בידוד של אזור-מיקרוגליה ספציפי מתוך חצי הכדור השני של המוח העכבר עבור רצפי RNA של תא יחיד בודד

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

אנו מספקים פרוטוקול עבור בידוד של מיקרוגלייה מאזורים בגזור שונים של המוח העכבר באמצע המחצית, ואחריו הכנה חצי אוטומטי הספריה לרצף העמוק של RNA תא בודד של טרנססקריפט באורך מלא. שיטה זו תסייע להבהיר טרוגניות תפקודית של מיקרוגלייה בריאות ומחלות.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhou, L., Li, Q. Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing. J. Vis. Exp. (154), e60347, doi:10.3791/60347 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

כמו מקרופאגים תושב במערכת העצבים המרכזית, מיקרוגלייה פעיל שליטה בפיתוח המוח הומאוסטזיס, ואת התפקוד שלהם יכול לנהוג במחלות אנושיות. מקדמות רבות נעשו כדי לחשוף את החתימות המולקולריות של מיקרוגלייה הומטיק, כמו גם שינויים של הביטוי הגנטי שלהם בתגובה לגירויים סביבתיים. עם הופעתו והתבגרות של תא בודד מתודולוגיות גנומית, הוא מוכר יותר ויותר כי מיקרוגלייה הטרוגניים עשוי להיות מתחת לתפקידים מגוונים הם משחקים בתנאים התפתחותיים ופתולוגיים שונים. ניתוח נוסף של טרוגניות כזה יכול להיות מושגת באמצעות בידוד יעיל של מיקרוגלייה מתוך אזור נתון של עניין, ואחריו פרופיל רגיש של תאים בודדים. כאן, אנו מספקים פרוטוקול מפורט לבידוד מהיר של מיקרוגלייה מאזורי מוח שונים בחצי הכדור המוח העכבר המבוגר. אנו גם להדגים כיצד להשתמש מיקרוגלייה אלה מיון עבור מבוסס צלחת תא יחיד ברצף RNA רצפי. אנו דנים על הסתגלות של שיטה זו לתרחישים אחרים ולספק הנחיות לשיפור המערכת כדי להתאים למחקרים בקנה מידה גדול.

Introduction

Microglia, המייצג 5% על 10% של כל התאים העצביים, הם מקרופאגים המתמחים מפוזרים ברחבי מערכת העצבים המרכזית (CN)1. מוגן מאחורי מחסום דם-מוח, מיקרוגלייה אופייני במוח מבוגר בריא להכיל תהליכים עדינים רבים במהירות להאריך ולסגת כדי אינטראקציה עם נוירונים ותאי גליה אחרים בתוך הכימומה. Microglia יכול גם לאמץ את מורפולוגיה אמבות הקשורים בפונקציה phagocytic מוגברת במהלך שלבים התפתחותיים ספציפיים או על האתגרים החיסונית פציעה ומחלה1,2,3,4. תגליות מרגש לאחרונה הפגינו בבירור כי מיקרוגלייה הם בשום מקרה פסיבי עוברי אורח פסיבית המוח או אותות פתולוגיים, אבל לשחק תפקידים מרכזי בשליטה המוח התפתחות הומאוסטזיס, למשל, על ידי תמיכה הישרדות עצבי, גיזום הסינפסות בלתי האוליגודנדרוציטים, קידום תאים השושלת היוחסין בידול, כמו גם אנגיוגנזה1. ככל פונקציות יותר של מיקרוגלייה מובהר, ההתרגשות היא נוספת מונעת על ידי מחקרים גנטיקה של האדם, אשר הראו כי הרבה מחלות נוירוניווניות הסיכון גנים, כגון TREM2, הם בעיקר או בלעדית מבוטא על ידי מיקרוגלייה5,6,7. בהתחשב במשמעות שלהם בפיתוח וסביר מחלות נהיגה תפקידים, מאמץ עצום לאחרונה הושם לקראת ההבנה שלנו של רגולציה גנטית microglial ותפקוד בתקווה למצוא מטרות טיפוליות חדשות עבור מחלות ניווניות1,8.

רצפי RNA (RNA-seq) מאפשר אפיון לא משוחד של הביטוי הגן הספציפי לסוג תא, אשר בתורו המדריכים מדענים לחקור פונקציות גן ברשתות הסלולר צפוף7. RNA-seq נעשה בעיקר על דגימות בצובר, המוביל לגילוי של חתימת גנים microglial הומאטית המבדיל אותם מתאים עצביים אחרים החיסונית9. עם זאת, גישה כזו יכולה להתעלם הבדלים מולקולריים ופונקציונליים בקרב microglia, במיוחד אלה הנוכחים בפיתוח, או הקשורים הזדקנות ומחלות. אכן, תא בודד RNA-seq (scRNA-seq) מציע את הרגישות ואת הרזולוציה כי יש מהפכה בשדה על ידי חשיפת בעבר העריכה הטרוגניות של מיקרוגלייה במגוון של ההקשרים2,3,10. בנוסף, בשל נוכחותם של תאים אחרים החיסונית דומים בממשק מחזור המערכת, scRNA-seq מספק מידע לסייע לעיצוב של כלים חדשים כדי להפריד ולנתח פונקציונלית אלה תאים הקשורים עם מעט לפני ידע2,11.

מערך מגוון של פלטפורמות scRNA-seq הומצאו, כל אחד מתאים יישומים מסוימים12. באופן כללי, שיטות המבוססות על droplet, כגון: x גנומיקה, גבוהות יותר בתפוקה עם (עשרות) אלפי תאים ברצף בכל הפעלה, והם פחות סלקטיבית עבור הקלט שעשוי להכיל אוכלוסיות תאים מעורבות הדורשות סיווג נרחב. שיטות מבוססות לוח לספק רגישות גבוהה יותר לקרוא עומק13,14, בדרך כלל מיקוד אוכלוסיות ספציפיות ממיון התא כדי לחשוף הבדלים עדינים או תעתיקים נדירים. בהינתן אחוז קטן של תאים microglial, במיוחד אלה התפתחות-או מחלות הקשורות אוכלוסיות, בין כל סוגי התאים של ה-cn, זה לעתים קרובות רצוי לבודד מיקרוגלייה מאזור מסוים של עניין ולקבל מידע עמוק ובאורך מלא ההמרה על מנת להבין את טרוגניות.

כאן, אנו מספקים פרטים על איך לבודד מיקרוגלייה מאזורים שונים במוח העכבר גזור מאונה אחת, אשר משמשים עבור תא בודד (או בצובר) RNA-seq בעקבות הליך הכנה חצי אוטומטי המבוסס על לוח הספריה. לאחר מכן ניתן להשתמש בחצי הכדור השני לאימות היסטולוגית. באופן יעיל משיטה שפורסמה בעבר9, פרוטוקול בידוד זה שואפת למקסם את התשואה מכמות קטנה של חומרי ההתחלה, ובינתיים לשמור על פרופילי מיקרוגליאל גנטי ביטויים. אנו משתמשים מיון תא מופעל-פלואורסצנטית (facs) כדי להעשיר מיקרוגלייה (או תאים אחרים הקשורים החיסונית של עניין) לתוך 96-ובכן צלחות ממזער את הכרכים של ריאגנטים להכנת הספריה כדי להגדיל את התפוקה. אנו מדגישים את פלטפורמת scRNA-seq הרגישה הזאת, למרות שניתן ליישם אסטרטגיות אחרות המבוססות על צלחת. שיטה זו יכולה להיות מותאמת בקלות לבידוד מיקרוגלייה מרקמות אחרות, כגון פציעה או מחלה, וגיל העכבר יכול להשתנות כמעט בכל שלבי הלידה. בידוד יעיל של מיקרוגלייה אזוריים למחקרים בעלי תא יחיד הטרנססקריפט יסייע להבנה טובה יותר של התפקודים שלהם בריאות ומחלות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל ההליכים מעורבים מכרסמים להתאים הנחיות אוניברסיטת סטנפורד, אשר עומדים בפני חוקי המדינה ומדיניות. כל ההליכים בעלי חיים אושרו על ידי פאנל מינהלי של אוניברסיטת סטנפורד על טיפול בעלי חיים מעבדה.

הערה: כל קומפוזיציות הפתרונות והמאגרים ניתנים ברשימת חומרים.

1. הכנה ביום הבידוד התאי

  1. להכין את הריאגנטים הבאים ולצנן אותם על הקרח: בינוני A (50 mL), תא מגנטי המופעל מיון (MCS) מאגר (30 mL), מאגר FACS (25 מ"ל), פוספט באגירה מלוחים (PBS; 30 mL), DNase (320 μL), ו-RNase מעכב (30
    הערה: אמצעי האחסון המסופקים כאן מספיקים כדי לבודד מיקרוגלייה מ 4 אזורי המוח (למשל, קליפת המוח הזעירה, ההיפוקמפוס והסטריאטום) של האונה האחת של המוח העכבר. הקנה מידה אם נעשה שימוש ברקמות נוספות.
  2. מקום ארבע נקי 2 מ"ל המגון הומוזים על הקרח ולהוסיף 2 מ ל של בינוני A עם 80 μL של DNase (12,500 יחידות/mL) ו-5 μL של מעכבי RNase לתוך כל הומוגניד1. לצנן את הפיסטונס ב 15 מ ל צינורות.
  3. תווית 4 6 ס מ מנות פטרי עם מחוזות המוח לאוסף רקמות ולהוסיף 200 μL של בינוני קר A לתוך כל מנה על הקרח. הוסיפו כ-5 מ ל בינוני בצלחת פטרי בגודל 6 ס מ לניתוח.
    הערה: לפני השימוש, לוודא שכל הריאגנטים הם סטרילי מתאים ליישומים RNA. כלי הספסל והחיתוך צריך להיות נקי ומרוסס עם פתרון טיהור RNase (טבלת חומרים).

2. מחוז המוח חיתוך

הערה: שלב זה אמור להימשך ~ 30 דקות.

  1. הכנס 400-כ 500 μL של קטמין/xylazine (24 מ"ג/מ"ל קטמין ו 2.4 mg/mL xylazine) לתוך צפק של קטין לעכבר בשלב מבוגר (> 1 חודש).
    הערה: עכבר גברי משמש כאן להמחשה, אבל או מגדר מתאים.
  2. לחכות 5 דקות וקמצוץ רגל האחוריות כדי להבטיח חוסר הנסיגה.
  3. באופן מיידי להשתמש 26 G x 3/8 מחט לבצע מיזוג באמצעות 20 ל 30 מ ל של הקרח קר PBS עד מאגר אוזל ללא דם גלוי.
  4. הוא ערוף את ראשו של העכבר. עם זוג מספריים כירורגיים להשתמש במספריים קטנים כדי לחתוך את העור כדי לחשוף את הגולגולת מתחת, ולאחר מכן לחתוך את התפר המשונן, תפר מ, ותפירה מקורלית. מלקחיים להשתמש כדי למשוך את שני הצדדים של עצם הקודקוד ועצם הקודקוד מבלי לפגוע ברקמה, ובזהירות להעביר את המוח לתוך צלחת פטרי בינונית.
  5. השתמש להב מראש מקורר לחתוך את המוח דרך קו האמצע לשתי אונות.
    הערה: ארבעת האזורים המוח שתוארו כאן מתוך האונה אחד התשואה מספר מספיק של מיקרוגלייה עבור תא יחיד או בתפזורת RNA-seq יישומים. בחצי הכדור השני ניתן להשתמש עבור אימונוהיסטוכימיה או RNA באימות באתרו.
  6. הפרד את המוח החצי מהאונה הקורטיקלית ואת גזע המוח עם מלקחיים #55 ולהעביר את הרקמה לתוך אוסף צלחת פטרי.
  7. השתמש #55 מלקחיים כדי לנתח בזהירות את ההיפוקמפוס ואת הסטריאטום מקליפת המוח ולהעביר כל רקמה לתוך אוסף צלחת פטרי.

3. רקמת דיסוציאציה מכנית

הערה: לשמור על תאים וריאגנטים מגניב כל הזמן, למעט במהלך מכתים שלבים. שלב זה אמור להימשך ~ 30 דקות.

  1. קוצצים כל רקמת מוח עם להב תער לתוך < 1 מ"מ3 חתיכות קנס.
  2. השתמש בפיפטה 1 מ ל (עם טיפים לחתוך) כדי להעביר את חתיכות הרקמה לתוך מקורר לפני העור Dounce הומוזים, כל אחד המכיל 2 מ ל של בינונית A עם DNase ו-RNase מעכב.
  3. המגון לסדר את הרקמה על ידי הטיית באיטיות את הבוכנה פנימה והחוצה של מכשיר ההומוגניזה של הדיאונקיה עבור 6-10 משיכות מלאות, עד שלא קיימים גושים גלויים.
    הערה: Douncing הורג נוירונים ותאים גליה ביותר אחרים אבל לעזוב את התאים microglial ולא שלמים. שניהם לא מספיקים ו-over-douncing יכול לגרום לתשואה נמוכה של תאים.
  4. העברת רקמות שאינן מקבילות לתוך צינורות 50 mL דרך 70 יקרומטר בכיינים.
  5. לשטוף כל הומוגנידצר בוכנה עם סכום כולל של 6 מ ל של בינוני קר A ולסנן את פתרון השטיפה דרך מסננת אותו לתוך הצינור המקביל.
  6. להעביר את השעיות התא בודד (כ 8 mL כל) לתוך 15 מ"ל שפופרות חרוט ו צנטריפוגה ב 400 x g עבור 5 דקות ב 4 ° צ' עם בלם = 5.

4. הסרת מיאלין

הערה: שלב זה צריך לקחת ~ 60 דקות.

  1. הכן 1 עמודת דלדול (LD) גדולה (לקליפת קליפה) ו-3 עמודות מבחר גדולות (LS) (עבור 3 האזורים האחרים) במפריד מגנטי (טבלת חומרים). שטפו כל עמודה עם 3 מ ל של מאגר MCS.
  2. ברגע שצנטריפוגה מסתיים, הצינורות החוצה וזורקים את הסופרנטאנט בלי להפריע לגלולה. לגבי קליפת המוח ורקמות המוח, השהה מחדש תאים ב-850 μL של מאגר MCS עם 1.8 μL של מעכב RNase. עבור רקמות ההיפוקמפוס ו סטריאטום, השעיית התאים מחדש ב-400 μL של מאגר MCS עם 0.9 μL של מעכב RNase.
    הערה: העמודים (LD לעומת LS) ואמצעי האחסון המשמשים לההשעיה ממוטבים על בסיס כמות המיאלין הקיימת ברקמה. אם אזורים אחרים במוח מאחרים, ייתכן שיהיה צורך לכוונן תנאים אלה בהתאם לגודל הרקמה ולכמות המיאלין העשויה להתקיים. האפקטיביות של הסרת המיאלין יכול להיות מוערך בשלב 4.9.
  3. הוסף 100 μL של חרוזים הסרת המיאלין כל אחד לתוך תאים מקליפת המוח ולהוסיף 50 μL של חרוזים הסרת המיאלין כל אחד לתוך תאים מהיפוקמפוס וסטריאטום.
  4. בעדינות לערבב את התאים עם חרוזים ו-מודטה את הצינורות על הקרח 10 דקות.
  5. הביאו את עוצמת השפופרת עם תאים קורטיקליים ל -2 מ ל עם מאגר MCS, וכל האחרים ל-1 מ ל (כלומר, מוסיפים 1 מ ל לתאי קליפת המוח; 500 μL עבור תאים היפוקמאל וסטרילאטאל; אין צורך להוסיף מאגר לתאים מקרבלאר).
  6. לאחר שהעמודות ריקות ממאגר השטיפה, הניחו שפופרת של 15 מ ל מתחת לכל עמודה. טען תאים קורטיקלית (2 מ ל) לעמודת ה-LD, וכל האחרים (1 mL כל אחד) על העמודות LS. מיד להשתמש 1 mL של מאגר MCS כל אחד כדי לשטוף את הצינורות המקוריים ולטעון את הפתרון על העמודות המתאימות.
  7. שטוף את עמודת ה-LD פעם אחת עם 1 מ ל של מאגר MCS ושטוף כל עמודה LS פעמיים עם 1 מ ל של מאגר MCS כביסה. המשך לאסוף את פתרון הזרימה במהלך הכביסה.
  8. לסנן את התאים לתוך צינורות facs לתחתית עגול באמצעות כמוסות מסננת 35 יקרומטר.
    הערה: כל צינור צריך לאסוף כ 4 מ ל של השעיית תא יחיד מרוקן של מיאלין.
  9. באופן אופציונלי, לקחת 10 μL של ההשעיה התא ולערבב אותו עם 10 μL של 0.4% הפתרון הכחול. בדוק את התאים תחת מיקרוסקופ שדה בהיר 10x כדי להעריך את התשואה, שיעור ההישרדות ואת רמת המיאלין שיורית.
    הערה: הכנה מוצלחת צריך ליצור מעל 90% תאים חיים (עגול בצורה ולא להוציא את הצבע הכחול) עם מעט ללא פסולת מיאלין.
  10. גלולה תאים בצינורות FACS ב 400 x g עבור 5 דקות ב 4 ° c, עם בלם = 5. שופכים לאט החוצה את הסופר ומזגו את קצה הצינור על נייר טישו. השהה תאים מחדש בכל צינור עם 300 μL של מאגר FACS.
    הערה: אם מיון mcs הוא המועדף, CD11b חרוזים ניתן להשתמש כדי לבחור מיקרוגלייה ותאים אחרים מיאלואידים בעקבות הסרת מיאלין. תאים אלה יכולים לשמש לאחר מכן עבור שאינם מבוססי לוח scRNA-seq כמו גם בצובר RNA-seq. האזהרה של גישה חלופית זו היא כי חרוזים CD11b לא להפריד מיקרוגלייה מתאים אחרים החיסונית הקשורים אשר גם חיובית עבור אנטיגן זה.

5. צביעת עבור מיון התא המופעל על ידי קרינה פלואורסצנטית

הערה: שלב זה צריך לקחת ~ 40 דקות.

  1. הוסף 5 μL של העכבר קולטנים לחסום מגיב (לוח חומרים) לתוך כל צינורית. מודקון למשך 5 דקות על הקרח.
  2. הוסף 1 μL של CD45-PE-Cy7 ו-1 μL של CD11b-BV421 לתוך כל צינורית.
    הערה: נוגדנים עם fluorophores אחרים עשוי לשמש. נוגדנים נגד TMEM119, סמן ספציפי עבור הומאוטיות מיקרוגלייה9, ניתן גם לכלול, אבל זה מומלץ לשמש יחד עם CD45 ו CD11b, כי מספר אוכלוסיות מיקרוגלייה מסוימות עלול לאבד TMEM119 הביטוי פני השטח.
  3. מודטה את הצינורות על שייקר במשך 10 דקות בטמפרטורת החדר (RT).
  4. הוסף 2 מ ל של מאגר FACS כדי לשטוף.
  5. כדוריות התאים ב 4 ° צ', 400 x g עבור 5 דקות לאט לשפוך supernatant ולטפוח על הקצה של הצינור על נייר טישו. השעיה מחדש של תאים בכל צינור באמצעות 400 μL של מאגר FACS עם 1 μL של מעכב RNase ו 0.5 μL של propidium יודיד (PI, 1:1000 דילול).

6. מיון FACS באינדקס

הערה: . השלב הזה אמור לקחת ~ 1 h

  1. בעקבות נוהל FACS סטנדרטי, לצייר שערים המבוססות על פיזור (לא כולל פסולת), תאים בודדים, תאים חיים (PI שלילי), מיקרוגליה תאים מיאלואידים (CD45+, CD11b+).
    הערה: תאים microglial אופייני express CD45 ברמות נמוכות יותר לעומת מקרופאגים אחרים הקשורים בגבול, כגון perivascular ו-מקרופאגים של מנצ, ולכן על CD45 low CD11b+ צריך להיות מספיק אם המוקד של המחקר הוא ביטוי גנים פרופילים אלה מיקרוגלייה קלאסי1,2. עם זאת, מערכות משנה מסוימות של מיקרוגלייה יכול להיות גבוה יותר ביטוי CD45 וזה נכון במיוחד במהלך הפיתוח או בתנאי מחלה. כדי להבטיח ניתוח לא משוחדת של ביטוי הגנים microglial, CD45 גבוהה CD45 החיסונית נמוכה ניתן להקליט באמצעות הגדרת מיון המדד ושתי האוכלוסיות שנאספו לניתוח רצף במורד הזרם. בנוסף, TMEM119 ביטוי פני השטח עשוי לשמש כדי למקד את אוכלוסיית microglial הומאטית (ראה שלב 5.2) ונותחו יחד עם רמות CD45 ואת התוצאות הרצף.
  2. מיון מיקרוגלייה יחיד (עם זרבובית 100 יקרומטר) לתוך 96-ובכן פולימראז תגובת שרשרת (PCR) צלחות, המכיל 4 μl של מאגר הליזה כל טוב (עיין בפרוטוקול שפורסם14 לפרטים).
    הערה: הקונסורציום החיצוני בקרת RNA (ERCC) RNA ספייק-in mix (טבלה של חומרים) ניתן להוסיף ב 1:2.4 x 107 במאגר הליזה למטרות בקרת איכות ונורמליזציה2.
  3. מערבולת בקצרה את הצלחות. ומסתובבת באמצעות צנטריפוגה מלמעלה
  4. הקפא מיד את הדגימות על הקרח היבש. אחסן את הצלחות ב-80 ° צ' עד להכנה לספרייה.
    הערה: לחילופין, תאים נוספים ניתן לאסוף לתוך 1.5 mL צינורות עם מאגר החילוץ RNA עבור רנ א-seq בצובר. על פי הניסיון של המחברים, 3,000 תאים מספיקים כדי ליצור ספריות באיכות טובה לאחר הפרוטוקול שפורסם2,14.

7. הכנה לספריית RNA ברצף של תא יחיד

הערה: כאן, הפרוטוקול שפורסם14 מלווה בהפקת ספריות scRNA-seq בעזרת רובוטיקה לטיפול נוזלי וכמה שינויים. במאמר זה, ההליך מתואר רק בקצרה, וההבדלים מודגשים. עיבוד 4 צלחות בו לוקח בערך 2.5 ימים.

  1. הפשרת צלחות על קרח ולבצע תמלול הפוכה עם Oligo-dT30VN פריימר (במאגר הליזה) כדי ליצור cDNA עם ציקלנים תרמית (שולחן 1): 42 ° c 90 דקות; 70 ° c, 5 דקות; 4 ° c להחזיק. לאחר מכן להגביר את cDNA עם העיכול תוספת בדקה בתחילת (שולחן 2) באמצעות התמהיל הראשי pcr ו-pcr באתרו (ispcr) התחל (טבלת חומרים) ואת המצב הבאים Pcr: 37 ° צ' 30 דקות; 95 ° c 3 דקות; 23 מחזורים של 98 ° c, 67 ° c, 72 ° צ' 4 דקות; 72 ° c, 5 דקות
  2. טיהור cDNA באמצעות 18 μL של חרוזים מגנטיים לכל טוב (0.7:1 יחס). מודקת את הצלחת על דוכן מגנטי עבור 5 דקות ולשטוף דגימות פעמיים עם טרי שנעשו 80% אתנול, 80 μL לכל טוב בכל פעם. לאחר ייבוש את הצלחת עבור 15-20 דקות, elute cDNA לאחר מכן עם 20 μL של מאגר הימנעות לכל טוב.
    הערה: עבור בקרת איכות, השתמש מנתח קטע (רגישות גבוהה ברצף הדור הבא [NGS] ניתוח קטע, 1-6000 bp) כדי לבדוק גודל הפצות וריכוזים של cDNA, רק עוד דגימות התהליך עם הכתם בין 500-5000 bp, ויותר מ 0.05 ng/μL.
  3. כדי ליצור ספריות, לערבב 0.4 μL של כל דגם cDNA עם 1.2 μL של Tn5 tagmentation מערכת הכנת הספרייה (טבלת חומרים) בצלחת 384-באר עם הסיוע של מכונת ההכנה של nanoliter, ב 55 ° c 10 דקות.
    הערה: כאן, 1/12.5 של נפח התגובה המוצע (5 μL לדוגמה ו-15 μL של החומרים האחרים) מתווסף כדי להפחית את העלות ובינתיים להגדיל את התפוקה. מכונת פיאוליטר ליטוף (טבלת חומרים) משמשת להעברת ריאגנטים (זה והצעדים הבאים) מ ועד 384-צלחות.
  4. הוסף 0.4 μL של נטרול מאגר כדי להפסיק את תגובת הטמנטציה ב-RT עבור 5 דקות.
  5. הוסף 384 אינדקסים (טבלת חומרים, 0.4 μl קדימה ו 0.4 μl הפוך), 1.2 μl של שילוב PCR לדגימות (2 μl כל אחד), ולהגביר את הספריות באמצעות התנאי הבא: 72 ° צ' 3 דקות; 95 ° c; 10 מחזורים של 95 ° c, 55 ° צלזיוס 30, 72 ° צ' 1 דקות; 72 ° c, 5 דקות
  6. בריכת כל הספריות הבודדות (לקחת 1 μL כל אחד) מאותה צלחת 384-ובכן יחד, ולהשתמש חרוזים מגנטיים (טבלת חומרים, 0.7:1 יחס) כדי לטהר את הספריות האחרונות במאגר.
  7. השתמש בפלואורומטר (טבלת חומרים) כדי למדוד את הריכוזים ואת bioanalyzer (טבלת חומרים) כדי לבחון את הפצות הגודל של ספריות במאגר לפני הרצף. מקד את עומק רצף ב 1,000,000 raw קריאות לכל תא.
  8. בצע את ההליכים הביומטיים הסטנדרטיים כדי לסנן ולקצץ ברצף קריאות ולבצע יישור2. השתמש בטבלת הספירה ובמטא-נתונים כקלט לביצוע ניתוח באשכולות עם חבילת Seurat15.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

פרוטוקול זה מתאר שיטה לבידוד ומיון מיקרוגלייה מאזורי מוח שונים בחצי הכדור המוח האדם המבוגר, ואחריו scRNA-seq. אנו משתמשים douncing כדי ליצור תא השעיה בודד גם כצעד הראשון להעשיר microglia. לא מספיק או over-douncing מפחית את התשואה. בנוסף, מוחות עכבר למבוגרים מכילים רמות גבוהות של מיאלין, אשר יכול גם להפחית את יעילות מיון ותשואה אם לא הוסרו כראוי. לכן, אנו בודקים את ההשעיה התא תחת מיקרוסקופ באמצעות טריקון כחול ו היציטוטומטר כדי להעריך את התשואה, הכדאיות התא יעילות של הסרת המיאלין (שלב 4.9) לפני ביצוע כתמים נוגדן (איור 1). סה כ ספירות התא בנקודה זו אמורות להיות מעל 30,000 עבור קליפת המוח, ומעל 5,000 עבור רקמות אחרות. מעל 90% של תאים צריך להיות בר קיימא עם פסולת מיאלין קטנה.

אנו משתמשים מכונת facs כדי למיין מיקרוגלייה (או תאים מיאלואיד), אשר בדרך כלל CD45 נמוך ו CD11b חיובי. לפחות עבור רקמת קליפת העור, בידוד מוצלח צריך ליצור מעל 80% מיקרוגלייה מתוך כל התאים החיים בודד (איור 2). האוכלוסייה הגוססת/מתה מייצגת רק חלק קטן מההכנה (כ-10%).

ברגע מיקרוגלייה בודדים נלכדים לתוך מאגר לפירוק, RNA הוא שוחרר ולאחר מכן שופצה לאחור ל-cdna, אשר מוגבר אז עבור 23 מחזורים. חשוב לבדוק את האיכות של דגימות cDNA אלה-לפחות חלק מהם-לפני ביצוע ספריות. כמו פלטפורמת אלקטרופורזה נימי, מנתח הרסיס וערכות מקטע NGS בעלי רגישות גבוהה (1-6000 bp) לספק מידע מהיר ומדויק על הפצת גודל, כמו גם כמות של מולקולות cDNA להציג בכל טוב של צלחת 96-באר (איור 3a). דגימות המציגות הכתם (500-5000 bp) ומעל סף ריכוז מסוים (לדוגמה, 0.05 ng/μL) ניתן להשתמש כדי ליצור ספריות. באופן דומה, יש לבדוק את הספריות הנמצאות במאגר לפני הרצף (איור 3ב).

אנו לסדר את הדגימות לעומק של מעל 1,000,000 קריאות raw לכל תא, המקתים את כוח הזיהוי של מתודולוגיית scRNA-seq זו16. עם כ 60% שיעור מיפוי, מעל 2,000 גנים לכל תא microglial ניתן להבחין. אנו השיגו נתונים שפורסמו שנוצרו באמצעות שיטה זו בידוד17, ולהדגים את הצורך המופדה שלה מפני ניסויים עצמאיים ורגישות לזיהוי גנים ספציפיים microglia על פני האוכלוסייה הרצף (איור 4).

Figure 1
איור 1: הערכה של תשואה מיקרוגלייה בידוד, הכדאיות התא יעילות של הסרת המיאלין. הפאנל השמאלי הראה את תמונת שדה בהיר (4x ההגדלה) של טריפי כחול מוכתם תאים (מקליפת) לאחר עובר באמצעות עמודות להסרת מיאלין. תוצאות עבור אזורים אחרים ייראו דומים אך עם פחות תאים. הרוב המכריע (אם לא כולם) של תאים הופיע בהיר (לא מוכתם) ועגול עקב אובדן של תהליכים. התמונה הנכונה היה זום ב (20x) של האזור הקופסה ושברי המיאלין הקטנה היה נוכח. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: שערים המשמשות למיון microglia. הנתונים הראו את אסטרטגיית העליה של מיון מיקרוגלייה מקליפת המוח, ואת אותה אסטרטגיה שימש עבור אזורים אחרים. שאריות תאים לא נכללו לראשונה מתוך העלילה פיזור, ותאים בודדים היו מגודרת על ידי קדימה פיזור אזור (FSC-A)/קדימה רוחב פיזור (FSC-W). תאים חיים היו מגודרת על ידי כתמים שליליים PI, אשר היו מ 90% של כל התאים היחידים. Microglia, המייצג בערך 80% של תאים חיים, היו ממוינים מן CD45 נמוך CD11b + שער. סך של ~ 30,000 מיקרוגלייה יכול להיות מבודד וממוין מרקמת קליפת המוח (מאונה אחת של עכבר בן 3 חודשים). מיון אינדקס בוצע במכונת FACS. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3

Figure 3
איור 3: תוצאות בקרת האיכות הייצוגית עבור cDNA מוגבר מתוך תא microglial יחיד וספרייה ממאגר בסופו של דבר. (א) באמצעות מנתח חלקים, כל הקטעים מותווים עם גודלם על ציר ה-X, ועוצמת הקרינה היחסית בציר Y, המסמלת שפע של cdna בגודל נתון. LM (סמן תחתון, 1 bp) ו-UM (הסמן העליון, 6,000 bp) הם טעינת סמנים עם ריכוזים ידועים המשמשים למדידת כמות cDNA. מוגבר בהצלחה cDNA מתוך טופס מיקרוגליאל הנציג צורות עקומה (קו מנוקד ירוק) על גרף התפלגות גודל או הכתם (התווית סוגר) על הגרף ג'ל בין 500 bp ו 5,000 bp. פסגות מסומנות אחרות הוגברה מ-ERCC ספייק מולקולות או רנ א ריבוזומלית. הריכוז של cDNA בין 500 bp ו 5,000 bp יכול להיות כמותית, ואלה דגימות עם ריכוזים גבוהים יותר 0.05 ng/μL ומראה עקומות טיפוסיות כגון נשמרים לקראת הכנת הספרייה. . RFU, יחידה פלואורסצנטית יחסית (ב) בקרת איכות של הנציג מציג את התפלגות הגודל של ספריית המאגר הסופית (עם כ-380 תאים). בדרך כלל, הוא נע בין 200 bp ל 2,000 bp עם גודל ממוצע של 400-600 bp. שתי הפסגות החדות מעמיסים סמנים. . פו, יחידה פלואורסצנטית אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: scRNA-seq ניתוח של מיקרוגלייה מבודדים מ 4 מחוזות המוח של שני עכברים גברים. (א) tsne העלילה המציגה דפוס התערבבו של מיקרוגלייה אזוריים (רק תאים מעכבר #1 היו מודגשים). הם אינם יוצרים אשכולות שונים בהתאם למקורות האזור מעבר למעבר עדין לאזורים מרוכזים במגרש tSNE (אולי עקב אפקטי אצווה). התבוננות זו מתאימה לטרוגניות אזורית מוגבלת של מיקרוגלייה בהתבסס על ביטוי גנטי גלובלי בעכברים למבוגרים (ראה פרסום אחרון2 לדיון נוסף בנושא זה). (ב) tsne העלילה מציג דפוס חופפים של מיקרוגלייה משני עכברים בודדים שעובדו באופן עצמאי. למרות שאפקטי אצווה קטנים עשויים להתקיים (תאים המתתרכזים באזורים מסוימים של העלילה), תאים אלה אינם יוצרים אשכולות שונים בהתאם למקורות בעלי החיים. תוצאה זו מרמזת על השגות הפרוטוקול להשוואת הנתונים בין ניסויים. (ג) ביטוי של גנים חתימה מיקרוגלייה זוהה על ידי scRNA-seq מציג מעל 95% שיעור זיהוי עבור סמנים ספציפיים, כגון Tmem119 ו P2ry12, ולמעלה מ 80% שיעור הזיהוי של שעתוק מוכרים גורמים כגון Sall1 ו -Pu .1. הנתונים נותחו מחדש מהספרות המפורסמת17. (ד) הרוב המכריע של חוסר ביטוי מבודד מיקרוגלייה של גנים ספציפיים סוגי תאים אחרים, כגון Tubb3 (נוירונים), Aldh1l1 (astrocytes), Gjb1 (oligodendrocytes הפוך), ו Tie1 (התאים האנדותל). (ה) ביטוי של גנים הקשורים הפעלה microglial או לחץ. סמנים קלאסיים, Tnf, Il1b, Nos2, ו Nfkb2, אשר הביעו ביטוי נמוך, מוצגים בחלק העליון. הגנים תגובה מוקדמת, Egr1 ו Fos, מוצגים בחלק התחתון (ראה דיון). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

ריאגנט אמצעי אחסון (μL)
פירוק תאים 4
רוורס טרנסקריפטאז (100 U/μL) 0.95
מעכבי rnase 0.25
מאגר הסטרנד הראשון 5x 2
(DTT; 100 ממ) 0.5
בטאצין (5 מ') 2
מתחת לגיל2 (1 מ') 0.06
בורר תבנית אוליגו (טסו; 100 μM) 0.1
H2O 0.14
כולל 10

שולחן 1: שעתוק הפוך במצב. מסופקים כרכים עבור תגובת שעתוק אחת הפוכה.

ריאגנט אמצעי אחסון (μL)
תעתיק הפוך מוצר 10
שילוב בסיס של PCR 2 x 12.5
ISPCR (10 μM) 0.25
למדא אקסונוכר 0.1125
H2O 2.1375
כולל 25

שולחן 2: מצב הגברה של ה-PCR. כמויות מגיב להגברה אחת של ה-PCR של cDNA מתא בודד מסופקות.

מבוסס לוח (פרוטוקול זה) מבוסס Droplet (מגנומיקה של 10 x)
רגישות עוד גנים זוהו זוהו פחות גנים
אורך מלא כן לא (5 ' או 3 ' סוף)
גמישות עבור מספרי תאים/אוכלוסיות מתאים לאפיון של אוכלוסיות משנה קטנות או נדירות מתאים לסיווג רחב של אוכלוסיות תאים גדולות
תפוקה עד כמה אלפי תאים מאות לעשרות אלפי תאים
מזהה מולקולרי ייחודי לא כן
עלות לכל תא $1 $5 פחות מ-$1
קושי ניסיוני שלבים נוספים ובדרך כלל דורשים רובוטיקה לטיפול נוזלי פשוט לביצוע עם מכונות ממוסחר
אוכלוסיות תאים ממוקד על-ידי מיון FACS שוחדת

טבלה 3: השוואה בין שיטות scRNA-seq מבוססות-לוח ומבוססות-droplet. במאמר זה, הליך scRNA-seq באורך מלא המבוסס על לוח מסופק, הכולל את היתרונות של רגישות גבוהה יותר, רצף באורך מלא וגמישות עבור מספר קטן של תאים כקלט. שיטות מבוססות Droplet מציעות את היתרונות של תפוקה גבוהה יותר, עלות נמוכה יותר, קלה לביצוע ונתונים במזהים מולקולריים ייחודיים. הם משלימים בהתאם למטרת הניסויים.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Microglia אינטראקציה פעילה עם סוגי תאים אחרים ב-CN, והם רגישים מאוד גירויים סביבתיים. על מנת למזער תגובות דלקתיות שינויים ביטוי הגנים שלהם במהלך תהליך הבידוד, פרוטוקול זה היה יעיל מתוך שיטה שפורסמה בעבר9, והוא מתאים כעת לבודד מיקרוגלייה מאזורים מרובים של המוח בודד בצורת העכבר במקביל. הרקמות והריאגנטים נשמרים בטמפרטורה קר וניסויים מבוצעים בזמן (כ 3.5 h מניתוח למיון) עם פחות שוטף ומלא ריאגנטים פחות מבוסס על גדלים רקמות מוגבלות. אנחנו בוחרים douncing על שיטות אחרות הומוקות, כגון העיכול אנזימטי, כי דיסוציאציה מכנית יכול להרוג ובכך להסיר נוירונים ותאים אחרים גליה תוך גרימת נזק קטן או הפעלה מיקרוגלייה9,18. Over-douncing, עם זאת, עשוי להפחית את התשואה של מיקרוגלייה ויש להימנע. זה כבר הוכח כי דיסוציאציה מכנית הסרת חרוזים מבוססי המיאלין ואחריו מיון FACS להציג פחות הפעלה microglia, מבוסס על ביטוי מינימלי של גנים דלקתיים הקלאסי, למשל, Tnf, Il1b, Nos2, ו Nfkb29 (איור 4e). עם זאת, מיקרוגלייה יכול עדיין להגיב לתנאים vivo ex במהלך הדיסוציאציה ומיון על ידי upregulating גנים תגובה מוקדמת כגון Fos ו Egr1 (איור 4E), אשר בדרך כלל לא מבוטא על ידי מיקרוגלייה ב vivo2,19, ושינויים כאלה מחקרים הטרנססקריפט צריך תמיד להיות מאומת על סעיפים היסטולוגיה.

כאן אנו מספקים הליכים לבידוד מיקרוגלייה מקליפת המוח, המוח השני, ההיפוקמפוס והסטריאטום של האונה הבוגרת מוחית העכבר, ואת הפרוטוקול הזה ניתן להתאים בקלות לאזורים אחרים או שלבים. זה שימושי עבור מצבים, למשל, כאשר מיקרוגלייה מושפע מחלות מוגבלים לאזורים מסוימים של המוח אשר ניתן לגזור, או בלימודי הזדקנות, שם האגירת דגימות אינו מתאים בשל וריאציות בודדות משמעותיות. עם הזמינות של נוגדנים נגד microglial (או במחבת מולדים החיסון) אפיסקופים, פרוטוקול זה יכול להיות גם מותאם עבור בידוד מיקרוגלייה ב חולדה או רקמות אדם9. בשעת הסתגלות לרקמות גדולות או ישנות יותר, חשוב לשקול ולבדוק את נפח החרוזים של המיאלין וסוג העמודות המשמשות. גישה חלופית עבור הסרת המיאלין היא על ידי צפיפות מעבר הצבע צנטריפוגה מסחרי בצמיגות נמוכה מדיה20. בסך הכל שתי שיטות אלה הן דומות ביעילות שלהם, למרות צפיפות מעבר הצבע צנטריפוגה שיטה עשויה לספק תשואה גבוהה מעט, ומאידך, השיטה חרוזים מגנטיים פחות סביר להציג אנדוטוקסינים, אשר עשוי להפעיל מיקרוגלייה21,22.

בשל האחוז הקטן של מיקרוגלייה בין תאי המוח הכולל, זה לעתים קרובות חיוני להעשיר או לטהר מיקרוגלייה לפני ביצוע לימודי הטרנססקריפט בודד. אנו משתמשים ב-facs כגישה רגישה ללכידת סוגי תאים מיוצגים הצנוע, ולבחור מיקרוגלייה מבוסס על CD11b ו CD45 הביטוי המשטח. מחצי הכדור הראשון, אנו להשיג באופן שגרתי ~ 30,000 מיקרוגלייה לקליפת המוח, ו ~ 5,000 מיקרוגלייה עבור המוח השני, היפוקמפוס או סטריאטום. תשואות אלה מספיקות רוב היישומים תא יחיד, כמו גם בתפזורת RNA-seq (3,000 או יותר תאים ניתן להשתמש). כדאי להזכיר כי מיקרוגלייה עשוי upregulate CD45 immunoreactivity במהלך פיתוח או מחלה2, שבו במקרה תאים עם רמות נמוכות וגבוהות של CD45 צריך להיות מוקלט ואינדקס מיון לניתוח. אפשרות נוספת עבור מיקרוגלייה מעשירה היא להשתמש CD11b חרוזים-תיווך מגנטי המופעל מיון התא בעקבות הסרת המיאלין, אבל זה היה להגביל scRNA-seq כדי שיטות droplet.

כדי ללמוד ביטוי גנטי microglial ברזולוציה תא בודד, אנחנו בדרך כלל למיין תאים לפחות 2-3 96-היטב צלחות לכל מדגם ולבצע הכנה לספרייה עם מכונות טיפול נוזלי. זה הוכח כי זה מבוסס צלחת באורך מלא הכנה הספריה היא אחת השיטות הרגישות ביותר scRNA-seq במגבלת זיהוי, המאפשר קוונפיקציה מדויקת של תעתיקים נדירים, כגון גורמים שעתוק13,14,16. בגלל רצף באורך מלא, גישה זו אינה כפופה להטיה של 5 או 3, וניתן להשתמש בה כדי לנתח משתני שחבור (שולחן 3). בנוסף, בניגוד לשיטות המבוססות על droplet, הדורשות בדרך כלל מאות או אלפי תאים בתגובה, פרוטוקול זה מבוסס על הצלחת מקבל את הגמישות לכלול מספר קטן של תאים בכל ניסוי, ובהדרגה להרחיב את גודל האוכלוסייה על ידי הוספת לוחות נוספים לתוך העיצוב בהמשך. זה יתרון כאשר לימוד תת קבוצות קטנות של מיקרוגלייה בתנאים מסוימים כגון התפתחות עובריים.

בעוד הפרוטוקול הזה מייצר באצילות באיכות גבוהה scRNA-seq ספריות עבור microglia האזורית המוח, זה לעתים קרובות מתאים רק למחקרים קטנים בקנה מידה בעלות גבוהה יחסית (על $5/תא עבור הכנת הספריה, עדיין זול יותר $23/תא אם באמצעות החוצה את ערכת v4 של המדף SmartSeq). מספר אסטרטגיות יכולות לסייע בהפחתת העלות ובהגדלת התפוקה. ראשון, תאים ניתן למיין לתוך 384-היטב צלחות עם מעט כמו 0.5 μL של מאגר הליזה, וזה רק דורש 1/8 כרכים של ריאגנטים עבור תמלול הפוכה ראשונית שלבי הגברה. שנית, ניתן לייצר in-house Tn5 טרנספסדאז בעל איכות דומה כמו האחד בערכה מסחרית זמין23. שני שינויים אלה עלולים להפחית את עלות ההכנה של הספריה למטה ל-$1/תא. שלישית, באמצעות אינדקסים מותאמים אישית, ניתן לחבר אלפי תאים ביחד לרצף במערכת מבלי להקריב את עומק הרצף (> 1 מיליון קריאות/תא)17. שיפורים אלה יחד עם השילוב של רובוטים אוטומטי טיפול באמצעות, יאפשר תפוקה גבוהה scRNA-seq עמוק של מיקרוגלייה מבודדים כמעט כל האזורים המוגדרים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

אנו מודים למריקו ל. בנט, ליאנה ניקול בונאנו, ו Spyros דארמני על עזרתם במהלך פיתוח פרוטוקול זה. אנו מודים גם למתקן ה-FACS המשותף של סטנפורד, במיוחד מרדית ווגלז וליסה ניקולס; ין טראן, מייקל Eckart מאוניברסיטת סטנפורד וחומצות גרעין מתקן (פאן) על התמיכה הגדולה שלהם לצילום. עבודה זו ממומנת על ידי קרן JPB ו וינסנט ג'יי קוטס.

Materials

Name Company Catalog Number Comments
5 M Betaine Sigma-Aldrich Cat# B0300-5VL
10 mM dNTP mix Thermo Fisher Scientific Cat# R0192
0.5 M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
10X Hanks’ Balanced Salt Solution Thermo Fisher Scientific Cat# 14185-052
1 M HEPES Thermo Fisher Scientific Cat# 15630080
1X KAPA HIFI Hotstart Master Mix Kapa Biosciences Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap Corning Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp) Advanced Analytical Cat# DNF-474-1000
Bovine Serum Albumin Sigma Aldrich Cat# A8806
DNase I Worthington Cat# LS002007 Working solution: 12500 units/ml
DTT, Molecular Grade Promega Cat# P1171
ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740
Fetal Bovine Serum Thermo Fisher Scientific Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes) Illumina Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes) Illumina Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes) Illumina Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes) Illumina Cat# FC-131-2004
Lambda Exonuclease (5 U/μl) New England BioLabs Cat# M0262S
Mouse Fc block BD Pharmingen Cat# 553142
Myelin removal beads Miltenyl Biotec Cat# 130-096-433
Nextera XT DNA Sample Prep Kit Illumina Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina Cat# 20024907
PBS (10X), pH 7.4 Thermo Fisher Scientific Cat# 70011044
PCRClean DX beads Aline Biosciences Cat# C-1003-50
Propidium Iodide Thermo Fisher Scientific Cat# P3566 Staining: 1:1000
Qubit dsDNA HS Assay Kit Thermal Fisher Scientific Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70) BioLegend Cat# 101236; RRID: AB_11203704 Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11) Thermo Fisher Scientific Cat# 25-0451-82; RRID: AB_469625 Staining: 1:300
Recombinant RNase Inhibitor Takara Bio Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl) Clontech Cat# 639538 Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS buffer Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific VWR 89005-556
Hard-shell 96-well PCR plates Bio-Rad HSP9631
Others
Dumont #55 forceps Fine Science Tools 11295-51
Dounce homogenizer, 2 ml Wheaton 357422
Large depletion column Miltenyi Biotec 130-042-901
Large selection column Miltenyi Biotec 130-042-401
MACS MultiStand Miltenyi Biotec 130-042-303
QuadroMACS Separator Miltenyi Biotec 130-090-976
RNAzap Thermo Fisher Scientific AM9780
Strainer (70 μm) Falcon 352350
Equipment
BD FACSAria II BD Biosciences http://www.bdbiosciences.com/
Bioanalyzer Agilent 2100
Fragment Analyzer Agilent 5300
Mosquito HTS nanoliter pipetting robot TTP Labtech https://www.ttplabtech.com/
Qubit 4 Fluorometer Thermo Fisher Scientific Q33226

DOWNLOAD MATERIALS LIST

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18, (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101, (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169, (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94, (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368, (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368, (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34, (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113, (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50, (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22, (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317 (2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14, (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9, (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65, (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562, (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125, (1), 70 (2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19, (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122 (2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147 (2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3, (13), 121109 (2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8, (1), Bethesda. 79-89 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics