Изоляция региона конкретных микроглии от одного взрослого полушария мозга мыши для глубокой одноклеточной РНК секвенирования

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Мы предоставляем протокол для изоляции микроглии от различных расчлененных областей полушария мозга взрослой мыши, а затем полуавтоматизированную подготовку библиотеки для глубокого одноклеточного секвенирования РНК полнометражных транскриптомов. Этот метод поможет выяснить функциональную неоднородность микроглии в здоровье и болезни.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhou, L., Li, Q. Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing. J. Vis. Exp. (154), e60347, doi:10.3791/60347 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Как резидент макрофаги в центральной нервной системе, микроглии активно контролируют развитие мозга и гомеостаза, и их дисфункции могут управлять человеческими заболеваниями. Значительные успехи были сделаны, чтобы раскрыть молекулярные подписи гомеостатической микроглии, а также изменения их экспрессии генов в ответ на экологические стимулы. С появлением и созреванием одноклеточных геномных методологий все шире признается, что неоднородная микроглия может лежать в основе различных ролей, которые они играют в различных условиях развития и патологических условиях. Дальнейшее вскрытие такой неоднородности может быть достигнуто путем эффективной изоляции микроглии от данной области интереса, за которой следует чувствительное профилирование отдельных клеток. Здесь мы предоставляем подробный протокол для быстрой изоляции микроглии из различных областей мозга в одном полушарии мозга для взрослых мышей. Мы также демонстрируем, как использовать эти отсортированные микроглии для одноклеточного секвенирования РНК на основе пластин. Мы обсуждаем приспособляемость этого метода к другим сценариям и предоставляем руководящие принципы для совершенствования системы для размещения крупномасштабных исследований.

Introduction

Микроглия, представляющая 5%-10% всех нервных клеток, являются резидентными макрофагами, разбросанными по всей центральной нервной системе (ЦНС)1. Защищенный за гематоэнцефалии барьер, типичные микроглии в здоровом мозге взрослого содержат много тонких процессов, которые быстро продлить и втягивать взаимодействовать с нейронами и другими глиальными клетками в parenchyma. Микроглия может также принять амебоидной морфологии, связанные с увеличением фагоцитарной функции на конкретных стадиях развития или на иммунные проблемы при травме и болезни1,2,3,4. Недавние захватывающие открытия ясно показали, что микроглии ни в коем случае не являются пассивными наблюдателями к мозгу полученных или патологических сигналов, но играют ключевую роль в контроле развития мозга и гомеостаза, например, поддерживая выживание нейронов, обрезка незрелых синапсов, содействие дифференциации линий олигодендроцитов, а также ангиогенез1. По мере того как больше функций микроглии выяснены, возбуждение более далее подпитывается людскими исследованиями генетики, которые показали что много нейродегенеративных генов риска заболевания, such as TREM2, большей частью или исключительн выражено микроглией5,6,7. . Учитывая их значение в развитии и правдоподобные болезни вождения роли, огромные усилия были направлены на наше понимание микроглиальной регуляции генов и функции в надежде найти новые терапевтические цели для нейродегенеративных заболеваний1,8.

Секвенирование РНК (РНК-сек) позволяет объективно охарактеризовать экспрессию генов типа клеток, что, в свою очередь, направляет ученых к изучению функций генов в плотных клеточных сетях7. РНК-сек в основном было сделано на массовых образцов, что привело к открытию гомеостатической микроглиальной подписи гена, который отличает их от других нервных и иммунных клеток9. Однако такой подход может упускать из виду молекулярные и функциональные различия между микроглией, особенно те, которые временно присутствуют в процессе развития, или связанные со старением и болезнями. Действительно, одноклеточный РНК-сек (scRNA-seq) предлагает чувствительность и разрешение, которые произвели революцию в этой области, выявив ранее недооцененную неоднородность микроглии в различных контекстах2,3,10. Кроме того, в связи с наличием других аналогичных иммунных клеток на цНС-циркуляции интерфейса, scRNA-seq предоставляет информацию, помогающую дизайн новых инструментов для разделения и функционально вскрыть эти связанные клетки с небольшим ипредварительных знаний2,11.

Был изобретен разнообразный набор платформ scRNA-seq, каждая из которых подходит для определенных приложений12. В целом, методы на основе капель, такие как 10x геномика, выше пропускной связи с (десятки) тысячи клеток последовательной в каждом запуске, и они менее избирательны для ввода, которые могут содержать смешанные популяции клеток, требующих широкой классификации. Методы на основе плит обеспечивают более высокую чувствительность и глубину чтения13,14, как правило, ориентации конкретных популяций от сортировки клеток, чтобы выявить тонкие различия или редкие стенограммы. Учитывая небольшой процент микроглиальных клеток, особенно субпопуляций, связанных с развитием или болезнями, среди всех типов клеток ЦНС, часто желательно изолировать микроглию от конкретной области, интересуемых, и получить глубокую и полноформатную транскриптомическую информацию, с тем чтобы понять их неоднородность.

Здесь мы предоставляем подробную информацию о том, как изолировать микроглии из различных областей мозга мыши расчленены из одного полушария, которые используются для одноклеточных (или объемных) РНК-сек после полуавтоматической пластины на основе процедуры подготовки библиотеки. Другое полушарие может быть использовано для гистологической проверки. Оптимизированный из ранее опубликованного метода9,этот протокол изоляции направлен на максимизацию выхода от небольшого количества исходных материалов, а тем временем поддерживать эндогенные профили экспрессии микроглиальных генов. Мы используем флуоресценцию активированных клеток сортировки (FACS) для обогащения микроглии (или других связанных иммунных клеток, представляющих интерес) в 96-колодных пластин и миниатюризации объемов реагентов для подготовки библиотеки для того, чтобы увеличить пропускную способность. Мы выделяем эту чувствительную платформу scRNA-seq, хотя могут быть применены и другие стратегии на основе пластин. Этот метод может быть легко адаптирован для изоляции микроглии от других расчлененных тканей, таких как травмы или заболевания очагов, и возраст мыши может варьироваться практически на всех послеродовых стадиях. Эффективная изоляция региональной микроглии для одноклеточных исследований транскриптомики будет способствовать лучшему пониманию их функций в области здравоохранения и болезней.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все процедуры с участием грызунов соответствовали руководящим принципам Стэнфордского университета, которые соответствуют национальным законам и политике штатов. Все процедуры для животных были одобрены Административной группой Стэнфордского университета по уходу за лабораторными животными.

ПРИМЕЧАНИЕ: Все решения и буферные композиции приведены в таблице материалов.

1. Подготовка в День изоляции ячеек

  1. Подготовьте следующие реагенты и охладьте их на льду: средний A (50 мл), магнитно-активированный сортировка клеток (MCS) буфер (30 мл), буфер FACS (25 мл), фосфат-буферный солен (PBS; 30 мл), DNase (320 л) и ингибитор RNase (30 л).
    ПРИМЕЧАНИЕ: Объемы, приведенные здесь, достаточны для изоляции микроглии от 4 областей мозга (например, коры головного мозга, мозжечка, гиппокампа и стриатума) одного полушария мозга мыши. Масштабируйте, если используется больше тканей.
  2. Поместите четыре чистых 2 мл Dounce гомогенизаторов на льду и добавить 2 мл среднего С 80 зл DNase (12500 единиц / мл) и 5 л ингибитора RNase в каждом dounce гомогенизатор. Охладите поршни в трубках 15 мл.
  3. Пометьте четыре 6 см блюда Петри с областями мозга для сбора тканей и добавьте 200 кл холодного среднего А в каждое блюдо на льду. Добавить около 5 мл среднего в 6 см Петри блюдо для вскрытия.
    ПРИМЕЧАНИЕ: Перед использованием убедитесь, что все реагенты стерильны и подходят для РНК-приложений. Скамейка и вскрытие инструменты должны быть чистыми и распыляется с RNase обеззараживания решение (Таблица материалов).

2. Рассечение региона мозга

ПРИМЕЧАНИЕ: Этот шаг должен занять 30 мин.

  1. Вводят в пеританум ювенильной и взрослой сценической мыши 400-500 л кетамина/ксилазина (24 мг/мл кетамина и 2,4 мг/мл ксилазина) в перитонею несовершеннолетнего для взрослых сценических мышей (nogt;1 месяц).
    ПРИМЕЧАНИЕ: Мужская мышь используется здесь для иллюстрации, но любой пол подходит.
  2. Подождите 5 минут и щипать заднюю лапу, чтобы обеспечить отсутствие опровержения.
  3. Немедленно используйте иглу 26 G x 3/8 для выполнения перфузии транскардиаального с 20-30 мл ледяного PBS до тех пор, пока буфер не иссякнет без видимой крови.
  4. Обезглавить мышь с помощью хирургических ножниц. Используйте небольшие ножницы, чтобы разрезать кожу, чтобы разоблачить под черепом, а затем прорезать сагитальный шов, лямбдой шва и коронарный шов. Используйте щипцы, чтобы снять обе стороны теменной кости и межпальковой кости, не повреждая ткани, и осторожно переместить мозг в рассечение чашку Петри со средним А.
  5. Используйте предварительно охлажденное лезвие, чтобы разрезать мозг через середину в два полушария.
    ПРИМЕЧАНИЕ: Четыре области мозга, описанные здесь из одного полушария дают достаточное количество микроглии для одноклеточных или объемных применений РНК-сек. Другое полушарие может быть использовано для иммуногистохимии или РНК на месте проверки.
  6. Отделить мозжечок от корковой доли и ствола мозга с #55 щипцов и перенести ткань в коллекцию чашку Петри.
  7. Используйте #55 щипцы, чтобы тщательно вскрыть гиппокампа и стриатум из коры и передать каждую ткань в коллекцию чашку Петри.

3. Механическая диссоциация тканей

ПРИМЕЧАНИЕ: Держите клетки и реагенты остыть все время, за исключением во время окрашивания шагов. Этот шаг должен занять 30 мин.

  1. Нарезать каждую ткань мозга с лезвием бритвы в злот;1 мм3 мелких кусочков.
  2. Используйте 1 мл пипетки (с наконечниками отрезали) для передачи частей ткани в предварительно охлажденных Dounce гомогенизаторов, каждый из которых содержит 2 мл среднего с DNase и ингибиторОм RNase.
  3. Гомогенизировать ткань, медленно скручивая поршень в и из гомогенизатора Dounce для 6'10 полных ударов, пока нет видимых кусков.
    ПРИМЕЧАНИЕ: Douncing убивает нейроны и большинство других глиальных клеток, но оставить микроглиальных клеток, а нетронутыми. Как недостаточное, так и чрезмерное дуновирование может привести к низкой урожайности клеток.
  4. Перенесите диссоциированные ткани в трубки 50 мл через 70 мкм-ситектов.
  5. Промыть каждый Dounce гомогенизатор и поршень в общей сложности 6 мл холодной среды и фильтрования раствор а через тот же ситечко в соответствующую трубку.
  6. Перенесите одноклеточные подвески (около 8 мл каждая) в конические трубки 15 мл и центрифугу при 400 х г в течение 5 мин при 4 кв с тормозом No 5.

4. Удаление Миелина

ПРИМЕЧАНИЕ: Этот шаг должен занять 60 мин.

  1. Подготовьте 1 колонку большого истощения (LD) (для коры головного мозга) и 3 больших колонки (LS) (для других 3 областей) в магнитном сепараторе(Таблица материалов). Промыть каждый столбец с 3 мл буфера MCS.
  2. После того, как центрифугация закончена, пипетка и отбросить супернатант, не нарушая гранулы. Для тканей коры и мозжечка, resuspend клетки в 850 Зл буфера MCS с 1,8 л ингибитора RNase. Для гиппокампа и стриатумт тканей, resuspend клеток в 400 зл и в буфере MCS с 0,9 л ингибитора RNase.
    ПРИМЕЧАНИЕ: Столбцы (LD против LS) и объем, используемый для повторной подвески, оптимизированы в зависимости от количества миелина, присутствующем в ткани. Если другие области мозга анализируются, эти условия, возможно, должны быть скорректированы в зависимости от размера ткани и сколько миелина может существовать. Эффективность удаления миелина можно оценить в шаге 4.9.
  3. Добавьте 100 зЛ бисера удаления миелина каждый в клетки из коры и мозжечка и добавить 50 зликат миелина удаления бисера каждый в клетки из гиппокампа и стриатума.
  4. Аккуратно перемешайте клетки с бисером и насигните трубки на льду в течение 10 мин.
  5. Доведите объем трубки с корковыми клетками до 2 мл с буфером MCS, а все остальные до 1 мл (т.е. добавьте 1 мл для корковых клеток; 500 л для гиппокампальных и стриатальных клеток; нет необходимости добавлять буфер к мозжечковым клеткам).
  6. После того, как столбцы опорожняются, поместите трубку длиной 15 мл ниже каждой колонны. Нагрузка корковых клеток (2 мл) на столбец LD, и все остальные (1 мл каждый) на столбцы LS. Немедленно используйте 1 мл буфера MCS каждый для мытья оригинальных труб и загрузите раствор на соответствующие колонны.
  7. Вымойте столбец LD один раз с 1 мл буфера MCS и мыть каждый столбец LS дважды с 1 мл буфера MCS каждой стирки. Продолжайте собирать сквозной раствор во время стирки.
  8. Фильтр клетки в круглые нижние трубки FACS через 35 мкм ситечко.
    ПРИМЕЧАНИЕ: Каждая трубка должна собрать около 4 мл одноклеточной подвески, истощенной миелином.
  9. Дополнительно, возьмите 10 qL клеточной подвески и смешайте его с 10 зл 0,4% trypan синий раствор. Изучите клетки под 10-м ярким полевым микроскопом, чтобы оценить урожайность, выживаемость и уровень остаточного миелина.
    ПРИМЕЧАНИЕ: Успешный препарат должен генерировать более 90% живых клеток (круглый по форме и за исключением синего красителя) практически без миелина мусора.
  10. Клетки пеллет в трубках FACS при 400 х г в течение 5 мин при 4 градусах По цельсию, с тормозом 5. Медленно вылить супернатант и мазок края трубки на бумаге. Resuspend клетки в каждой трубке с 300 зл и l буфера FACS.
    ПРИМЕЧАНИЕ: Если сортировка MCS предпочтительна, шарики CD11b могут быть использованы для выбора микроглии и других миелоидных клеток после удаления миелина. Эти клетки могут быть использованы для не-пластины на основе scRNA-seq, а также объемНОЙ РНК-сек. Предостережение этого альтернативного подхода заключается в том, что бисер CD11b не отделяет микроглию от других связанных иммунных клеток, которые также являются положительными для этого антигена.

5. Окрашивание для флуоресценции активированной сортировки клеток

ПРИМЕЧАНИЕ: Этот шаг должен занять 40 минут.

  1. Добавить 5 зл и l рецепторов мыши Fc блок реагента (Таблица материалов) в каждой трубке. Инкубировать в течение 5 мин на льду.
  2. Добавьте в каждую трубку 1 qL CD45-PE-Cy7 и 1 Зл CD11b-BV421.
    ПРИМЕЧАНИЕ: Антитела с другими конъюгированными флюорофорами могут быть использованы. Антитела против TMEM119, специфический маркер для гомеостатической микроглии9, также могут быть включены, но рекомендуется использовать вместе с CD45 и CD11b, потому что некоторые субпопуляции микроглии могут потерять выражение поверхности TMEM119.
  3. Инкубировать трубки на шейкере в течение 10 минут при комнатной температуре (RT).
  4. Добавьте 2 мл буфера FACS для мытья.
  5. Клетки пеллет при 4 градусах Цельсия, 400 х г в течение 5 мин. Медленно вылейте супернатант и обмазать край трубки на бумажной ткани. Повторное использование клеток в каждой трубке с использованием 400 qL буфера FACS с 1 qL ингибитора RNase и 0,5 зла пропидий йодида (PI, 1:1,000 разбавления).

6. Индекс FACS Сортировка

ПРИМЕЧАНИЕ: Этот шаг должен занять 1 ч.

  1. Следуя стандартной процедуре FACS, рисуйте ворота на основе рассеяния (за исключением мусора), одиночных клеток, живых клеток (PI отрицательный), микроглии и миелоидных клеток (CD45,CD11b).
    ПРИМЕЧАНИЕ: Типичные микроглиальные клетки выражают CD45 на более низких уровнях по сравнению с другими связанными с границами макрофагами, такими как периваскулярные и менингеальные макрофаги, и, следовательно, gating на CD45 низкий CD11b- должно быть достаточно, если в центре внимания исследования находится профили экспрессии генов в этих классических микроглии1,2. Тем не менее, некоторые подмножества микроглии могут иметь более высокое выражение CD45, и это особенно верно во время развития или в условиях заболевания. Для обеспечения объективного анализа экспрессии микроглиальных генов, cd45 высоких и CD45 низких иммунофенотипов могут быть записаны через настройки сортировки индекса и обе популяции собраны для секвенирования и анализа вниз по течению. Кроме того, выражение поверхности TMEM119 может быть использовано для таргетинга на гомеостатической микроглиальной популяции (см. шаг 5.2) и проанализировано вместе с уровнями CD45 и результатами секвенирования.
  2. Сортировать одну микроглию (с соплом 100 мкм) в 96-хорошо полимеразы цепной реакции (ПЦР) пластин, содержащих 4 Зл лиза буфера каждый хорошо (см. опубликованный протокол14 для деталей).
    ПРИМЕЧАНИЕ: Внешний консорциум управления РНК (ERCC) РНК шип-в смеси (Таблица материалов) могут быть добавлены в 1:2.4 х 107 в буфере лизиса для контроля качества и нормализациицелей 2.
  3. Кратко вихрь пластин и спина вниз с помощью скамейки верхней центрифуги.
  4. Немедленно заморозить образцы на сухом льду. Храните тарелки при -80 градусах по Цельсию до подготовки библиотеки.
    ПРИМЕЧАНИЕ: Кроме того, больше клеток могут быть собраны в 1,5 мл труб с РНК-буфер экстракции для навалом РНК-сек. По опыту авторов, 3000 ячеек достаточно для создания библиотек хорошего качества после опубликованного протокола2,14.

7. Одноклеточный РНК-секвенирование библиотеки Подготовка

ПРИМЕЧАНИЕ: Здесь, опубликованный протокол14 следует для создания scRNA-seq библиотек с помощью жидкости обработки робототехники и несколько модификаций. В этой статье процедура лишь кратко описана, и различия выделены. Обработка 4 пластин одновременно занимает около 2,5 дней.

  1. Оттепель пластин на льду и выполнять обратную транскрипцию с Oligo-dT30VN грунтовки (в буфере лисиса) для генерации кДНК с тепловыми циклами (Таблица 1): 42 C 90 мин; 70 кв 5 мин; 4 градуса по Цельсию. Затем усиливайте кДНК дополнительным шагом пищеварения exonuclease в начале (Таблица 2) с помощью мастер-микса ПЦР и на месте ПЦР (ISPCR) грунтовки(Таблица материалов) и следующее состояние ПЦР: 37 кв 30 мин; 95 кв 3 мин; 23 цикла по 98 градусов по Цельсию 20 с, 67 градусов по Цельсию 15 с, 72 кв 4 мин; 72 кв 5 мин.
  2. Очистите кДНК с использованием 18 л магнитных бусин окнух (коэффициент 0,7:1). Инкубировать пластину на магнитной подставке в течение 5 мин и мыть образцы дважды с свежеприготовленным 80% этанола, 80 л на скважину каждый раз. После высыхания пластины в течение 15-20 мин, elute кДНК с 20 злицита буфера на хорошо.
    ПРИМЕЧАНИЕ: Для контроля качества используйте анализатор фрагментов (высокой чувствительностью следующего поколения, анализ фрагментов, 1-6000 вт) для проверки распределения размеров и концентраций кДНК, и только дальнейшие образцы процесса с мазком между 500-5,000 bp, и выше 0,05 нг/л.
  3. Для создания библиотек смешайте 0,4 л каждого образца кДНК с 1,2 злителя тимента Tn5 реагентов из комплекта подготовки библиотеки(Таблица материалов)в 384-хорошую пластину с помощью нанолитрового трубачного аппарата, при 55 кв 10 мин.
    ПРИМЕЧАНИЕ: Здесь добавляется 1/12,5 из предлагаемого объема реакции (5 л образца и 15 л реагентов тегментации) добавляется для снижения затрат и между тем увеличения пропускной всей проходики. Нанолитерная трубачная машина(Таблица материалов)используется для передачи реагентов (это и последующие шаги) из и до 384-колодцев.
  4. Добавьте 0,4 л буфера нейтрализации, чтобы остановить реакцию тегменции на RT в течение 5 мин.
  5. Добавьте 384 индекса(Таблица Материалов,0,4 л вперед и 0,4 л обратного), 1,2 л смеси ПЦР к образцам (по 2 л каждый) и усиливайте библиотеки, используя следующее условие: 72 кв 3 мин; 95 градусов по Цельсию 30 с; 10 циклов по 95 градусов по Цельсию 10 с, 55 градусов по Цельсию 30 с, 72 кв 1 мин; 72 кв 5 мин.
  6. Объедините все отдельные библиотеки (возьмите по 1 л каждая) из одной и той же пластины 384 колодца вместе и используйте магнитные бусы(таблица материалов,соотношение 0,7:1) для очистки окончательных объединенных библиотек.
  7. Используйте флюорометр(Таблица материалов) для измерения концентраций и биоанализатор(Таблица материалов) для изучения распределения размеров объединенных библиотек перед секвенированием. Целевой глубины секвенирования на 1 миллион сырых считывает на ячейку.
  8. Следуйте стандартным биоинформатическим процедурам для фильтрации и обрезки секвенирования считывания и выполнения выравнивания2. Используйте таблицу подсчета и метаданные в качестве входных данных для анализа кластеризации с пакетом Seurat15.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Этот протокол описывает метод изоляции и сортировки микроглии из различных областей мозга в одном взрослом полушарии мозга, за которым следует scRNA-seq. Мы используем douncing для создания одной подвески клеток, а также в качестве первого шага для обогащения микроглии. Недостаточное или чрезмерное наддувание снижает урожайность. Кроме того, мозг и мозг и мозг взрослых мышей содержат высокий уровень миелина, что также может снизить эффективность сортировки и урожайность, если не удалить должным образом. Таким образом, мы исследуем суспензию клетки под микроскопом с помощью трипан синий и гемоцитометр для оценки урожайности, жизнеспособности клеток и эффективности удаления миелина (шаг 4.9) перед выполнением антитела окрашивания (Рисунок 1). Общее количество клеток на данный момент должно быть более 30000 для коры головного мозга, и более 5000 для других тканей. Более 90% клеток должны быть жизнеспособными с небольшим количеством миелина мусора.

Мы используем машину FACS для сортировки микроглии (или миелоидных клеток), которые, как правило, CD45 низким и CD11b положительным. По крайней мере, для корковой ткани, успешная изоляция должна генерировать более 80% микроглии из всех живых одиночных клеток(рисунок 2). Умирающая/умерётая популяция составляет лишь малую часть препарата (около 10%).

После того, как отдельные микроглии захвачены в буфер лиза, РНК высвобождается и затем обратное транскрибируется к кДНК, которая затем усиливается в течение 23 циклов. Важно проверить качество этих образцов кДНК, по крайней мере, часть из них, прежде чем делать библиотеки. Как платформа капиллярного электрофорасиса, анализатор фрагментов и высокочувствительные наборы фрагментов NGS (1-6000 bp) обеспечивают быструю и точную информацию о распределении размеров, а также количество молекул кДНК, присутствующих в каждой скважине 96-хорошей пластины(рисунок 3A). Образцы, показывающие мазок (500-5000 bp) и выше определенного порога концентрации (например, 0,05 нг/Л) могут быть использованы для изготовления библиотек. Аналогичным образом, объединенные библиотеки должны быть протестированы на биоанализаторе перед секвенированием(рисунок 3B).

Мы секвенирования образцов на глубину более 1 миллиона сырых считывает на ячейку, которая насыщает способность обнаружения этой методологии scRNA-seq16. При частоте карт около 60% можно обнаружить более 2000 генов на микроглиальную клетку. Мы получили опубликованные данные, которые были получены с помощью этого метода изоляции17, и продемонстрировать его воспроизводимость от независимых экспериментов и чувствительность для обнаружения микроглии конкретных генов по секвенированной популяции (Рисунок 4).

Figure 1
Рисунок 1: Оценка выхода изоляции микроглии, жизнеспособности клеток и эффективности удаления миелина. Левая панель показала яркое полевое изображение (4x увеличение) трипан синих окрашенных клеток (из коры головного мозга) после прохождения через колонны удаления миелина. Результаты для других регионов будут выглядеть похожими, но с меньшим количеством ячеек. Подавляющее большинство (если не все) клеток оказались яркими (неокрашенными) и круглыми из-за потери процессов. Право изображение было зум-в (20x) из коробки области и мало миелина мусора присутствовал. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Ворота, используемые для сортировки микроглии. Данные показали стратегию сортировки микроглии из коры головного мозга, и такая же стратегия использовалась и для других регионов. Сотовый мусор был впервые исключен из участка рассеяния, и отдельные ячейки были закрыты вперед рассеяния области (FSC-A)/вперед рассеяния ширины (FSC-W). Живые клетки были закрыты PI отрицательное окрашивание, которые были от около 90% всех одиночных клеток. Микроглия, представляющая примерно 80% живых клеток, была отсортирована из низких ворот CD45. В общей сложности микроглии в размере 30 000 фунтов могут быть выделены и отсортированы из ткани коры головного мозга (из одного полушария 3-месячной мыши). Сортировка индекса проводилась на машине FACS. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3

Figure 3
Рисунок 3: Результаты контроля качества представителя для усиленной кДНК из одной микроглиальной ячейки и в конечном итоге объединенной библиотеки. (A) Используя анализатор фрагмента, все фрагменты построены с их размерами на оси X, и относительной интенсивностью флуоресценции на оси Y, означая обилие данного размера cDNA. LM (нижний маркер, 1 bp) и UM (верхний маркер, 6000 bp) являются маркерами загрузки с известными концентрациями, используемыми для измерения количества кДН. Успешно усиленная кДНК из репрезентативной микроглиальной клетки образует кривую (зеленую пунктирную линию) на графике распределения размеров или мазок (помеченный кронштейн) на гелевом графике между 500 bp и 5,000 bp. Другие помеченные пики были усилены из молекул ERCC шип-в молекулили или рибосомной РНК. Концентрация кДНК между 500 bp и 5,000 bp может быть количественно, и те образцы с концентрацией выше 0,05 нг /КЛ и показывая такие типичные кривые сохраняются для подготовки библиотеки. РФС, относительная флуоресценция. (B) Представитель результат контроля качества на биоанализаторе, показывающем распределение размера окончательной объединенной библиотеки (около 380 ячеек). Как правило, она колеблется от 200 б.п. до 2000 б.п. со средним размером 400-600 б.п. Двумя острыми пиками были погрузочные маркеры. FU, флуоресценция. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: scRNA-seq анализ микроглии изолированы из 4 областей мозга двух мышей мужского пола. (A) tSNE участок, показывающий переплета шаблон арегионарной микроглии (были выделены только клетки из мыши #1). Они не образуют различных кластеров в зависимости от происхождения региона за тонкий сдвиг в концентрированных районах на участке tSNE (возможно, из-за пакетных эффектов). Это наблюдение согласуется с ограниченной региональной неоднородностью микроглии, основанной на глобальной экспрессии генов у взрослых мышей (см. недавнюю публикацию2 для дальнейшего обсуждения этой темы). (B) tSNE участок, показывающий перекрывающийся узор микроглии от двух отдельных мышей, которые были обработаны независимо. Хотя небольшие пакетные эффекты могут существовать (клетки, концентрирующиеся в определенных областях участка), эти клетки не образуют различных кластеров в зависимости от происхождения животных. Этот результат свидетельствует о воспроизводимости протокола для сравнения данных между экспериментами. (C) Выражение генов подписи микроглии обнаружено scRNA-seq показывая над 95% тарифом обнаружения для специфических маркеров, such as Tmem119 и P2ry12, и над 80% тарифом обнаружения для известных факторов транскрипции such as Sall1 и Pu.1. Данные были повторно проанализированы из опубликованной литературы17. (D) Подавляющее большинство изолированных микроглии отсутствие экспрессии генов, характерных для других типов клеток, таких как Tubb3 (нейроны), Aldh1l1 (астроциты), Gjb1 (олигодендроциты), и Tie1 (эндотелиальные клетки). (E) Выражение генов, связанных микроглиальной активации или стресса. Классические маркеры, Tnf, Il1b, Nos2, и Nfkb2, которые скромно выражены, показаны на вершине. Ранние гены ответа, Egr1 и Fos, показаны внизу (см. обсуждение). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Реагента Объем (КЛ)
Лиза клетки 4
Обратная транскрипта (100 U/L) 0.95
Ингибитор рназы 0.25
5x Первый буфер нити 2
Дитиотрейтол (DTT; 100 мМ) 0.5
Бетаин (5 м) 2
MgCl2 (1 M) 0.06
Шаблон переключатель олиго (TSO; 100 мкм) 0.1
H2O 0.14
Общая 10

Таблица 1: Обратная транскрипция состояния. Предусмотрены тома реагента для одной обратной реакции транскрипции.

Реагента Объем (КЛ)
Обратный транскрипционный продукт 10
2x PCR мастер-микс 12.5
Праймер ISPCR (10 мкм) 0.25
Ламбда экзонуклизе 0.1125
H2O 2.1375
Общая 25

Таблица 2: Состояние усиления ПЦР. Предусмотрены объемы реагентов для одного ПЦР-усиления кДНК из одной клетки.

Плита на основе (этот протокол) Капли на основе (10x геномика)
Чувствительность Обнаружено больше генов Меньше генов обнаружено
Полная длина Да Нет (5' или 3' конец)
Гибкость для ячеек/популяций Подходит для характеристики малых или редких субпопуляций Подходит для широкой категоризации популяций больших клеток
Пропускной способности До нескольких тысяч клеток Сотни и десятки тысяч клеток
Уникальный молекулярный идентификатор Нет Да
Стоимость ячейки $1-$5 менее $1
Экспериментальная сложность Больше шагов и обычно требуют жидкостной обработки робототехники Простой для выполнения с коммерциализированными машинами
Популяции клеток Целенаправленная сортировка FACS Объективной

Таблица 3: Сравнение методов на основе тарелость и капельна на основе scRNA-seq. В этой статье предусмотрена процедура полнометражного scRNA-seq на основе пластин, которая имеет преимущества более высокой чувствительности, полнометражного секвенирования и гибкости для небольшого числа ячеек в качестве входных данных. Методы на основе droplet предлагают преимущества более высокой пропускной выхажий, более низкой стоимости, простоты в эксплуатации и данных в уникальных молекулярных идентификаторах. Они дополняют друг друга в зависимости от цели экспериментов.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Микроглия активно взаимодействует с другими типами клеток в ЦНС, и они очень чувствительны к экологическим стимулам. Для того, чтобы свести к минимуму воспалительные реакции и аномальные изменения в экспрессии их генов в процессе изоляции, этот протокол был упорядочен из ранее опубликованного метода9, и теперь подходит для изоляции микроглии из нескольких областей одного полушария мозга мыши параллельно. Ткани и реагенты хранятся при холодной температуре, а эксперименты проводятся своевременно (около 3,5 ч от вскрытия до сортировки) с меньшим количеством стир и меньшим количеством реагентов на основе ограниченных размеров тканей. Мы выбираем douncing по сравнению с другими методами гомогенизации, таких как ферментативное пищеварение, потому что механическая диссоциация может убить и, таким образом, удалить нейроны и другие глиальные клетки, вызывая небольшой ущерб или активации микроглии9,18. Чрезмерное дуновирование, однако, может снизить урожайность микроглии и следует избегать. Ранее было показано, что механическая диссоциация и бисер на основе удаления миелина следуют FACS сортировки ввести меньше активации микроглии, на основе минимального выражения классических воспалительных генов, например, Tnf, Il1b, Nos2, и Nfkb29 (Рисунок 4E). Тем не менее, микроглия все еще может реагировать на условия ex vivo во время диссоциации и сортировки путем upregulating ранних генов ответа, таких как Fos и Egr1 (Рисунок 4E), которые обычно не выражаются микроглии in vivo2,19, и такие изменения от транскриптомических исследований всегда должны быть проверены на гистологии разделов.

Здесь мы предоставляем процедуры для изоляции микроглии от коры головного мозга, мозжечка, гиппокампа и стриатума из полушария мозга взрослых мышей, и этот протокол может быть легко адаптирован к другим регионам или этапам. Это полезно для ситуаций, например, когда пораженная болезнью микроглия ограничена определенными областями мозга, которые могут быть расчленены, или в исследованиях старения, где объединение образцов нецелесообразно из-за значительных индивидуальных вариаций. С наличием антител против микроглиальных (или пан врожденных иммунных) эпитопов, этот протокол также может быть адаптирован для изоляции микроглии у крыс или человеческихтканей 9. При регулировке для больших или старых тканей, важно рассмотреть и проверить объем миелина удаления бисера и тип столбцов, используемых. Альтернативным подходом для удаления миелина является центрифугирование градиента плотности в коммерческих низковязкихносителях 20. В целом эти два метода сопоставимы по своей эффективности, хотя метод центрифугирования градиента плотности может обеспечить несколько более высокие урожаи, а с другой стороны, метод магнитных бусин вменьшей степени вводит эндотоксины, которые могут активировать микроглию21,22.

Из-за небольшого процента микроглии среди общих клеток мозга, это часто необходимо обогатить или очистить микроглии перед выполнением одноклеточных транскриптомических исследований. Мы используем FACS в качестве чувствительного подхода для захвата малопредставленных типов клеток и выбираем микроглию на основе выражения поверхности CD11b и CD45. Из одного полушария мы обычно получаем микроглию в размере 30 000 евро для коры головного мозга и микроглию в размере 5000 фунтов за мозжечок, гиппокамп или стриатум. Эти урожаи достаточны для большинства одноклеточных приложений, а также объемных РНК-сек (3000 или более ячеек могут быть использованы). Стоит отметить, что микроглия может upregulate CD45 иммунореактивности во время развития или болезни2, и в этом случае клетки с низким и высоким уровнем CD45 должны быть записаны и индекс отсортированы для анализа. Другой вариант для обогащения микроглии является использование CD11b бисера посреднические магнитно-активированные клетки сортировки после удаления миелина, но это будет ограничивать scRNA-seq капли методы.

Для изучения экспрессии микроглиальных генов при одноклеточном разрешении мы обычно сортируют клетки по крайней мере в 2,3 96-колодцевы пластины на образец и выполняем библиотечную подготовку с помощью жидкостных машин обработки. Было показано, что эта пластина на основе полнометражной библиотеки подготовки подход является одним из наиболее чувствительных scRNA-seq методы в пределах обнаружения, что позволяет точной количественной оценки редких стенограмм, таких как транскрипционные факторы13,14,16. Из-за полнометражного секвенирования, этот подход не подлежит 5' или 3' смещения и может быть использован для анализа вариантов сплайсинга (Таблица 3). Кроме того, в отличие от методов на основе капель, которые обычно требуют сотни или тысячи клеток в реакции, этот протокол на основе пластин имеет гибкость, чтобы включить небольшое количество клеток в каждом эксперименте, и постепенно расширить размер популяции, добавив больше пластин в дизайн позже. Это выгодно при изучении небольших подмножеств микроглии в определенных условиях, таких как эмбриональное развитие.

В то время как этот протокол воспроизводит высококачественные библиотеки scRNA-seq для микроглии мозга, он часто подходит только для небольших исследований из-за относительно высокой стоимости (около $5/cell для подготовки библиотеки, все еще дешевле, чем $23/cell при использовании с полки SmartSeq v4 kit). Несколько стратегий могут помочь снизить стоимость и увеличить пропускную плату. Во-первых, клетки могут быть сортированы в 384-колодские пластины с всего лишь 0,5 л буфера из лисиса, и это требует только 1/8 томов реагентов для первоначальной обратной транскрипции и ПЦР усиления шагов. Во-вторых, можно производить в доме Tn5 transposase, который имеет такое же качество, как один в коммерчески доступных комплект23. Эти две модификации могут снизить стоимость подготовки библиотеки до $1/ячейки. В-третьих, используя индивидуальные индексы, тысячи ячеек могут быть объединены для секвенирования на системе без ущерба для последовательности глубины (1 миллион считывает /ячейка)17. Эти усовершенствования наряду с включением автоматизированных роботов обработки жидкостей, позволит высокой пропускной глубокий scRNA-seq микроглии изолированы практически из любых определенных регионов.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Мы благодарим Марико Л. Беннетт, Лиану Николь Бонанно и Спироса Дарманиса за помощь в разработке этого протокола. Мы также благодарим Стэнфордский общий фонд FACS, в частности Мередит Вегларц и Лиза Николс; Иен Тран, Майкл Экарт из Стэнфордского протеина и нуклеиновой кислоты фонда (PAN) за их большую поддержку для съемок. Эта работа финансируется Фондом JPB и Фондом Винсента Коутса.

Materials

Name Company Catalog Number Comments
5 M Betaine Sigma-Aldrich Cat# B0300-5VL
10 mM dNTP mix Thermo Fisher Scientific Cat# R0192
0.5 M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
10X Hanks’ Balanced Salt Solution Thermo Fisher Scientific Cat# 14185-052
1 M HEPES Thermo Fisher Scientific Cat# 15630080
1X KAPA HIFI Hotstart Master Mix Kapa Biosciences Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap Corning Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp) Advanced Analytical Cat# DNF-474-1000
Bovine Serum Albumin Sigma Aldrich Cat# A8806
DNase I Worthington Cat# LS002007 Working solution: 12500 units/ml
DTT, Molecular Grade Promega Cat# P1171
ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740
Fetal Bovine Serum Thermo Fisher Scientific Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes) Illumina Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes) Illumina Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes) Illumina Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes) Illumina Cat# FC-131-2004
Lambda Exonuclease (5 U/μl) New England BioLabs Cat# M0262S
Mouse Fc block BD Pharmingen Cat# 553142
Myelin removal beads Miltenyl Biotec Cat# 130-096-433
Nextera XT DNA Sample Prep Kit Illumina Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina Cat# 20024907
PBS (10X), pH 7.4 Thermo Fisher Scientific Cat# 70011044
PCRClean DX beads Aline Biosciences Cat# C-1003-50
Propidium Iodide Thermo Fisher Scientific Cat# P3566 Staining: 1:1000
Qubit dsDNA HS Assay Kit Thermal Fisher Scientific Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70) BioLegend Cat# 101236; RRID: AB_11203704 Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11) Thermo Fisher Scientific Cat# 25-0451-82; RRID: AB_469625 Staining: 1:300
Recombinant RNase Inhibitor Takara Bio Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl) Clontech Cat# 639538 Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS buffer Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific VWR 89005-556
Hard-shell 96-well PCR plates Bio-Rad HSP9631
Others
Dumont #55 forceps Fine Science Tools 11295-51
Dounce homogenizer, 2 ml Wheaton 357422
Large depletion column Miltenyi Biotec 130-042-901
Large selection column Miltenyi Biotec 130-042-401
MACS MultiStand Miltenyi Biotec 130-042-303
QuadroMACS Separator Miltenyi Biotec 130-090-976
RNAzap Thermo Fisher Scientific AM9780
Strainer (70 μm) Falcon 352350
Equipment
BD FACSAria II BD Biosciences http://www.bdbiosciences.com/
Bioanalyzer Agilent 2100
Fragment Analyzer Agilent 5300
Mosquito HTS nanoliter pipetting robot TTP Labtech https://www.ttplabtech.com/
Qubit 4 Fluorometer Thermo Fisher Scientific Q33226

DOWNLOAD MATERIALS LIST

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18, (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101, (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169, (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94, (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368, (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368, (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34, (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113, (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50, (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22, (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317 (2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14, (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9, (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65, (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562, (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125, (1), 70 (2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19, (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122 (2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147 (2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3, (13), 121109 (2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8, (1), Bethesda. 79-89 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics