalpellklinge und tauchen Sie die geschnittenen Tomatensämlinge vorsichtig in die bakterielle Biomasse (Abbildung 1E).
  3. Nach der Impfung mit A. rhizogenesdie Tomatensämlinge mit einem 2 cm x 4 cm halbkreisförmigen Filterpapier bedecken (Abbildung 1F), um eine hohe Luftfeuchtigkeit zu halten und das Überleben und die Neuwurzelentwicklung zu erleichtern.
  4. Bewahren Sie die verwandelten Tomatensämlinge 6-7 Tage auf. Dann verwenden Sie ein steriles Skalpell, um die neu entstehenden haarigen Wurzeln zu schneiden(Abbildung 1G,H; bei diesem Schritt sind die Wurzeln noch nicht transformiert) und lassen Sie die Sämlinge neue haarige Wurzeln zu produzieren.
  5. Sobald die zweite Generation der neuen haarigen Wurzeln erscheint (Abbildung 1I), entfernen Sie das Filterpapier auf den Sämlingen und versiegeln Sie die Platte wieder mit Mikroporenband.
    HINWEIS: An dieser Stelle ermöglicht das Vorhandensein des DsRed-Fluoreszenzmarkers im Transformationsvektor die Transformationseffizienz in den neuen Wurzeln zu visualisieren.
  6. Um dsRed Fluoreszenz zu visualisieren, verwenden Sie ein Stereomikroskop oder andere Geräte für die Pflanzen-in-vivo-Bildgebung (Abbildung 1J). Markieren Sie die positiven (rote Fluoreszenz) transformierten Wurzeln und entfernen Sie die negativen nicht transformierten Wurzeln (keine rote Fluoreszenz) mit einem sterilen Skalpell.
  7. Übertragen Sie die Sämlinge mit roter Fluoreszenz auf eine neue Platte mit einem Medium mit 1/2 MS, um die Entwicklung der transformierten Wurzel als Hauptwurzel zu erleichtern (Abbildung 1K). Bewahren Sie die Sämlinge, die keine rote Fluoreszenz zeigen, in derselben Platte auf, um die Entstehung von fluoreszierenden Wurzeln (Abbildung 1L) in späteren Zeitpunkten zu überprüfen.
  8. Alternative Methode auf Basis der Antibiotikaauswahl
    1. Alternative zu Schritt 2.5, bereiten Sie halbgefüllte 9 cm2 quadratische Platten mit 1/2 MS Medium mit dem entsprechenden Antibiotikum. Neigen Sie die Platten ca. 5° während des Vorbereitungsprozesses, um einen leeren Raum ohne Medium zu erzeugen (Abbildung 2A), so dass die Triebe wachsen können, um den Kontakt mit dem Antibiotikum zu vermeiden.
    2. Alternativ zu Schritt 2.6 entstanden nach dem Schneiden der ersten nicht transformierten haarigen Wurzeln (Schritt 2.4) die Sämlinge ohne Wurzeln mit Filterpapieren mit der entsprechenden Größe auf die halbgefüllten Platten (Abbildung 2B).
      HINWEIS: Als Positivkontrolle wird empfohlen, mehrere Sämlinge mit einem Plasmid zu transformieren, das die gleiche Antibiotikaresistenz und ein Reportergen enthält (in diesem Protokoll pK7GWIWG2_II-RedRoot; Kanamycin 50 g/ml).
    3. Alternative zu Schritt 2.7, lassen Sie die Sämlinge neue haarige Wurzeln entwickeln und schneiden Sie jene Wurzeln, die nicht in direktem Kontakt mit der Oberfläche der Filter-Sandwich-Papiere sind, da diese Wurzeln Antibiotika-Auswahl vermeiden können.
      HINWEIS: Aufgrund der antibiotischen Wirkung kann die Wurzelentwicklung langsamer sein als in Platten ohne Antibiotika. Neue transformierte haarige Wurzeln erscheinen innerhalb von 14 bis 18 Tagen nach dem Übertragen der Sämlinge ohne Wurzeln auf die halbgefüllten Platten (Schritt 2.8.2) (Abbildung 2C-E).
  9. Bedecken Sie die Sämlinge mit einem 2 cm x 4 cm Halbkreisfilterpapier, versiegeln Sie den Teller und bebrüten die Sämlinge, damit sie neue haarige Wurzeln entwickeln können.
    HINWEIS: Es ist nicht notwendig, die A. rhizogenes mit Antibiotika zu beseitigen. Das Filterpapier auf dem MS-Medium und der Mangel an Saccharose hemmen die Ausbreitung der A. Rhizogenen auf der Platte5.
  10. Fünf bis sieben Tage nach der ersten Wurzelauswahl wiederholen Sie den Auswahlprozess, um neue transformierte Wurzeln auszuwählen und nicht transformierte Wurzeln zu entfernen. Die Sämlinge mit transformierten Wurzeln auf eine neue Platte mit einem Medium von 1/2 MS übertragen.

3. Übertragung in Impftöpfe

  1. Bereiten Sie Impftöpfe vor, in denen die Oberfläche der Wurzeln dem bakteriellen Inokulum ausgesetzt wird: Die Impftöpfe mit Wasser einweichen, überschüssiges Wasser abgießen und in eine Kunststoff-Pflanzschale legen. Übertragen Sie die ausgewählten Sämlinge mit transformierten Wurzeln mit einer Pinzette in Impftöpfe (Abbildung 3A).
  2. Bedecken Sie das Fach mit Plastikfolie oder einem transparenten Deckel und halten Sie sie bei 25 x 28 °C und 65 % Luftfeuchtigkeit (16 h/8 h hell/dunkel; 130 mol Photonen m-2s-1 Licht), um eine hohe Luftfeuchtigkeit zu halten Abbildung 3B). Entfernen Sie die Abdeckung nach fünf oder sechs Tagen.
    HINWEIS: Die umgewandelten Tomatenpflanzen sind zwei bis drei Wochen nach ihrer Übertragung auf den Boden zur Impfung bereit (Abbildung 3C). Während des Wachstums auf dem Boden können Tomatenpflanzen neue Wurzeln produzieren, die nicht umgewandelt werden. Um das Ausmaß dieses Phänomens zu bestimmen, wurde die rote Fluoreszenz in Wurzeln von 3 Wochen alten transformierten Tomatenpflanzen visualisiert. Die meisten Wurzeln (80%-100%) zeigte rote Fluoreszenz, was darauf hindeutet, dass sie tatsächlich transformiert sind (Abbildung 3D,E).

4. Bodenträgheit

  1. R. solancearum (Stamm GMI1000 in diesem Protokoll) in phi flüssigem Medium (Tabelle 211) in einem Orbitalshaker (200 Rpm) bei 28 °C bis zur stationären Phase anbauen.
  2. Bestimmen Sie die Bakterienzahlen, indem Sie die optische Dichte der Bakterienkultur bei 600 nm (OD600) messen. Verdünnen Sie die Bakterienkultur mit Wasser auf eine OD600 von 0,1 (unter den hier verwendeten Bedingungen entspricht dies etwa 108 koloniebildenden Einheiten [CFU]/mL).
  3. 16 bis 20 Impftöpfe mit transformierten Tomatenpflanzen in eine Impfschale (29 cm x 20 cm) geben; Abbildung 4A).
  4. Gießen Sie 300 ml (ca. 15 ml pro Pflanze) bakterielles Inokulum (OD600 von 0,1) in die Schale, die die Impftöpfe enthält. Lassen Sie sie in das Inokulum für 20 min einweichen (Abbildung 4B).
  5. Bereiten Sie eine neue Schale mit einer Schicht von Blumenerde. Bewegen Sie die geimpften Töpfe in das neue Tablett (Abbildung 4C) und legen Sie die Schalen in eine Wachstumskammer mit 75 % Luftfeuchtigkeit, 26 x 28 °C und einer Photoperiode von 12 h Licht und 12 h Dunkelheit (130 mol Photonen m-2s-1 Licht).

5. Bestimmung der Infektionsparameter und statistische Auswertung

  1. Score-Krankheitssymptome wie zuvor beschrieben12,13, mit einer Skala von 0 (keine Symptome) bis 4 (vollständiges Welken) (Abbildung 4D-H), jeden Tag nach Ralstonia Impfung für zwei Wochen.
    HINWEIS: Die Daten des Krankheitsindex werden im Laufe der Zeit von derselben Versuchseinheit (jeder Pflanze) gesammelt.

6. Genexpressionsanalyse

ANMERKUNG: Die Expression des Transgens oder das Silencing des Zielgens kann durch RT-PCR oder durch quantitative RT-PCR (qRT-PCR) bestimmt werden.

  1. Sammeln Sie Proben und extrahieren Sie RNA aus einem repräsentativen Teil des transformierten Wurzelsystems (um die Wirkung auf das Zielgen zu bewerten) und Blätter (als interne Kontrolle).
  2. Synthetisieren Sie cDNA mit 1 g der gesamten DNase-behandelten RNA.
  3. Analysieren Sie die Genexpression der Zielgene mit qRT-PCR. Berechnen Sie die relativen Transkriptionsniveaus mit der2-CT-Methode 14, wobei SlEF-1 als Haushaltsgen15verwendet wird.
    HINWEIS: Primersequenzen sind in Tabelle 1aufgeführt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abbildung 5 zeigt die Entwicklung von Krankheitssymptomen von Tomatenpflanzen mit Wurzeln, die mit einem leeren Vektor (EV) transformiert wurden, und Pflanzen mit Wurzeln, die mit einem RNAi-Konstrukt transformiert wurden, das auf SlCESA6 (Solyc02g072240) abzielt. Die Krankheitsindexdaten (Abbildung 5A) werden von derselben Versuchseinheit (jede Pflanze) im Laufe der Zeit nach einer beliebigen Skala von 0 bis 4 gesammelt und folgen keiner Gaußschen Verteilung, was die Verwendung von Standardtests für parametrische Daten ausschließt. Darüber hinaus gibt es eine intrinsische Veränderung von Pflanze zu Pflanze in dieser Art von Experimenten, aufgrund der Besiedlung und Infektionsdynamik. Im Folgenden betrachteten wir verschiedene Methoden für die Darstellung und statistische Analyse der Symptome im Zusammenhang mit Ralstonie-Infektion.

Als Standardansatz wurde ein U Mann-Whitney-Zweischwanztest verwendet, um sowohl Die Kontroll- (EV) als auch die SlCESA6-RNAi-Infektionskurvenzu vergleichen. Nach dieser Analyse scheint die Differenz zwischen den Medianen beider Kurven nicht signifikant zu sein (P = 0,16).

Es ist auch möglich, den Bereich unter der Krankheitsfortschrittskurve (AUDPC) zu quantifizieren, was die Kombination mehrerer Beobachtungen des Krankheitsfortschritts in einem einzigen Wert ermöglicht. AUDPC zeigte einen höheren Wert für Kontrollanlagen (EV; 28,75 x 4,75) im Vergleich zu SlCESA6-RNAi (21,01 x 4,74) Pflanzen am Ende des Infektionsprozesses, was darauf hindeutet, dass SlCES6-stillePflanzen resistenter gegen Ralstonia-Infektionen sind als Kontrollpflanzen(Abbildung 5B).

Konfidenzintervalle (CI) bieten eine Möglichkeit, mit hoher Wahrscheinlichkeit einen Wertebereich zu schätzen, in dem der Grundgesamtheitswert (oder Parameter) einer bestimmten Variablen gefunden wird. Wie in Abbildung 5Cdargestellt, schätzt die Fläche von 95% CI für die Kontrolle (EV) und SlCESA6-RNAi Infektionskurven eine höhere Wahrscheinlichkeit von Resistenzen, wenn SlCESA6 zum Schweigen gebracht wird.

Krankheitsindexwerte können in binäre Daten umgewandelt werden, wobei ein Krankheitsindex niedriger als 2, der "0" entspricht, und ein Krankheitsindex gleich oder höher als 2, der "1"12entspricht. Dies ermöglicht die Darstellung einer Überlebenskurve nach der Ralstonia-Impfung. Diese Transformation basiert auf der Beobachtung, dass die Pflanzen, sobald sie beginnen, klare Symptome zu entwickeln (Krankheitsindex von 2), als "infiziert" gelten und als Folge dieser Infektion sterben werden. Die Unterschiede in der Überlebensrate zwischen EV- und SlCESA6-RNAi-Pflanzenwaren statistisch nicht signifikant nach einem Gehan-Breslow-Wilcoxon Statistical Test (P = 0.13) (Abbildung 5D).

Neben der Durchführung statistischer Analysen und unabhängig von den ermittelten P-Werten lohnt es sich, diese Daten auf der Grundlage der Reproduzierbarkeit der beobachteten Tendenzen innerhalb verschiedener Wiederholungen zu interpretieren (Ergänzende Abbildung 1). In Übereinstimmung mit dieser Vorstellung haben sich in letzter Zeit immer mehr Wissenschaftler zu den Risiken einer übermäßigen Nutzung strenger statistischer Schwellenwerte geäußert (z. B. der Standard-P-0,05)16. P

Die Expression von SlCESA6 wurde in zwei zufällig ausgewählten transformierten Wurzeln vor dem Impfschritt analysiert, was zeigt, dass die erhöhte Resistenz gegen Ralstonie mit der reduzierten Expression von SlCESA6 korreliert (Abbildung 5E). Mit dieser Methode kann eine Transformationsrate von 35 bis 40 % nach zwei Auswahlrunden erreicht werden (Abbildung 5F). Dieser Wert kann durch zusätzliche Auswahlrunden5erhöht werden.

Figure 1
Abbildung 1: Pflanzenvorbereitung, -umwandlung und -auswahl. (A) Keimung von Tomatensamen in halbstarkem MS(1/2) Medium. (B) Gekeimte Tomatensamen, die auf Filterpapier auf einem Teller mit einem Medium mit 1/2 MS liegen. Tomatensämlinge vor (C) und nach (D) Schneiden des Radikels und des Bodens des Hypocotyls. (E) Umwandlung von Tomatensämlingen durch Eintauchen in bakterielle Biomasse. (F) Transformierte Tomatensämlinge, die mit Filterpapier bedeckt sind, um die Feuchtigkeit aufrechtzuerhalten. Emergence (G) und Entfernung (H) neuer (nicht transformierter) haariger Wurzeln. (I) Transformierte Wurzeln. (J) Auswahl transformierter Tomatenhaarwurzeln durch Visualisierung der DsRed-Fluoreszenz. Rote Pfeile zeigen positive transformierte Wurzeln an, die DsRed Fluoreszenz exdrücken. (K) Entwicklung der transformierten Wurzeln als Hauptwurzeln. (L) Visualisierung der DsRed-Fluoreszenz in reifen transformierten Wurzeln. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Alternative Methode auf der Grundlage der Antibiotikaauswahl. (A) Halbgefüllte quadratische Platte mit 1/2 MS Medium. (B) Sämlinge auf Filterpapier auf 1/2 MS Medium mit Antibiotikum liegend, nach Entfernung der ersten nicht transformierten haarigen Wurzeln. (C) Wurzeln mit zusätzlichem Filterpapier bedeckt. (D) Tomaten transformierte Wurzeln, die auf einem Medium mit Antibiotikum angebaut werden. (E) Seedlinge, die mit pK7GWIWG2_II-RedRoot (Kanamycin 50 g/ml) transformiert wurden, dsRed als positive Kontrolle ausdrücken. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Übertragung der transformierten Tomate in Impftöpfe. (A) Wurzeltransformierte Tomaten, die in vollgetränkte Impftöpfe übertragen werden. (B) Verwandelte Tomaten in Impftöpfen, die mit einem Kunststoffdeckel bedeckt sind, um eine hohe Luftfeuchtigkeit zu erhalten. (C) Zwei bis drei Wochen alte wurzeltransformierte Tomaten, nach Übertragung auf Impftöpfe, bereit, geimpft zu werden. (D) Drei Wochen alte Tomatenpflanzen nach dem Entfernen des Bodens. (E) DsRed Fluoreszenz in Wurzeln von 3 Wochen alten transformierten Tomatenpflanzen. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Ralstonie-Boden-Drenching-Impfung. (A) Materialien, die für die Inokulation von R. solanacearum GMI1000 benötigt werden. (B) Bodenbefeuchtung von transformierten Tomaten in Impftöpfen mit R. solanacearum GMI1000 inoculum. (C) Geimpfte Tomaten auf eine Schicht Von Blumenerde gelegt. (D-H) Ralstonia-Krankheit Symptome Skala von 0 (keine Symptome) bis 4 (kompletteS Welken). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: SlCESA6 Silencing erhöht die Widerstandsfähigkeit gegen R. solanacearum. (A) Krankheitssymptome von RNAi-vermittelten SlCESA6-silenced (CESA6-RNAi) und leeren Vektor (EV) wurzeltransformierten Tomatenpflanzen nach Impfung mit R. solanacearum. Die Werte entsprechen dem Mittelwert von acht Pflanzen. (B) Fläche unter der Krankheitsfortschrittskurve von Pflanzen, die in Panel A. (C) 95% Konfidenz Intervall der in Panel A. (D) Gezeigten Pflanzen Prozent der überlebenden Pflanzen in Panel A. (E) Genexpressionsanalyse durch qRT-PCR von RNAi-vermitteltem SlCESA6-silenced (CESA6i) und EV-Wurzel-transformierten Tomatenpflanzen in Wurzeln (1,2) und Trieb (S) gezeigt werden. Die Werte entsprechen dem Mittelwert von drei technischen Replikationen. (F) Transformationsrate von EV und CESA6-RNAi wurzeltransformierten Tomatenpflanzen zweier unabhängiger Experimente. Die Werte entsprechen dem Mittelwert sS, nach zwei Runden der Auswahl. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Primername Primer-Sequenz (5'-3')
EF-1-F GGTGGCGAGCATGATTTTGA
EF-1-R CGAGCCAACCATGGAAAACAACAA
qCESA6-F GATCTGGTTCGCTTTCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
CESA6-RNAi-R TTTGAGACTTTGGCACTGGA

Tabelle 1: Primersequenzen.

Zutaten Für 1 L
Bacto-Pepton 10 g
Hefe-Extrakt 1 g
Casaminosäuren 1 g

Tabelle 2: Phi () mittlere Zusammensetzung.

Ergänzende Abbildung 1: Reproduzierbarkeit des in Abbildung 5A dargestellten Ergebnisses. Krankheitssymptome von RNAi-vermitteltem SlCESA6-silenced (CESA6-RNAi) und EV-Wurzel-transformierten Tomatenpflanzen nach Impfung mit R. solanacearum. Die Werte entsprechen dem Mittelwert von acht Pflanzen. Die Genexpressionsanalyse wurde von qRT-PCR von RNAi-vermitteltem SlCESA6-silenced (CESA6i) und Empty Vector (EV) wurzeltransformierten Tomatenpflanzen in Wurzeln (1,2) und Trieb (S) durchgeführt. Die Werte entsprechen dem Mittelwert von drei technischen Replikationen. Bitte klicken Sie hier, um diese Abbildung herunterzuladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia solanacearum stellt eine wichtige Bedrohung für die Landwirtschaft dar; Seine Wechselwirkung mit natürlichen Wirten von landwirtschaftlicher Bedeutung ist jedoch im Vergleich zu anderen bakteriellen Krankheitserregern, insbesondere bei Pflanzenarten, noch immer wenig verstanden. In den meisten Fällen wird die genetische Analyse durch die Zeit und die Kosten behindert, die für die genetische Veränderung von Wirtspflanzen erforderlich sind. Um dieses Problem anzugehen und die genetische Analyse der R. solanacearum Infektion bei Tomaten zu erleichtern, haben wir eine einfache Methode entwickelt, die auf Agrobacterium rhizogenes-vermittelte Umwandlung von Tomatenwurzeln basiert (Abbildung 1), gefolgt von bodendurchdringender Impfung (Abbildung 3). Die transformierten Wurzeln werden mit einem fluoreszierenden Reporter (DsRed in diesem Protokoll) ausgewählt (Abbildung 1). Darüber hinaus haben wir auch eine alternative Methode entwickelt, die auf der Antibiotikaauswahl basiert und den nicht transformierten Luftteil nicht beschädigt (Abbildung 2).

Das Transformationsprotokoll basiert auf dem von Ho-Pl'garo et al.5beschriebenen , mit mehreren Modifikationen. Die Vielseitigkeit dieser Methode ermöglicht mehrere zusätzliche Assays in transformierten Wurzeln, wie z. B. solche zur Analyse der Pflanzenphysiologie, der Reaktion auf chemische Behandlungen und/oder Reaktionen auf verschiedene biotische und abiotische Belastungen.

Nach der Übertragung der transformierten Pflanzen auf den Boden, wir überlegten die Möglichkeit, dass Pflanzen neue Wurzeln entwickeln können, die nicht transformiert werden können. Wir untersuchten diese Möglichkeit, indem wir die Fluoreszenz von DsRed im Wurzelsystem transformierter Pflanzen zwei Wochen nach ihrer Übertragung auf den Boden beobachteten (vor der Ralstonia-Impfung). Die Ergebnisse zeigten rote Fluoreszenz in den meisten Wurzeln (Abbildung 3D).

Der T-DNA-Transfer durch Agrobacterium ist zufällig in das Wirtsgenom integriert, so dass diese Methode eine heterogene Population von Tomatenpflanzen mit unterschiedlicher Expressionsebene des Zielgens erzeugt. R. solanacearum Infektion verursacht in der Regel den Tod der Pflanzen, die in der Folge behindert die Sammlung von Wurzelproben nach dem Experiment, um die Genexpression jeder Pflanze zu analysieren. Um den Expressionsgrad des Zielgens während der Experimente zu analysieren, wählen wir zwei bis drei wurzeltransformierte Pflanzen vor dem Impfschritt als repräsentative Probe der Population aus, die geimpft wird. Abbildung 5 zeigt, dass die Verringerung der Krankheitssymptome in Tomatenpflanzen mit der Effizienz des SlCESA6-Silencings vor dem Impfschritt korreliert. Daher zeigen unsere repräsentativen Ergebnisse trotz der Einschränkungen des Protokolls deutlich, dass diese Methode ein leistungsfähiges Instrument ist, um Kandidatengene zu untersuchen, die an Resistenz oder Anfälligkeit für R. solanacearum in Tomaten beteiligt sind. Das in diesem Artikel gezeigte Beispiel ermöglichte es uns zu bestimmen, dass das Abklopfen von SlCESA6, einer sekundären Zellwand-bezogenen Cellulose-Synthase, die Resistenz gegen Infektionen durch R. solanacearumerhöht, ähnlich früheren Beobachtungen mit seinem Ortholog AtCESA8 (At4g18780) von Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Wir danken allen Labormitgliedern des Macho-Labors für die hilfreichen Diskussionen, Alvaro Lépez-Garcéa für statistische Ratschläge und Xinyu Jian für die technische und administrative Unterstützung während dieser Arbeit. Wir danken der PSC Cell Biology Kerneinrichtung für die Unterstützung bei der Fluoreszenzbildgebung Diese Arbeit wurde durch das Strategic Priority Research Program der Chinese Academy of Sciences (Grant XDB27040204), das Shanghai Center for Plant Stress Biology (Chinesisch) unterstützt. Akademie der Wissenschaften) und das chinesische 1000 Talents-Programm.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics