Tomatrottransformasjon etterfulgt av inokulasjon med Ralstonia Solanacearum for enkel genetisk analyse av bakteriell wiltsykdom

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi en allsidig metode for tomatrottransformasjon etterfulgt av inokulasjon med Ralstonia solanacearum for å utføre enkel genetisk analyse for studiet av bakteriell wilt sykdom.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum er et ødeleggende jordbåren vaskulært patogen som kan infisere et stort utvalg av plantearter, noe som forårsaker en viktig trussel mot landbruket. Ralstonia-modellen er imidlertid betydelig underutforsket i forhold til andre modeller som involverer bakterielle plantepatogener, som Pseudomonas syringae i Arabidopsis. Forskning rettet mot å forstå samspillet mellom Ralstonia og avlingsanlegg er avgjørende for å utvikle bærekraftige løsninger for å bekjempe bakteriell wilt sykdom, men er for tiden hindret av mangel på enkle eksperimentelle analyser for å karakterisere de ulike komponentene i samspillet i innfødte vertsplanter. I dette scenariet har vi utviklet en metode for å utføre genetisk analyse av Ralstonia infeksjon av tomat, en naturlig vert for Ralstonia. Denne metoden er basert på Agrobacterium rhizogenes-mediert transformasjon av tomatrøtter, etterfulgt av Ralstonia jord-drenching inokulasjon av de resulterende plantene, som inneholder forvandlede røtter som uttrykker konstruksjonen av interesse. Allsidigheten til rottransformasjonsanalysen gjør det mulig å utføre enten genoveruttrykk eller gendeaktivering mediert av RNAi. Som et konseptbevis brukte vi denne metoden til å vise at RNAi-mediert deaktivering av SlCESA6 i tomatrøtter ga motstand mot Ralstonia. Her beskriver vi denne metoden i detalj, slik at genetiske tilnærminger til å forstå bakteriell wilt sykdom på relativt kort tid og med små krav til utstyr og plantevekstplass.

Introduction

Ralstonia solanacearum, årsaksmidlet av bakteriell wilt sykdom, er et ødeleggende jordbåren vaskulær patogen med en verdensomspennende fordeling som kan infisere et stort utvalg av plantearter, inkludert potet, tomat, tobakk, banan, pepper og aubergine, blant annet1,2. Yield tap forårsaket av Ralstonia kan nå 80-90% av produksjonen i tomat, potet eller banan, avhengig av sort, klima, jord og andre faktorer3. Ralstonia-modellen er imidlertid betydelig underutforsket i forhold til andre modeller som involverer bakterielle plantepatogener, for eksempel Pseudomonas syringae eller Xanthomonas spp. I tillegg er de fleste studier i plantemikrobeinteraksjoner fokusert på modellanlegget Arabidopsis thaliana. Selv om forskning ved hjelp av disse modellene i stor grad har bidratt til vår forståelse av plantebakterier interaksjoner, de ikke ta opp dagens nødvendighet for å forstå disse interaksjonene i avlingplanter. Forskning rettet mot å forstå samspillet mellom Ralstonia og avlingsanlegg er avgjørende for å utvikle bærekraftige løsninger for å bekjempe bakteriell wilt sykdom, men er for tiden hindret av mangel på enkle eksperimentelle analyser for å karakterisere de ulike komponentene i samspillet. Spesielt tomat, en naturlig vert for Ralstonia, er den nest viktigste vegetabilske avlingen over hele verden og påvirkes av en mengde sykdommer4, inkludert bakteriell wilt sykdom. I dette arbeidet har vi utviklet en enkel metode for å utføre genetisk analyse av Ralstonia infeksjon av tomat. Denne metoden er basert på Agrobacterium rhizogenes-mediert transformasjon av tomatrøtter, ved hjelp av DsRed fluorescens som utvalgsmarkør5, etterfulgt av Ralstonia jord-drenching inokulasjon av de resulterende plantene, som inneholder forvandlede røtter som uttrykker konstruksjonen av interesse. Allsidigheten til rottransformasjonsanalysen gjør det mulig å utføre enten genoveruttrykk eller gendeaktivering mediert av RNAi.

En potensiell begrensning av denne metoden består på gjenværende vekst av ikke-forvandlede røtter. Dette er spesielt viktig i de tilfellene hvor plasmidbrukt mangler et reportergen som gjør det mulig å velge transformerte røtter. For å løse dette problemet har vi utviklet en alternativ metode basert på antibiotikavalg, som hemmer veksten av ikke-forvandlede røtter samtidig som veksten av sunne antibiotikaresistente forvandlede røtter. Siden A. rhizogenes ikke induserer transformasjonen av skudd, er de utsatt for antibiotika, og derfor bør de holdes atskilt fra det antibiotikaholdige mediet.

Selv om plantemotstand mot Ralstonia ikke er godt forstått, har flere rapporter tilhørende celleveggendringer til økt motstand mot bakteriell wilt6,7,8,9. Det har blitt foreslått at disse celleveggendringene påvirker vaskulær utvikling, et viktig aspekt for livsstilen til Ralstonia inne i anlegget10. Mutasjoner i gener som koder cellulosesynthasene CESA4, CESA7 og CESA8 i Arabidopsis thaliana har vist seg å svekke sekundær celleveggintegritet, noe som forårsaker økt motstand mot Ralstonia, som synes å være knyttet til ABA-signalering8. Derfor, som et bevis på konseptet for vår metode, utførte vi RNAi-mediert gendeaktivering av SlCESA6 (Solyc02g072240), en sekundær celleveggcellulose synthase, og ortholog av AtCESA8 (At4g18780). Påfølgende jord-drenching inokulasjon med Ralstonia viste at deaktivering Av SlCESA6 forbedret motstand mot bakterielle wilt symptomer, noe som tyder på at celle veggmediert motstand mot Ralstonia er sannsynlig bevart i tomat, og validere vår metode for å utføre genetisk analyse av bakteriell wilt resistens i tomat røtter. Her beskriver vi denne metoden i detalj, slik at genetiske tilnærminger til å forstå bakteriell wilt sykdom på relativt kort tid og med små krav til utstyr og plantevekstplass.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

MERK: Viktige deler av denne metoden innebærer håndtering av plantematerialer in vitro, og derfor er det viktig å holde sterile forhold under alle disse prosedyrene, inkludert visualisering av DsRed fluorescens. Under hele transformasjonsprosessen vokser tomatfrøplanter ved 25-28 °C og 16 timer/8 timer lys/mørk (130 μmolfotoner m-2s-1 lys). Platene er forseglet med mikroporetape for å lette gassutveksling og transpirasjon.

1. Utarbeidelse av tomatplanter og Agrobacterium rhizogenes

  1. Steriliser tomatfrø (Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) med 5% (v / v) natriumhypokloritt i 5 min. Vask 4-5 ganger med destillert sterilt vann og hold frøene riste sakte i sterilt vann over natten for å lette spiring.
  2. Overfør tomatfrøene til halvstyrke Murashige og Skoog (1/2 MS) medium uten sukrose (2,21 g / L MS, 8% m / v agar). Oppbevar frøene i mørket ved 25−28 °C i tre dager (figur 1A).
    MERK: Rundt 40 frø er vanligvis nødvendig for hver konstruksjon.
  3. Autoklav 8,5 cm2 firkantede filterpapir. Plasser de firkantede filterpapirene inne i 9 cm2 firkantede petriskåler som inneholder 1/2 MS-medium (plasser papiret på toppen av agaren) og plasser seks spirede tomatfrø på hver tallerken (figur 1B). Forsegle platen med mikroporetape og inkuber de spirede frøene ved 25–28 °C i 3–4 dager.
  4. Grow Agrobacterium rhizogenes MSU440 i solid LB medium (med passende antibiotika) ved 28 °C to dager før plantetransformasjon.
    MERK: A. rhizogenes er levert av Dr. Juan Antonio López Ráez, EEZ-CSIC, Granada, Spania. I eksperimentet som er beskrevet i denne artikkelen, ble A. rhizogenes som inneholder pK7GWIWG2_II-RedRoot::CESA6 eller en tom vektor, som kontroll, brukt. pK7GWIWG2_II-RedRoot inneholder et reportergen, DsRed, drevet av Arabidopsis thaliana ubiquitin promotor (pAtUBQ10), og gir motstand mot spektrosektomi (50 μg/ml). Det er mulig å bruke andre vektorer for genoveruttrykk, som rapportert før5. I dette arbeidet ble forsterkningen av det spesifikke fragmentet for SlCESA6-deaktivering oppnådd ved omvendt transkripsjon (RT) PCR ved hjelp av RNA isolert fra tomat (S. lycopersicum cv. Moneymaker) og ligated i p-ENTR/D-TOPO vektor (Tabell 1). Deretter ble SlCESA6-RNAi-fragmentet klonet inn i den pK7GWIWG2_II-RedRoot binære vektoren.

2. Plantetransformasjon og valg

  1. Bruk en steril skalpell, kutt radicleen og bunnen av hypokotylen til tomatfrøplanter (Figur 1C,D).
  2. Harvest A. rhizogenes biomasse fra overflaten av LB medium ved hjelp av plast tips eller en skalpell blad og forsiktig dyppe kuttet tomat frøplanter i bakteriell biomasse (Figur 1E).
  3. Etter inokulasjon med A. rhizogenes,dekk tomatplantene med et 2 cm x 4 cm halvsirkelformet filterpapir (Figur 1F), for å holde høy luftfuktighet og lette overlevelse og ny rotutvikling.
  4. Oppbevar de forvandlede tomatplantene i 6-7 dager. Deretter bruker du en steril skalpell til å kutte de nye fremvoksende hårete røttene (Figur 1G, H; på dette trinnet blir røttene ikke forvandlet ennå) og la plantene produsere nye hårete røtter.
  5. Når den andre generasjonen av nye hårete røtter vises (Figur 1I), fjern filterpapiret på toppen av plantene, og forsegle platen med mikroporetape igjen.
    MERK: På dette punktet gjør tilstedeværelsen av DsRed fluorescerende markør i transformasjonsvektoren det mulig å visualisere transformasjonseffektiviteten i de nye røttene.
  6. For å visualisere DsRed fluorescens, bruk et stereomikroskop eller annet utstyr for plantein vivo imaging (Figur 1J). Merk den positive (røde fluorescensen) forvandlede røtter og fjern de negative ikke-forvandlede røttene (ingen rød fluorescens) ved hjelp av en steril skalpell.
  7. Overfør plantene som viser rød fluorescens til en ny plate som inneholder 1/2 MS-medium, for å lette utviklingen av den transformerte roten som hovedrot (Figur 1K). Oppbevar plantene som ikke viser rød fluorescens i samme plate for å kontrollere fremveksten av fluorescerende røtter (Figur 1L) i senere tidspunkter.
  8. Alternativ metode basert på antibiotikavalg
    1. Alternativ til trinn 2.5, klargjør halvfylte 9 cm2 kvadratplater som inneholder 1/2 MS-medium med riktig antibiotika. Hell platene ca 5° under forberedelsesprosessen for å generere et tomt rom uten medium (Figur 2A), slik at skuddene kan vokse unngå kontakt med antibiotika.
    2. Alternativ til trinn 2.6, etter å ha kuttet de første ikke-forvandlede hårete røttene dukket opp (trinn 2.4), overføre plantene uten røtter til de halvfylte platene ved hjelp av filterpapir med riktig størrelse (Figur 2B).
      MERK: Som positiv kontroll anbefales det å forvandle flere frøplanter med en plasmid som inneholder samme antibiotikaresistens og et reportergen (i denne protokollen, pK7GWIWG2_II-RedRoot; kanamycin 50 μg/ml).
    3. Alternativ til trinn 2.7, la plantene utvikle nye hårete røtter og kutte de røttene som ikke er i direkte kontakt med overflaten av filtersandwichpapirene, siden disse røttene kan unngå antibiotikavalg.
      MERK: På grunn av antibiotikaeffekten kan rotutviklingen være langsommere enn i plater uten antibiotika. Nye transformerte hårete røtter vises innen 14-18 dager etter overføring av plantene uten røtter til de halvfylte platene (trinn 2.8.2) (Figur 2C-E).
  9. Dekk plantene med et 2 cm x 4 cm halvsirkelfilterpapir, forsegle platen og inkuber plantene for å la dem utvikle nye hårete røtter.
    MERK: Det er ikke nødvendig å eliminere A. rhizogenes ved hjelp av antibiotika. Filterpapiret på toppen av MS-mediet og mangelen på sukrose hemmer spredningen av A. rhizogenes på platen5.
  10. Fem til syv dager etter det første rotvalget gjentar du utvelgelsesprosessen for å velge nye transformerte røtter og fjerner ikke-transformerte røtter. Overfør plantene som inneholder transformerte røtter til en ny plate som inneholder 1/2 MS-medium.

3. Overføring til inokulasjon potter

  1. Forbered inokulasjonspotter hvor overflaten av røttene vil bli utsatt for bakteriell inoculum: suge inokulasjonspotter med vann, hell av overflødig vann og legg dem i et plastplantebrett. Overfør de valgte plantene med transformerte røtter til inokulasjonspotter ved hjelp av pinsett (figur 3A).
  2. Dekk brettet med plastfolie eller et gjennomsiktig lokk og hold dem ved 25-28 °C og 65 % fuktighet (16 t/8 t lys/mørk; 130 μmol fotoner m-2s-1 lys), for å opprettholde et høyt fuktighetsnivå figur 3B). Fjern dekselet etter fem eller seks dager.
    MERK: De transformerte tomatplantene er klare for inokulasjon to til tre uker etter overføring av dem til jord (figur 3C). Under veksten på jord kan tomatplanter produsere nye røtter som ikke forvandles. For å fastslå omfanget av dette fenomenet ble rød fluorescens visualisert i røtter av 3 uker gamle forvandlede tomatplanter. De fleste røtter (80%-100%) viste rød fluorescens, noe som indikerer at de faktisk er forvandlet (Figur 3D,E).

4. Jord-drenching inokulasjon

  1. Grow R. solancearum (stamme GMI1000 i denne protokollen) i phi flytende medium (Tabell 211) i en orbital shaker (200 rpm) ved 28 °C til stasjonær fase.
  2. Bestem bakterietallene ved å måle den optiske tettheten til bakteriekulturen ved 600 nm (OD600). Fortynn bakteriekulturen med vann til en OD600 på 0,1 (under forhold som brukes her, tilsvarer dette ca. 108 kolonidannende enheter [CFU]/ml).
  3. Plasser 16−20 inokulasjonspotter som inneholder transformerte tomatplanter i et inokulasjonsbrett (29 cm x 20 cm; Figur 4A).
  4. Hell 300 ml (~ 15 ml per plante) av bakteriell inoculum (OD600 av 0,1) i skuffen som inneholder inokulasjonspotter. La dem suge i inokulumet i 20 min (Figur 4B).
  5. Forbered en ny skuff med et lag med potting jord. Flytt de inokulerte grytene inn i det nye brettet (Figur 4C) og plasser brettene i et vekstkammer med 75 % fuktighet, 26–28 °C og en fotoperiode på 12 timer lys og 12 timer mørke (130 μmolfotmm -2s-1 lys).

5. Bestemmelse av infeksjonsparametre og statistisk analyse

  1. Score sykdom symptomer som tidligere beskrevet12,13, ved hjelp av en skala fra 0 (ingen symptomer) til 4 (fullstendig visne) (Figur 4D-H), hver dag etter Ralstonia inokulasjon i to uker.
    MERK: Sykdomsindeksdataene samles inn fra samme eksperimentelle enhet (hvert anlegg) over tid.

6. Analyse av genuttrykk

MERK: Uttrykket for transgene eller deaktivering av målgenet kan bestemmes av RT-PCR eller av kvantitativ RT-PCR (qRT-PCR).

  1. Samle inn prøver og trekke ut RNA fra en representativ del av det transformerte rotsystemet (for å evaluere effekten på målgenet) og blader (som internkontroll).
  2. Syntetiser cDNA ved bruk av 1 μg av total DNase-behandlet RNA.
  3. Analyser genuttrykk for målgenene ved qRT-PCR. Beregn de relative transkripsjonsnivåene ved hjelp av2-ΔΔCT-metoden 14,ved hjelp av SlEFα-1 som rengjøringsgen15.
    MERK: Primersekvenser er oppført i tabell 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 5 viser utviklingen av sykdomssymptomer på tomatplanter med røtter forvandlet med en tom vektor (EV), og planter med røtter forvandlet med en RNAi-konstruksjon rettet mot SlCESA6 (Solyc02g072240). Sykdomsindeksdataene (Figur 5A) samles inn fra samme eksperimentelle enhet (hvert anlegg) over tid i henhold til en vilkårlig skala fra 0 til 4, og følger ikke en gaussisk fordeling, og utelukker bruk av standardtester for parametriske data. Videre er det en egen plante-til-plante variasjon i denne typen eksperimenter, på grunn av kolonisering og infeksjondynamikk. Nedenfor vurderte vi ulike metoder for representasjon og statistisk analyse av symptomer knyttet til Ralstonia infeksjon.

Som en standard tilnærming ble en U Mann-Whitney to-tailed ikke-parametrisk test for å sammenligne både kontroll (EV) og SlCESA6-RNAi infeksjonkurver brukt. Ifølge denne analysen ser forskjellen mellom medianene for begge kurvene ut til å være ikke signifikant(P = 0,16).

Det er også mulig å kvantifisere området under sykdomsprogresjonskurven (AUDPC), noe som gjør det mulig å kombinere flere observasjoner av sykdomsfremgang til en enkelt verdi. AUDPC viste en høyere verdi for kontrollanlegg (EV; 28,75 ± 4,75) sammenlignet med SlCESA6-RNAi (21,01 ± 4,74) planter på slutten av infeksjonsprosessen, noe som indikerer at SlCES6-stilnet planter er mer motstandsdyktige mot Ralstonia infeksjon enn kontrollplanter (figur 5B).

Konfidensintervaller (CI) gir en måte å estimere på, med høy sannsynlighet, et verdiområde der populasjonsverdien (eller parameteren) for en gitt variabel finnes. Som det er vist i figur 5C,området 95% KI for kontroll (EV) og SlCESA6-RNAi infeksjon kurver anslår en høyere sjanse for motstand når SlCESA6 er dempet.

Sykdomindeksverdier kan forvandles til binære data, med tanke på en sykdomsindeks lavere enn 2 tilsvarende "0", og en sykdomsindeks lik eller høyere enn 2 tilsvarende "1"12. Dette gjør det mulig å representasjon av en overlevelseskurve etter Ralstonia inokulasjon. Denne transformasjonen er basert på observasjonen at når plantene begynner å utvikle klare symptomer (sykdomsindeks på 2), anses de som "smittet" og vil dø som følge av denne infeksjonen. Forskjellene i overlevelsesraten mellom EV- og SlCESA6-RNAi-anleggene var ikke statistisk signifikante i henhold til en Statistisk test av Gehan-Breslow-Wilcoxon (P = 0,13) (figur 5D).

I tillegg til å utføre statistisk analyse, og uavhengig av de oppnådde P-verdiene, er det verdt å tolke disse dataene basert på reproduserbarheten til de observerte tendensene innenfor forskjellige replikater (Supplerende figur 1). I tråd med denne forestillingen har et økende antall forskere nylig kommentert risikoen for å overbruke strenge statistiske terskler (for eksempel standard P ≤ 0,05)16.

Uttrykket for SlCESA6 ble analysert i to tilfeldig utvalgte transformerte røtter før inokulasjonstrinnet, som viser at den forbedrede motstanden mot Ralstonia korrelerer med det reduserte uttrykket for SlCESA6 (Figur 5E). Ved hjelp av denne metoden kan en transformasjonshastighet på 35-40 % etter to valgrunder oppnås (figur 5F). Denne verdien kan økes ved å utføre flere utvalgsrunder5.

Figure 1
Figur 1: Planteforberedelse, transformasjon og utvelgelse. (A) Spiring av tomatfrø i halvstyrke MS (1/2) medium. (B) Spiret tomatfrø plassert på filterpapir som ligger på en tallerken som inneholder 1/2 MS-medium. Tomatfrøplanter før (C) og etter (D) kutte reddik og bunnen av hypokotylen. (E) Tomat frøplante transformasjon ved å dyppe i bakteriell biomasse. (F) Forvandlede tomatfrøplanter dekket med filterpapir for å opprettholde fuktighet. Fremveksten (G) og fjerning (H) av nye (ikke-forvandlede) hårete røtter. (I) Forvandlede røtter. (J) Valg av forvandlede tomat hårete røtter ved visualisering av DsRed fluorescens. Røde piler indikerer positive forvandlede røtter som uttrykker DsRed fluorescens. (K) Utvikling av de forvandlede røttene som de viktigste røttene. (L) Visualisering av DsRed fluorescens i modne forvandlede røtter. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 2
Figur 2: Alternativ metode basert på antibiotikavalg. (A) Halvfylt firkantet plate som inneholder 1/2 MS-medium. (B) Kutt frøplanter avhendes på filterpapir liggende på 1/2 MS medium med antibiotika, etter fjerning av første ikke-forvandlede hårete røtter. (C) Røtter dekket med ekstra filterpapir. (D) Tomat forvandlet røtter dyrket på 1/2 MS medium med antibiotika. (E) Frøplanter forvandlet med pK7GWIWG2_II-RedRoot (kanamycin 50 μg/ml), uttrykker DsRed, som positiv kontroll. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 3
Figur 3: Overføring av forvandlet tomat til inokulasjonspotter. (A)Rotforvandlede tomater overført til full-gjennomvåt inokulasjon potter. (B) Forvandlede tomater i inokulasjonpotter dekket med et plastlokk for å opprettholde høyt fuktighetsnivå. ToCtil tre uker gamle rotforvandlede tomater, etter overføring til inokulasjonspotter, klar til å bli inokulert. (D) Tre uker gamle tomatplanter etter å ha fjernet jorda. (E) DsRed fluorescens i røtter av 3-ukers forvandlede tomatplanter. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 4
Figur 4: Ralstonia jord-drenching inokulasjon. (A) Materialer som trengs for R. solanacearum GMI1000 inokulasjon. (B) Jord-drenching av forvandlede tomater i inokulasjon potter med R. solanacearum GMI1000 ioculum. (C) Inokulerte tomater plassert på et lag av potting jord. - Jeg har ikke noe åsi. Ralstonia sykdom symptomer skala fra 0 (ingen symptomer) til 4 (fullstendig visner). Vennligst klikk her for å se en større versjon av denne figuren.

Figure 5
Figur 5: SlCESA6-deaktivering forbedrer motstanden mot R. solanacearum. (A) Sykdomsymptomer på RNAi-mediert SlCESA6-silenced (CESA6-RNAi) og tom vektor (EV) rotforvandlet tomatplanter ved inokulasjon med R. solanacearum. Verdier tilsvarer midlene ± SE av åtte planter. (B) Område under sykdomsprogresjonskurven av planter vist i panel A. (C) 95% konfidensIntervall av planter vist i panel A. (D) Prosent av overlevende planter vist i panel A. (E) Genuttrykksanalyse av qRT-PCR av RNAi-mediert SlCESA6-silenced (CESA6i) og EV rot-ødelagte tomatplanter i røtter (1,2) og skyte (S). Verdier tilsvarer midlene ± SE av tre tekniske replikater. (F) Transformasjonshastighet av EV og CESA6-RNAi rotforvandlede tomatplanter av to uavhengige eksperimenter. Verdier tilsvarer midlene ± SE, etter to runder med valg. Vennligst klikk her for å se en større versjon av denne figuren.

Primer navn Primer sekvens (5'-3')
EFα-1-F (Andre) GGTGGCGAGCATGATTTTGA (Nær GGTGGCGAGCATGATTTTGA)
EFα-1-R (Andre) CGAGCCAACCATGGAAAACAA (andre kan være på vei mot
QCESA6-F (andre kan være på vei mot GATCTGGTTCGCTTCTCGT
QCESA6-R (andre kan være på vei til ÅRE) TCCCTCCCTTTCATACCTTG (Andre)
Cesa6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
Cesa6-RNAi-R TTTGAGACTTTGGCACTGGA (TTTGAGACTTTGGCACTGGA)

Tabell 1: Primersekvenser.

Ingredienser For 1 L
Bacto peptone 10 g
Gjær ekstrakt 1 g
Casamino syrer 1 g

Tabell 2: Phi (Ø) medium sammensetning.

Tilleggstall 1: Reproduserbarhet av resultatet vist i figur 5A. Sykdomssymptomer på RNAi-mediert SlCESA6-silenced (CESA6-RNAi) og EV rotforvandlet tomatplanter ved inokulasjon med R. solanacearum. Verdier tilsvarer midlene ± SE av åtte planter. Genuttrykksanalyse ble utført av qRT-PCR av RNAi-mediert SlCESA6-silenced (CESA6i) og Empty Vector (EV) rotforvandlede tomatplanter i røtter (1,2) og skyte (S). Verdier tilsvarer midlene ± SE av tre tekniske replikater. Vennligst klikk her for å laste ned denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia solanacearum utgjør en viktig trussel mot landbruket; Men samspillet med naturlige verter av landbruksbetydning er fortsatt dårlig forstått sammenlignet med andre bakterielle patogener, spesielt i planteplantearter. I de fleste tilfeller er genetisk analyse hindret av tid og utgifter som kreves for å genetisk modifisere vertsplanter. For å løse dette problemet og lette genetisk analyse av R. solanacearum infeksjon i tomat, har vi utviklet en enkel metode basert på Agrobacterium rhizogenes-mediert transformasjon av tomatrøtter (Figur 1), etterfulgt av jord-drenching inokulasjon (Figur 3). De transformerte røttene velges ved hjelp av en fluorescerende reporter (DsRed i denne protokollen) (Figur 1). I tillegg har vi også utviklet en alternativ metode basert på antibiotikavalg som ikke skader den ikke-transformerte antennedelen (Figur 2).

Transformasjonsprotokollen er basert på det som er beskrevet av Ho-Plágaro et al.5, med flere modifikasjoner. Allsidigheten til denne metoden tillater flere ekstra analyser i transformerte røtter, for eksempel de som analyserer plantefysiologi, respons på kjemiske behandlinger og / eller svar på ulike biotiske og abiotiske påkjenninger.

Etter å ha overført de forvandlede plantene til jord, vurderte vi muligheten for at planter kan utvikle nye røtter som kanskje ikke kan forvandles. Vi utforsket denne muligheten ved å observere fluorescensen fra DsRed i rotsystemet av transformerte planter to uker etter overføring av dem til jord (før Ralstonia inokulasjon). Resultatene viste rød fluorescens i de fleste røttene (figur 3D).

T-DNA overføring av Agrobacterium er integrert i vertsgenomet på en tilfeldig måte, og derfor genererer denne metoden en heterogen populasjon av tomatplanter med forskjellig uttrykksnivå av målgenet. R. solanacearum infeksjon forårsaker normalt plantens død, som senere hindrer innsamling av rotprøver etter eksperimentet for å analysere genuttrykket til hver plante. For å analysere uttrykksnivået til målgenet under forsøkene, velger vi to til tre rotforvandlede planter før inokulasjonstrinnet, som representativt utvalg av befolkningen som vil bli vaksinert. Figur 5 viser at reduksjonen av sykdomssymptomer i tomatplanter korrelerer med effektiviteten av SlCESA6-deaktivering før inokulasjonstrinnet. Derfor, og til tross for begrensningene i protokollen, viser våre representative resultater tydelig at denne metoden er et kraftig verktøy for å studere kandidatgener involvert i motstand eller mottakelighet for R. solanacearum i tomat. Eksemplet som vises i denne artikkelen tillot oss å fastslå at nedslående SlCESA6, en sekundær celle veggrelatert cellulose synthase, forbedrer motstandmot infeksjon av R. solanacearum, som ligner tidligere observasjoner ved hjelp av sin ortholog AtCESA8 (At4g18780) fra Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker alle laboratoriemedlemmer av Macho-laboratoriet for nyttige diskusjoner, Alvaro López-García for statistisk rådgivning, og Xinyu Jian for teknisk og administrativ hjelp under dette arbeidet. Vi takker KJERNEanlegget for PSC Cell Biology for hjelp med fluorescensavbildning Dette arbeidet ble støttet av Strategic Priority Research Program for det kinesiske vitenskapsakademiet (gi XDB27040204), Shanghai Center for Plant Stress Biology (kinesisk Academy of Sciences) og det kinesiske 1000 Talents-programmet.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics