Transformation des racines de tomate suivie de l’inoculation avec Ralstonia Solanacearum pour l’analyse génétique directe de la maladie bactérienne de wilt

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous présentons une méthode polyvalente pour la transformation des racines de tomate suivie de l’inoculation avec Ralstonia solanacearum pour effectuer l’analyse génétique simple pour l’étude de la maladie bactérienne de flétrir.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum est un agent pathogène vasculaire dévastateur transmis par le sol qui peut infecter un large éventail d’espèces végétales, ce qui constitue une menace importante pour l’agriculture. Cependant, le modèle Ralstonia est considérablement sous-exploré par rapport à d’autres modèles impliquant des pathogènes végétaux bactériens, tels que les seringues Pseudomonas dans Arabidopsis. La recherche visant à comprendre l’interaction entre Ralstonia et les plantes cultivées est essentielle pour développer des solutions durables pour lutter contre la flétrie bactérienne, mais elle est actuellement entravée par l’absence d’essais expérimentaux simples pour caractériser les différentes composantes de l’interaction dans les plantes hôtes indigènes. Dans ce scénario, nous avons développé une méthode pour effectuer l’analyse génétique de l’infection Ralstonia de la tomate, un hôte naturel de Ralstonia. Cette méthode est basée sur Agrobacterium rhizogenes- transformation médiatisée des racines de tomate, suivie par l’inoculation du sol Ralstonia des plantes résultantes, contenant des racines transformées exprimant la construction de l’intérêt. La polyvalence de l’essai de transformation des racines permet d’effectuer soit la surexpression génétique ou le silençage génétique médié par les ARNi. Comme preuve de concept, nous avons utilisé cette méthode pour montrer que le silence par médiation RNAi de SlCESA6 dans les racines de tomate confère une résistance à Ralstonia. Ici, nous décrivons cette méthode en détail, permettant aux approches génétiques de comprendre la maladie bactérienne de flétrissement dans un temps relativement court et avec de petites exigences de l’équipement et de l’espace de croissance des plantes.

Introduction

Ralstonia solanacearum, l’agent causal de la maladie bactérienne de flétrissement, est un agent pathogène vasculaire dévastateur transmis par le sol avec une distribution mondiale qui peut infecter une grande gamme d’espèces végétales, y compris la pomme de terre, la tomate, le tabac, la banane, le poivre et l’aubergine, entre autres1,2. Les pertes de rendement causées par Ralstonia peuvent atteindre 80-90% de la production de tomates, de pommes de terre ou de bananes, selon le cultivar, le climat, le sol et d’autres facteurs3. Cependant, le modèle Ralstonia est considérablement sous-exploré par rapport à d’autres modèles impliquant des pathogènes végétaux bactériens, tels que pseudomonas syringae ou Xanthomonas spp. En outre, la plupart des études sur les interactions plantes-microbe sont axées sur la plante modèle Arabidopsis thaliana. Bien que la recherche utilisant ces modèles ait largement contribué à notre compréhension des interactions plante-bactérie, elles ne répondent pas à la nécessité actuelle de comprendre ces interactions dans les plantes cultivées. La recherche visant à comprendre l’interaction entre Ralstonia et les plantes cultivées est essentielle pour développer des solutions durables pour lutter contre la flétrie bactérienne, mais elle est actuellement entravée par l’absence d’essais expérimentaux simples pour caractériser les différentes composantes de l’interaction. En particulier, la tomate, un hôte naturel pour Ralstonia, est la deuxième culture végétale la plus importante dans le monde et est affectée par une pléthore de maladies4, y compris la maladie bactérienne de flétrissement. Dans ce travail, nous avons développé une méthode facile pour effectuer l’analyse génétique de l’infection de Ralstonia de la tomate. Cette méthode est basée sur Agrobacterium rhizogenes-transformation négociée des racines de tomate, en utilisant la fluorescence DsRed comme marqueur de sélection5, suivie par l’inoculation du sol Ralstonia des plantes résultantes, contenant des racines transformées exprimant la construction de l’intérêt. La polyvalence de l’essai de transformation des racines permet d’effectuer soit la surexpression génétique ou le silençage génétique médié par les ARNi.

Une limitation potentielle de cette méthode consiste en la croissance résiduelle des racines non transformées. Ceci est particulièrement important dans les cas où le plasmide utilisé n’a pas de gène reporter qui permet la sélection des racines transformées. Pour résoudre ce problème, nous avons développé une méthode alternative basée sur la sélection des antibiotiques, qui inhibe la croissance de racines non transformées tout en permettant la croissance de racines transformées résistantes aux antibiotiques saines. Étant donné que A. rhizogenes n’induit pas la transformation des pousses, ils sont sensibles à l’antibiotique, et, par conséquent, ils doivent être tenus séparés du milieu antibiotique contenant.

Bien que la résistance des plantes contre Ralstonia ne soit pas bien comprise, plusieurs rapports ont associé des altérations de la paroi cellulaire à une résistance accrue au flétrissement bactérien6,7,8,9. Il a été suggéré que ces altérations de mur cellulaire affectent le développement vasculaire, un aspect essentiel pour le mode de vie de Ralstonia à l’intérieur de la plante10. Les mutations dans les gènes codant les synthases de cellulose CESA4, CESA7 et CESA8 dans Arabidopsis thaliana ont été montrés pour altérer l’intégrité secondaire de mur de cellules, causant une résistance accrue à Ralstonia, qui semble être liée à la signalisation ABA8. Par conséquent, comme une preuve de concept pour notre méthode, nous avons effectué le silençage génétique RNAi-négocié de SlCESA6 (Solyc02g072240), une synthase de cellulose cellule-mur secondaire secondaire, et orthologue de AtCESA8 (At4g18780). L’inoculation subséquente de sol-drenching avec Ralstonia a prouvé que le silence SlCESA6 a augmenté la résistance aux symptômes bactériens de flétrissement, suggérant que la résistance mur-négociée de cellules à Ralstonia est probablement conservée dans la tomate, et validant notre méthode pour effectuer l’analyse génétique de la résistance bactérienne de flétrie dans les racines de tomate. Ici, nous décrivons cette méthode en détail, permettant aux approches génétiques de comprendre la maladie bactérienne de flétrissement dans un temps relativement court et avec de petites exigences de l’équipement et de l’espace de croissance des plantes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

REMARQUE : Des parties importantes de cette méthode impliquent la manipulation des matériaux végétaux in vitro, et il est donc important de maintenir des conditions stériles pendant toutes ces procédures, y compris la visualisation de la fluorescence DsRed. Pendant tout le processus de transformation, les semis de tomates poussent à 25 à 28 oC et à 16 h/8 h léger/foncé (130 photons demol m-2s-1 lumière). Les plaques sont scellées avec du ruban adhésif micropore afin de faciliter l’échange de gaz et la transpiration.

1. Préparation des plants de tomates et des rhizogenes Agrobacterium

  1. Stériliser les graines de tomates (Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) avec 5% (v/v) hypochlorite de sodium pendant 5 min. Laver 4-5 fois avec de l’eau stérile distillée et garder les graines trembler lentement dans l’eau stérile pendant la nuit pour faciliter la germination.
  2. Transférer les graines de tomate à murashige et Skoog (1/2 MS) moyen sans saccharose (2,21 g/L MS, 8% w/v agar). Maintenir les graines dans l’obscurité à 25 à 28 oC pendant trois jours(figure 1A).
    REMARQUE : Environ 40 graines sont habituellement nécessaires pour chaque construction.
  3. Autoclave 8,5 cm2 papiers filtres carrés. Placez les papiers filtres carrés à l’intérieur des boîtes de Petride 9 cm 2 cm 2 carrés contenant un milieu de 1/2 MS (placez le papier sur le dessus de l’agar) et placez six graines de tomates germées dans chaque assiette(figure 1B). Sceller la plaque avec du ruban adhésif micropore et incuber les graines germées à 25 à 28 oC pendant 3 à 4 jours.
  4. Cultivez Agrobacterium rhizogenes MSU440 en milieu LB solide (avec antibiotiques appropriés) à 28 oC deux jours avant la transformation des plantes.
    REMARQUE : A. rhizogenes est fourni par le Dr Juan Antonio Lepez Ràez, EEZ-CSIC, Grenade, Espagne. Dans l’expérience décrite dans cet article, A. rhizogenes contenant pK7GWIWG2_II-RedRoot : ::CESA6 ou un vecteur vide, comme contrôle, ont été utilisés. pK7GWIWG2_II-RedRoot contient un gène reporter, DsRed, entraîné par le promoteur Arabidopsis thaliana ubiquitin (pAtUBQ10), et confère une résistance à la spectinomycine (50 g/mL). Il est possible d’utiliser d’autres vecteurs pour la surexpression génétique, tel que rapporté avant5. Dans ce travail, l’amplification du fragment spécifique pour le silence SlCESA6 a été obtenue par transcription inverse (RT) PCR à l’aide d’ARN isolé de la tomate (S. lycopersicum cv. Moneymaker) et ligated en p-ENTR/D-TOPO vector (tableau 1). Par la suite, le fragment SlCESA6-RNAi a été cloné dans le vecteur binaire pK7GWIWG2_II-RedRoot.

2. Transformation et sélection des plantes

  1. À l’aide d’un scalpel stérile, couper le radicle et le fond de l’hypocotyl des semis de tomates(figure 1C,D).
  2. RécolteZ la biomasse de rhizogenes de la surface du milieu LB à l’aide de pointes en plastique ou d’une lame de scalpel et trempez soigneusement les semis coupés de tomates dans la biomasse bactérienne(figure 1E).
  3. Après l’inoculation avec A. rhizogenes, couvrir les semis de tomates avec un papier filtre semi-circulaire de 2 cm x 4 cm(figure 1F), afin de maintenir une humidité élevée et de faciliter la survie et le développement de nouvelles racines.
  4. Conserver les semis transformés de tomates pendant 6-7 jours. Ensuite, utilisez un scalpel stérile pour couper les nouvelles racines poilues émergentes(figure 1G,H; à cette étape, les racines ne sont pas encore transformées) et permettre aux semis de produire de nouvelles racines poilues.
  5. Une fois que la deuxième génération de nouvelles racines poilues apparaissent (figure 1I), retirez le papier filtre sur les semis, et scellez la plaque avec du ruban adhésif micropore à nouveau.
    REMARQUE : À ce stade, la présence du marqueur fluorescent DsRed dans le vecteur de transformation permet de visualiser l’efficacité de transformation dans les nouvelles racines.
  6. Pour visualiser la fluorescence DsRed, utilisez un stéréomicroscope ou tout autre équipement pour l’imagerie in vivo végétale(figure 1J). Marquez les racines positives (fluorescence rouge) transformées et enlevez les racines négatives non transformées (pas de fluorescence rouge) à l’aide d’un scalpel stérile.
  7. Transférer les semis montrant la fluorescence rouge dans une nouvelle plaque contenant un milieu de la SP 1/2, afin de faciliter le développement de la racine transformée comme racine principale(figure 1K). Conservez les semis qui ne montrent pas de fluorescence rouge dans la même plaque pour vérifier l’émergence de racines fluorescentes(figure 1L) dans les points de temps ultérieurs.
  8. Méthode alternative basée sur la sélection des antibiotiques
    1. Alternative à l’étape 2.5, préparer des plaques carrées demi-remplies de 9 cm2 contenant un milieu de 1/2 MS avec l’antibiotique approprié. Incliner les plaques à environ 5 degrés pendant le processus de préparation pour générer un espace vide sans milieu(figure 2A), permettant aux pousses de croître en évitant tout contact avec l’antibiotique.
    2. Alternative à l’étape 2.6, après avoir coupé les premières racines poilues non transformées émergé (étape 2.4), transférer les semis sans racines sur les plaques à moitié remplies à l’aide de papiers filtres avec la taille appropriée (figure 2B).
      REMARQUE : En tant que contrôle positif, il est recommandé de transformer plusieurs semis avec un plasmide contenant la même résistance aux antibiotiques et un gène reporter (dans ce protocole, pK7GWIWG2_II-RedRoot; kanamycine 50 g/mL).
    3. Alternative à l’étape 2.7, laissez les semis développer de nouvelles racines poilues et couper les racines qui ne sont pas en contact direct avec la surface des papiers de sandwich filtre, puisque ces racines peuvent éviter la sélection d’antibiotiques.
      REMARQUE : En raison de l’effet antibiotique, le développement des racines peut être plus lent que dans les plaques sans antibiotiques. De nouvelles racines poilues transformées apparaissent dans les 14 à 18 jours suivant le transfert des semis sans racines dans les assiettes à moitié remplies (étape 2.8.2) (figure 2C-E).
  9. Couvrir les semis d’un papier filtre semi-cercle de 2 cm x 4 cm, sceller la plaque et incuber les semis pour les laisser développer de nouvelles racines poilues.
    REMARQUE : Il n’est pas nécessaire d’éliminer les rhizogenes A. à l’aide d’antibiotiques. Le papier filtre sur le dessus du milieu de la SP et le manque de saccharose inhibent la propagation des rhizogenes A. sur la plaque5.
  10. Cinq à sept jours après la première sélection des racines, répétez le processus de sélection pour sélectionner de nouvelles racines transformées et enlever les racines non transformées. Transférer les semis contenant des racines transformées en une nouvelle plaque contenant un milieu de 1/2 MS.

3. Transfert aux pots d’inoculation

  1. Préparer des pots d’inoculation où la surface des racines sera exposée à l’inoculum bactérien : tremper les pots d’inoculation avec de l’eau, verser tout excès d’eau et les placer dans un plateau de plantation en plastique. Transférer les semis sélectionnés avec des racines transformées en pots d’inoculation à l’aide de pincettes (figure 3A).
  2. Couvrir le plateau d’une pellicule plastique ou d’un couvercle transparent et de les conserver à 25 à 28 oC et à 65 % d’humidité (16 h/8 h de lumière/obscurité; 130 photons demol m-2s-1 lumière), pour maintenir un niveau élevé d’humidité Figure 3B). Retirer le couvercle après cinq ou six jours.
    REMARQUE : Les plants de tomates transformés sont prêts pour l’inoculation deux à trois semaines après leur transfert dans le sol(figure 3C). Pendant la croissance sur le sol, les plants de tomates peuvent produire de nouvelles racines qui ne sont pas transformées. Pour déterminer l’étendue de ce phénomène, la fluorescence rouge a été visualisée dans les racines des plants transformés de tomate de 3 semaines. La plupart des racines (80%-100%) a montré la fluorescence rouge, indiquant qu’ils sont effectivement transformés (figure 3D,E).

4. Inoculation d’arrosage des sols

  1. Cultivez R. solancearum (souche GMI1000 dans ce protocole) en milieu liquide phi(tableau 211) dans un shaker orbital (200 tr/min) à 28 oC jusqu’à la phase stationnaire.
  2. Déterminer les nombres bactériens en mesurant la densité optique de la culture bactérienne à 600 nm (OD600). Diluer la culture bactérienne avec de l’eau à un OD600 de 0,1 (dans des conditions utilisées ici, cela correspond à environ10 8 unités de formation de colonies [CFU]/mL).
  3. Placer les pots d’inoculation 16-20 contenant des plants de tomates transformés dans un plateau d’inoculation (29 cm x 20 cm; Figure 4A).
  4. Verser 300 ml (15 ml par plante) d’inoculum bactérien(OD 600 de 0,1) dans le plateau contenant les pots d’inoculation. Laissez-les tremper dans l’inoculum pendant 20 min (figure 4B).
  5. Préparer un nouveau plateau avec une couche de terreau. Déplacez les pots inoculés dans le nouveau plateau(figure 4C) et placez les plateaux dans une chambre de croissance avec 75% d’humidité, 26 à 28 oC, et un photoperiod de 12 h de lumière et 12 h d’obscurité (130 photons demol m-2s-1 lumière).

5. Détermination des paramètres d’infection et analyse statistique

  1. 12 ,13,13en utilisant une échelle allant de 0 (pas de symptômes) à 4 (flétrissement complet)(figure 4D-H), chaque jour après l’inoculation de Ralstonia pendant deux semaines.
    REMARQUE : Les données de l’indice de la maladie sont recueillies à partir de la même unité expérimentale (chaque plante) au fil du temps.

6. Analyse de l’expression génique

REMARQUE : L’expression du transgène ou le silence du gène cible peut être déterminée par RT-PCR ou par RT-PCR quantitatif (qRT-PCR).

  1. Recueillir des échantillons et extraire l’ARN d’une partie représentative du système racinaire transformé (pour évaluer l’effet sur le gène cible) et les feuilles (comme contrôle interne).
  2. Synthèse cDNA à l’aide de 1 g d’ARN traité par DNase.
  3. Analyser l’expression génique des gènes cibles par qRT-PCR. Calculez les niveaux de transcription relatifs à l’aide de la méthode 2-CT 14, en utilisant SlEF-1 comme gène d’entretienménager 15.
    REMARQUE : Les séquences d’introduction sont répertoriées dans le tableau 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figure 5 montre le développement des symptômes de la maladie des plants de tomates avec des racines transformées avec un vecteur vide (EV), et les plantes avec des racines transformées avec une construction d’ARNi ciblant SlCESA6 (Solyc02g072240). Les données de l’indice de la maladie(figure 5A) sont recueillies à partir de la même unité expérimentale (chaque plante) au fil du temps selon une échelle arbitraire de 0 à 4, et ne suivent pas une distribution gaussienne, excluant l’utilisation de tests standard pour les données paramétriques. En outre, il existe une variation intrinsèque de plante à plante dans ce type d’expériences, en raison de la colonisation et la dynamique des infections. Ci-dessous nous avons considéré différentes méthodes pour la représentation et l’analyse statistique des symptômes associés à l’infection de Ralstonia.

En approche standard, un test non paramétrique à deux queues U Mann-Whitney pour comparer les courbes d’infection à deux queues (EV) et SlCESA6-RNAi a été utilisé. Selon cette analyse, la différence entre les médianes des deux courbes semble non significative(P - 0,16).

Il est également possible de quantifier la zone sous la courbe de progression de la maladie (AUDPC), ce qui permet de combiner de multiples observations de la progression de la maladie en une seule valeur. AUDPC a montré une valeur plus élevée pour les plantes témoins (EV; 28,75 à 4,75) par rapport aux plantes SlCESA6-RNAi (21,01 à 4,74) à la fin du processus d’infection, ce qui indique que les plantes silencieuses SlCES6sont plus résistantes à l’infection à Ralstonia que les usines témoins(figure 5B).

Les intervalles de confiance (CI) offrent un moyen d’estimer, avec une forte probabilité, une gamme de valeurs dans lesquelles la valeur (ou le paramètre) de la population d’une variable donnée se trouve. Comme il est indiqué dans la figure 5C, la zone de IC à 95% pour le contrôle (EV) et slCESA6-RNAi courbes d’infection estimer un plus grand risque de résistance lorsque SlCESA6 est réduit au silence.

Les valeurs de l’indice de la maladie peuvent être transformées en données binaires, compte tenu d’un indice de la maladie inférieur à 2 correspondant à «0», et un indice de la maladie égal ou supérieur à 2 correspondant à «1»12. Cela permet la représentation d’une courbe de survie après l’inoculation de Ralstonia. Cette transformation est basée sur l’observation que, une fois que les plantes commencent à développer des symptômes clairs (indice de la maladie de 2), ils sont considérés comme «infectés» et mourront à la suite de cette infection. Les différences dans le taux de survie entre les plantes EV et SlCESA6-RNAi n’étaient pas statistiquement significatives selon un test statistique Gehan-Breslow-Wilcoxon(P - 0,13) (figure 5D).

En plus d’effectuer une analyse statistique, et indépendamment des valeurs P obtenues, il vaut la peine d’interpréter ces données en fonction de la reproductibilité des tendances observées au sein de différentes répliques(figure supplémentaire 1). Conformément à cette notion, un nombre croissant de scientifiques ont récemment commenté les risques d’un surutiliser des seuils statistiques stricts (tels que la norme P - 0,05)16.

L’expression de SlCESA6 a été analysée dans deux racines transformées choisies au hasard avant l’étape d’inoculation, montrant que la résistance accrue à Ralstonia est corrélée avec l’expression réduite de SlCESA6 (figure 5E). Grâce à cette méthode, un taux de transformation de 35 à 40 % après deux rondes de sélection peut être obtenu(figure 5F). Cette valeur peut être augmentée en effectuant des tours de sélection supplémentaires5.

Figure 1
Figure 1 : Préparation, transformation et sélection des plantes. (A) Germination des graines de tomate dans le milieu de la MS à moitié forte (1/2). (B) Graines de tomates germées placées sur du papier filtre couché sur une assiette contenant un milieu de la M.D. Semis de tomate avant (C) et après (D) couper le radicle et le fond de l’hypocotyl. (E) Transformation des semis de tomates en plongeant dans la biomasse bactérienne. (F) Semis transformés de tomates recouvertes de papier filtre pour maintenir l’humidité. Émergence (G) et l’enlèvement (H) de nouvelles racines poilues (non transformées). (I) Racines transformées. (J) Sélection des racines poilues de tomate transformées par visualisation de la fluorescence DsRed. Les flèches rouges indiquent des racines transformées positives exprimant la fluorescence DsRed. (K) Développement des racines transformées comme racines principales. (L) Visualisation de la fluorescence DsRed dans les racines transformées matures. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Méthode alternative basée sur la sélection des antibiotiques. (A) Plaque carrée demi-remplie contenant un milieu de 1/2 MS. (B) Couper les semis éliminés sur du papier filtre couché sur un milieu de la SEP 1/2 avec un antibiotique, après l’élimination des premières racines poilues non transformées. (C) Racines recouvertes de papier filtre supplémentaire. (D) Racines transformées de tomate cultivées sur un milieu de SEP 1/2 avec un antibiotique. (E) Semis transformés avec pK7GWIWG2_II-RedRoot (kanamycine 50 g/mL), exprimant DsRed, comme contrôle positif. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Transfert de la tomate transformée en pots d’inoculation. (A) Tomates transformées en racines transférées dans des pots d’inoculation imbibés. (B) Tomates transformées dans des pots d’inoculation recouverts d’un couvercle en plastique pour maintenir un niveau élevé d’humidité. (C) Deux à trois semaines de tomates transformées en racines, après transfert à des pots d’inoculation, prêts à être inoculés. (D) Plantes de tomates de trois semaines après avoir enlevé le sol. (E) Fluorescence DsRed dans les racines des plants de tomates transformés de 3 semaines. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Inoculation de sol-drenching de Ralstonia. (A) Matériaux nécessaires pour l’inoculation R. solanacearum GMI1000. (B) Soil-drenching of transformed tomatoes in inoculation pots with R. solanacearum GMI1000 inoculum. (C) Tomates inoculées placées sur une couche de terre cuite. (D-H) Ralstonia symptômes de la maladie échelle allant de 0 (pas de symptômes) à 4 (flétrissement complet). S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Le silence slCESA6 améliore la résistance à R. solanacearum. (A) Symptômes de la maladie de SlCESA6-silencieux (CESA6-RNAi) et vecteur vide (EV) plantes de tomates transformées en racines sur l’inoculation avec R. solanacearum. Les valeurs correspondent aux moyens de huit plantes. (B) Zone sous la courbe de progression de la maladie des plantes montrées dans le panneau A. (C) 95% de confiance Intervalle des plantes montrées dans le panneau A. (D) Pourcentage des plantes survivantes montrées dans le panneau A. (E) Analyse d’expression de gène par qRT-PCR de SlCESA6-négociéeRNAi -silenced (CESA6i) et EV racines-transformées en racines (1,2) et pousse (S). Les valeurs correspondent aux moyens de trois répliques techniques. (F) Taux de transformation de EV et CESA6-RNAi racines transformées plantes de tomates de deux expériences indépendantes. Les valeurs correspondent aux moyens de SE, après deux tours de sélection. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Nom d’apprêt Séquence d’apprêt (5'-3')
EF-1-F GGTGGCGAGCATGATTTTGA
EF-1-R CGAGCCAACCATGGAAAACAA
qCESA6-F GATCTGGTTCGCTTTCTCTCGCTCGCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
CESA6-RNAi-R TTTGAGactTGGCactGGGGA

Tableau 1 : Séquences d’apprêt.

Ingrédients Pour 1 L
Peptone Bacto 10 g
Extrait de levure 1 g
Acides casamnés 1 g

Tableau 2 : Composition moyenne de Phi.

Figure supplémentaire 1 : Reproductibilité du résultat indiqué dans la figure 5A. Symptômes de la maladie de l’ARNi-négocié SlCESA6-silenced (CESA6-RNAi) et EV racines transformées plantes de tomates sur l’inoculation avec R. solanacearum. Les valeurs correspondent aux moyens de huit plantes. L’analyse de l’expression génique a été effectuée par qRT-PCR de SlCESA6-silencieux (CESA6i) et empty Vector (EV) de plants de tomates transformés en racines (1,2) et de pousse (S). Les valeurs correspondent aux moyens de trois répliques techniques. S’il vous plaît cliquez ici pour télécharger ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia solanacearum représente une menace importante pour l’agriculture; cependant, son interaction avec les hôtes naturels d’importance agricole est encore mal comprise par rapport à d’autres agents pathogènes bactériens, en particulier chez les espèces végétales. Dans la plupart des cas, l’analyse génétique est entravée par le temps et les dépenses nécessaires pour modifier génétiquement les plantes hôtes. Pour résoudre ce problème et faciliter l’analyse génétique de l’infection à R. solanacearum dans la tomate, nous avons développé une méthode facile basée sur agrobacterium rhizogenes- transformation médiatisée des racines de tomate(figure 1), suivie de l’inoculation du sol(figure 3). Les racines transformées sont sélectionnées à l’aide d’un journaliste fluorescent (DsRed dans ce protocole) (Figure 1). De plus, nous avons également mis au point une méthode alternative basée sur la sélection des antibiotiques qui n’endommage pas la partie aérienne non transformée(figure 2).

Le protocole de transformation est basé sur celui décrit par Ho-Plôgaro et al.5, avec plusieurs modifications. La polyvalence de cette méthode permet de multiples essais supplémentaires dans les racines transformées, telles que celles d’analyser la physiologie végétale, la réponse aux traitements chimiques, et / ou des réponses à différents stress biotiques et abiotiques.

Après avoir transféré les plantes transformées en sol, nous avons envisagé la possibilité que les plantes puissent développer de nouvelles racines qui ne peuvent pas être transformées. Nous avons exploré cette possibilité en observant la fluorescence de DsRed dans le système racinaire des plantes transformées deux semaines après les avoir transférées au sol (avant l’inoculation de Ralstonia). Les résultats ont montré la fluorescence rouge dans la majorité des racines(figure 3D).

Le transfert d’ADN T par Agrobacterium est intégré dans le génome hôte de manière aléatoire, et, par conséquent, cette méthode génère une population hétérogène de plants de tomates avec un niveau d’expression différent du gène cible. L’infection à R. solanacearum provoque normalement la mort des plantes, ce qui, par la suite, entrave la collecte d’échantillons de racines après l’expérience pour analyser l’expression génique de chaque plante. Pour analyser le niveau d’expression du gène cible pendant les expériences, nous sélectionnons deux à trois plantes transformées en racines avant l’étape d’inoculation, comme échantillon représentatif de la population qui sera inoculée. La figure 5 montre que la réduction des symptômes de la maladie chez les plants de tomates est en corrélation avec l’efficacité du silence slCESA6 avant l’étape de l’inoculation. Par conséquent, et malgré les limites du protocole, nos résultats représentatifs démontrent clairement que cette méthode est un outil puissant pour étudier les gènes candidats impliqués dans la résistance ou la susceptibilité à R. solanacearum dans la tomate. L’exemple montré dans cet article nous a permis de déterminer que l’élimination SlCESA6, une synthase de cellulose liée à la paroi cellulaire secondaire, améliore la résistance à l’infection par R. solanacearum, ressemblant à des observations précédentes en utilisant son orthologue AtCESA8 (At4g18780) de Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions tous les membres du laboratoire Macho pour des discussions utiles, Alvaro Lopez-Garcia pour des conseils statistiques, et Xinyu Jian pour l’assistance technique et administrative pendant ce travail. Nous remercions l’installation de base de biologie cellulaire de la CFP pour son aide à l’imagerie par fluorescence Ce travail a été soutenu par le Programme de recherche prioritaire stratégique de l’Académie chinoise des sciences (subvention XDB27040204), le Shanghai Center for Plant Stress Biology (Chinois) Académie des sciences) et le programme chinois 1000 Talents.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics