깊은 단세포 RNA 염기서열 분석에 대한 하나의 성인 마우스 뇌 반구에서 영역 별 Microglia의 격리

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

우리는 성인 마우스 뇌 반구의 다른 해부 된 영역에서 microglia의 격리를위한 프로토콜을 제공하고, 전체 길이 전사체의 깊은 단일 세포 RNA 시퀀싱을위한 반자동 라이브러리 준비를 제공합니다. 이 방법은 건강과 질병에서 microglia의 기능적 이질성을 해명하는 데 도움이됩니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhou, L., Li, Q. Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing. J. Vis. Exp. (154), e60347, doi:10.3791/60347 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

중추 신경계에 거주 대식세포로, microglia 적극적으로 뇌 발달과 항상성을 제어, 그들의 기능 장애는 인간의 질병을 구동 할 수있다. 상당한 발전은 환경 자극에 응하여 그들의 유전자 발현의 변경뿐만 아니라 항상성 microglia의 분자 서명을 밝히기 위하여 만들어졌습니다. 단세포 게놈 방법론의 출현과 성숙으로, 이종 microglia는 다른 발달 및 병리학 조건에서 재생하는 다양한 역할을 기초로 할 수 있다는 것을 점점 인식되고 있습니다. 이러한 이질성의 추가 해부는 관심있는 특정 영역에서 microglia의 효율적인 분리를 통해 달성 될 수 있으며, 개별 세포의 민감한 프로파일링이 뒤따릅니다. 여기서, 우리는 단일 성인 마우스 뇌 반구에서 상이한 뇌 영역에서 microglia의 신속한 격리에 대한 상세한 프로토콜을 제공한다. 우리는 또한 플레이트 기반 깊은 단세포 RNA 순서를 위해 이 분류된 microglia를 사용하는 방법을 설명합니다. 이 방법의 다른 시나리오에 대한 적응성에 대해 논의하고 대규모 연구를 수용할 수 있도록 시스템을 개선하기 위한 지침을 제공합니다.

Introduction

모든 신경 세포의 5%-10%를 나타내는 Microglia는 중추 신경계 (CNS)1에걸쳐 흩어져 있는 상주 대식세포입니다. 혈액-뇌 장벽 뒤에 보호, 건강 한 성인 두뇌에 전형적인 microglia 신속 하 게 확장 하 고 천골에서 신경 세포와 상호 작용 하는 후퇴 많은 미세 한 프로세스를 포함. Microglia는 또한 특정 발달 단계 도중 증가된 식세포 기능과 관련되었던 amoeboid 형태를 채택할 수 있습니다 또는 상해와 질병에 있는 면역 도전에1,2,3,4. 최근의 흥미로운 발견은 microglia가 뇌 유래 또는 병리학 적 신호에 결코 수동적인 방관자가 아니라, 예를 들어, 신경 생존을 지원하고, 미성숙 시냅스를 가지치기, 올리고벤드로크세포 세포 분화를 촉진하고, 혈관신생1을촉진함으로써 뇌 발달 및 항상성 조절에 중추적인 역할을 한다는 것을 분명히 입증하였다. microglia의 더 많은 기능이 해명됨에 따라, 흥분은 TREM2와 같은 많은 신경 퇴행성 질환 위험 유전자가 주로 또는 독점적으로 마이크로 글리아5,6,7에의해 표현된다는 것을 보여주었던 인간 유전학 연구에 의해 더욱 촉진됩니다. 발달과 그럴듯한 질병 구동 역할에 있어서 의의를 감안할 때, 최근 신경퇴행성 질환에 대한 새로운 치료 표적을 찾기 위해 미세교세포 유전자 조절 및 기능에 대한 이해를 위해 엄청난 노력이 투입되고있다1,8.

RNA 시퀀싱 (RNA-seq)은 세포 유형 별 유전자 발현의 편견없는 특성화를 허용하며, 이는 차례로 조밀한 세포 네트워크에서 유전자 기능을 조사하는 과학자를안내합니다 7. RNA-seq는 주로 대량 샘플에서 이루어졌으며, 다른 신경 및 면역 세포와 구별되는 항상성 미세 교만 유전자 시그니처의 발견으로이어졌습니다 9. 그러나, 이러한 접근은 microglia 사이 분자와 기능적인 다름을 간과할 수 있었습니다, 특히 그 개발에 일시적으로 나타나거나, 노화와 질병과 관련되었던. 실제로, 단세포 RNA-seq(scRNA-seq)는 다양한 문맥2,3,10에서이전에 과소평가된 마이크로글리아의 이질성을 밝혀냄으로써 분야에 혁명을 일으켰던 감도 및 분해능을 제공한다. 또한, CNS 순환 계면에서 다른 유사한 면역 세포의 존재로 인해, scRNA-seq는 이러한 관련 세포를 거의 사전 지식 없이 분리하고 기능적으로 해부하는 새로운 도구의 설계를 돕는 정보를 제공한다2,11.

scRNA-seq 플랫폼의 다양한 배열이 발명되었으며, 각각 특정 애플리케이션12에적합합니다. 일반적으로, 10x 유전체학과 같은 액적 기반 방법은 각 실행에서 시퀀싱된 수천 개의 셀을 통해 처리량이 더 높으며, 광범위한 분류를 필요로 하는 혼합 된 세포 집단을 포함할 수 있는 입력에 대해 덜 선택적입니다. 플레이트 기반 방법은 더 높은 감도및 읽기 깊이13,14를제공하며, 일반적으로 세포 분류로부터 특정 집단을 타겟팅하여 미묘한 차이 또는 희귀 한 성적 증명서를 밝힙니다. microglial 세포의 작은 백분율을 감안할 때, 특히 그 발달- 또는 질병 관련 하위 집단, 모든 CNS 세포 모형 중, 관심있는 특정 지역에서 microglia를 격리하고 그들의 이질성을 이해하기 위하여 깊고 전체 길이 전사체 정보를 얻는 것이 바람직하다.

여기서, 우리는 반자동 플레이트 기반 라이브러리 준비 절차에 따라 단일 세포 (또는 대량) RNA-seq에 사용되는 단일 반구에서 해부된 다른 마우스 뇌 영역에서 microglia를 분리하는 방법에 대한 세부 정보를 제공합니다. 그런 다음 다른 반구를 조직학적 유효성 검사에 사용할 수 있습니다. 이전에 공표된 방법9로부터간소화된 이 절연 프로토콜은 소량의 시작 물질로부터 수율을 최대화하고, 한편 내인성 미세교유전자 발현 프로파일을 유지하는 것을 목표로 한다. 우리는 형광 활성화 세포 선별 (FACS)을 사용하여 마이크로 글리아 (또는 기타 관련 면역 세포)를 96 웰 플레이트로 풍부하게하고 처리량을 높이기 위해 라이브러리 준비를위한 시약의 양을 소형화합니다. 우리는 다른 플레이트 기반 전략이 적용될 수 있더라도, 이 민감한 scRNA-seq 플래트홈을 강조합니다. 이 방법은 상해 또는 질병 초점과 같은 다른 해부 된 조직에서 microglia를 쉽게 분리하도록 쉽게 적응 할 수 있으며 마우스의 나이는 거의 모든 출생 후 단계에 따라 다를 수 있습니다. 단세포 전사체 연구를 위한 국소 microglia의 능률적인 격리는 건강과 질병에 있는 그들의 기능의 더 나은 이해를 촉진할 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

설치류와 관련된 모든 절차는 스탠포드 대학 지침을 준수, 이는 국가 및 주 법률 및 정책을 준수. 모든 동물 절차는 실험실 동물 관리에 스탠포드 대학의 행정 패널에 의해 승인되었다.

참고: 모든 솔루션 및 버퍼 컴포지션은 재료 표에제공됩니다.

1. 세포 격리당일 준비

  1. 다음 시약을 준비하고 얼음에 냉각: 중간 A (50 mL), 자기 활성화 세포 선별 (MCS) 버퍼 (30 mL), FACS 버퍼 (25 mL), 인산완충식염수 (PBS; 30 mL), DNase (320 μL), 및 RNase 억제제 (30 μL).
    참고: 여기에 제공된 부적은 단일 마우스 뇌 반구의 4개의 뇌 영역(예: 피질, 소뇌, 해마 및 줄무늬)에서 미세글리아를 분리하기에 충분합니다. 더 많은 조직을 사용하는 경우 확장합니다.
  2. 얼음 에 깨끗한 2 mL Dounce 균질화4를 놓고 DNase 80 μL (12,500 단위 / mL)과 RNase 억제제 5 μL로 중간 A 2 mL을 각 Dounce 균질화제에 추가하십시오. 15 mL 튜브에 피스톤을 냉각.
  3. 조직 수집을 위해 뇌 부위에 6cm 페트리 접시 4개에 라벨을 부착하고 얼음 위에 각 접시에 차가운 매체 A 200 μL을 넣습니다. 중간 크기 A의 약 5 mL을 해부를 위해 6cm 페트리 접시에 넣습니다.
    참고: 사용하기 전에 모든 시약이 멸균되어 RNA 응용 분야에 적합한지 확인하십시오. 벤치 및 해부 도구는 RNase 오염 제거 솔루션(재료 표)으로청소하고 살포해야합니다.

2. 뇌 영역 해부

참고: 이 단계는 ~ 30 분 정도 소요됩니다.

  1. 400-500 μL의 케타민/자일라진(24 mg/mL 케타민 및 2.4 mg/mL 자일라진)을 청소년의 복막에 성인 단계 마우스(>1개월)에 주입합니다.
    참고: 남성 마우스는 여기에 그림을 위해 사용되지만 성별이 적합합니다.
  2. 5 분 동안 기다렸다가 뒷발을 꼬집어 후퇴가 없도록하십시오.
  3. 즉시 26 G x 3/8 바늘을 사용하여 20-30 mL의 얼음 차가운 PBS로 백혈구 관류를 수행하여 뚜피혈없이 버퍼가 다 떨어질 때까지 사용합니다.
  4. 수술 가위로 마우스를 참수. 작은 가위를 사용하여 피부를 열어 두개골 아래에 노출한 다음 시상 봉합사, 람도이달 봉합사 및 관상 봉합사를 잘라냅니다. 집게를 사용하여 조직을 손상시키지 않고 정수리 뼈와 심상 뼈의 양쪽을 떼어 내고 중간 A로 뇌를 해부 페트리 접시로 조심스럽게 옮깁니다.
  5. 미리 차가운 블레이드를 사용하여 중간선을 통해 뇌를 두 개의 반구로 잘라냅니다.
    참고: 단일 반구에서 여기에 기술된 4개의 두뇌 지구는 단 세포 또는 bulk RNA-seq 신청을 위한 microglia의 충분한 수를 산출합니다. 다른 반구는 세포 유효성 검사에서 면역성 화학 또는 RNA에 사용될 수 있다.
  6. 소뇌를 피질 엽과 뇌줄기에서 분리하여 #55 집게로 분리하고 조직을 수집 페트리 접시로 옮김을 옮김으로 옮김을 옮김으로 옮김을 옮김으로 옮김을 분리합니다.
  7. #55 포셉을 사용하여 해마와 줄무늬를 피질에서 조심스럽게 해부하고 각 조직을 수집 페트리 접시로 옮김하십시오.

3. 기계 조직 해리

참고: 염색 단계를 제외하고 는 세포와 시약을 항상 시원하게 유지하십시오. 이 단계는 ~ 30 분 정도 소요됩니다.

  1. 면도날로 각 뇌 조직을 <1 mm3미세 조각으로 자릅니다.
  2. 1 mL 파이펫(팁 이잘 포함)을 사용하여 조직 조각을 미리 냉각된 Dounce 균질화제로 옮기고, 각각 DNase 및 RNase 억제제가 있는 중간 A 2 mL을 함유합니다.
  3. 눈에 보이는 덩어리가 없을 때까지 6-10 전체 스트로크를 위해 Dounce 균질화기 안팎으로 피스톤을 천천히 비틀어 조직을 균질화합니다.
    참고: Douncing는 뉴런과 대부분의 다른 신경교 세포를 죽이고 그러나 microglial 세포를 오히려 그대로 둡니다. 불충분하고 과도하게 사용하면 세포의 수율이 낮아지게 될 수 있습니다.
  4. 해리된 조직을 70 μm 스트레이너를 통해 50 mL 튜브로 옮김을 옮니다.
  5. 총 6 mL의 차가운 배지 A로 각각의 Dounce 균질화 및 피스톤을 헹구고 동일한 스트레이너를 통해 헹구는 용액을 해당 튜브로 필터링합니다.
  6. 단일 셀 현탁액(각각 약 8mL)을 400 mg에서 15 mL 원엽 튜브 및 원심분리기를 4°C에서 5분 동안 브레이크 = 5로 옮깁니다.

4. 미엘린 제거

참고: 이 단계는 ~ 60 분 정도 소요됩니다.

  1. 자기 분리기(재료표)에서큰 고갈(LD) 열 1개(피질용)와 3개의 큰 선택(LS) 컬럼(기타 3개 영역)을 준비합니다. MCS 버퍼의 3 mL로 각 열을 헹구는다.
  2. 원심 분리가 완료되면, 피펫을 꺼내 펠릿을 방해하지 않고 상급자를 폐기하십시오. 피질 과 소뇌 조직의 경우, RNase 억제제의 1.8 μL로 MCS 완충액 850 μL에서 세포를 다시 중단하십시오. 해 마 와 striatum 조직에 대 한, 다시 중단 세포를 400 MCS 버퍼의 400 RNase 억제제의 0.9 μL.
    참고: 기둥 (LD 대 LS) 및 재현탁에 사용되는 부피는 조직에 존재하는 미엘린의 양에 따라 최적화됩니다. 그밖 두뇌 지구가 분석되는 경우에, 이 조건은 조직의 규모 및 얼마나 많은 myelin존재할 수 있는지에 따라서 조정될 필요가 있을 수 있습니다. 미엘린 제거의 효과는 4.9단계에서 추정될 수 있다.
  3. 100 μL의 미엘린 제거 구슬을 각각 피질과 소뇌의 세포에 넣고 해마와 줄무늬에서 세포에 50 μL의 미엘린 제거 구슬을 추가합니다.
  4. 세포를 구슬과 부드럽게 섞고 10 분 동안 얼음에 튜브를 배양하십시오.
  5. MCS 버퍼가있는 피질 세포가있는 튜브의 부피를 2 mL로 가져 오고 다른 모든 것을 1 mL로 가져 오십시오 (즉, 피질 세포에 대해 1 mL을 추가하십시오. 해마 및 줄무늬 세포에 500 μL; 소뇌 세포에 버퍼를 추가 할 필요가 없음).
  6. 헹구는 버퍼가 비어 있으면 각 컬럼 아래에 15mL 튜브를 놓습니다. 피질 세포(2mL)를 LD 컬럼에 로드하고 다른 모든 셀(각 1mL)을 LS 열에 로드합니다. 즉시 MCS 버퍼 의 1 mL를 사용하여 원래 튜브를 세척하고 해당 컬럼에 솔루션을로드합니다.
  7. LD 컬럼을 1 mL의 MCS 버퍼로 한 번 세척하고 각 LS 컬럼을 1 mL의 MCS 버퍼로 두 번 세척하십시오. 세척 하는 동안 흐름 통해 용액을 수집 을 계속 합니다.
  8. 35 μm 스트레이너 캡을 통해 둥근 바닥 FACS 튜브로 세포를 필터링합니다.
    참고: 각 튜브는 미엘린이 고갈된 단세포 현탁액의 약 4 mL를 수집해야 한다.
  9. 선택적으로, 셀 현탁액의 10 μL을 취하고 0.4% 트라이판 블루 용액의 10 μL과 혼합한다. 10x 밝은 필드 현미경의 밑에 세포를 검토하여 수율, 생존율 및 잔류 미엘린의 수준을 추정합니다.
    참고: 성공적인 준비는 미엘린 파편이 거의 또는 전혀없는 90 % 이상의 살아있는 세포 (모양이 둥근 파란색 염료 제외)를 생성해야합니다.
  10. FACS 튜브의 펠릿 세포는 4 °C에서 5 분 동안 400 x g에서 브레이크 = 5. 천천히 상급을 부어 티슈 페이퍼에 튜브의 가장자리를 두드려. FACS 버퍼의 300 μL각 튜브에 세포를 다시 일시 중단.
    참고: MCS 선별이 바람직한 경우, CD11b 비드는 미엘린 제거 후 미세글리아 및 기타 골수성 세포를 선택하는 데 사용될 수 있다. 이들 세포는 비플레이트 계 scRNA-seq뿐만 아니라 벌크 RNA-seq에 사용될 수 있다. 이 대안적인 접근의 주의는 CD11b 비드는 또한 이 항원을 위해 긍정적인 그밖 관련 면역 세포에서 microglia를 분리하지 않는다는 것입니다.

5. 형광 활성화 세포 선별을위한 염색

참고: 이 단계는 ~ 40 분 정도 소요됩니다.

  1. 각 튜브에 5 μL의 마우스 Fc 수용체 블록 시약(재료 표)를추가합니다. 얼음에 5 분 동안 배양.
  2. 각 튜브에 CD45-PE-Cy7 1 μL과 CD11b-BV421 의 1 μL을 추가합니다.
    참고: 다른 공액형 형광단을 가진 항체가 사용될 수 있다. TMEM119에 대한 항체는, 동압 성 마이크로 글리아9에대한 특정 마커도 포함 될 수 있지만, 특정 마이크로 글리아 하위 집단이 TMEM119 표면 발현을 잃을 수 있기 때문에 CD45 및 CD11b와 함께 사용하는 것이 좋습니다.
  3. 실온(RT)에서 10분 동안 셰이커에 튜브를 배양합니다.
  4. 씻을 FACS 버퍼 2mL를 추가합니다.
  5. 4 °C에서 펠릿 세포, 400 x g 5 분 동안. 천천히 상류물을 부어 티슈 페이퍼에 튜브의 가장자리를 두드려. 400 μL의 FACS 버퍼를 사용하여 각 튜브의 세포를 RNase 억제제 1 μL 및 프로피듐 요오드화물 0.5 μL (PI, 1:1,000 희석)을 사용하여 세포를 재중단시.

6. 인덱스 FACS 정렬

참고: 이 단계는 ~ 1 h를 취해야합니다.

  1. 표준 FACS 절차에 따라, 산란(파편 제외), 단일 세포, 라이브 셀(PI 음수), 미세글리아 및 골수성 세포(CD45+,CD11b+)를기반으로 게이트를 그립니다.
    참고: 전형적인 미세교세포는 다른 국경 관련 대식세포와 비교하여 낮은 수준에서 CD45를 발현하고, 따라서 CD45에 대한 게이팅은 낮은 CD11b+이며, 이러한 고전적 미세글리아1,2에서유전자 발현 프로파일의 초점이 면 충분해야 한다. 그러나, microglia의 특정 부분 집합은 더 높은 CD45 발현이 있을 수 있고 이것은 발달 도중 또는 질병 조건에서 특히 사실입니다. 미세교색 유전자 발현의 편견 없는 분석을 보장하기 위해 CD45 고위험 및 CD45 낮은 면역페노형은 인덱스 정렬 설정과 시퀀싱 및 다운스트림 분석을 위해 수집된 두 집단을 통해 기록될 수 있습니다. 또한, TMEM119 표면 발현은 적시성 미세교어 집단(단계 5.2 참조)을 표적으로 하고 CD45 수준 및 시퀀싱 결과와 함께 분석하는데 사용될 수 있다.
  2. 단일 마이크로글리아(100 μm 노즐 포함)를 96웰 폴리머라제 연쇄 반응(PCR) 플레이트로 정렬하고, 각각 4 μL의 용해 버퍼를 함유합니다(자세한 내용은 게시된 프로토콜14 참조).
    참고: 외부 RNA 제어 컨소시엄(ERCC) RNA 스파이크인혼합(표 의 재료표)은 품질 관리 및 정상화 를 위해 용해 완충액에 1:2.4 x 107에 첨가될 수 있다2.
  3. 벤치 탑 원심분리기를 사용하여 접시를 잠시 소용돌이시키고 스핀다운합니다.
  4. 즉시 드라이 아이스에 샘플을 동결. 접시를 -80°C에서 보관할 때까지 보관하십시오.
    참고: 대안적으로, 더 많은 세포는 벌크 RNA-seq를 위한 RNA 추출 완충액을 가진 1.5 mL 관으로 집합될 수 있다. 저자의 경험에 따르면, 3,000 셀은 게시 된 프로토콜2,14에따라 양질의 라이브러리를 생성하기에 충분합니다.

7. 단세포 RNA 시퀀싱 라이브러리 준비

참고: 여기서, 게시된프로토콜(14)은 액체 처리 로봇공학 및 몇 가지 수정의 도움으로 scRNA-seq 라이브러리를 생성하기 위해 뒤따른다. 이 문서에서는 절차만 간략하게 설명되며 차이점이 강조 표시됩니다. 4 개의 플레이트를 동시에 처리하는 데 약 2.5 일이 걸립니다.

  1. 얼음에 플레이트를 해동하고 Oligo-dT30VN 프라이머 (용해 완충제)로 역전사를 수행하여 열 사이클러로 cDNA를 생성합니다(표 1): 42 °C 90 분; 70 °C 5 분; 4 °C 홀드. 이어서 PCR 마스터 믹스를 이용하여 PCR 마스터 믹스를사용하고(표 2)PCR(재료표) 및 다음 PCR 조건인37°C 30분에서 추가적인 외핵구 소화 단계로 cDNA를 증폭; 95°C 3분; 98°C 20s, 67°C 15s, 72°C 4분의 23 사이클; 72 °C 5 분
  2. 웰 당 자기 비드 18 μL을 사용하여 cDNA를 정화하십시오 (0.7 :1 비율). 5 분 동안 마그네틱 스탠드에 접시를 배양하고 갓 만든 80 % 에탄올로 샘플을 두 번 씻어, 잘 당 80 μL 때마다. 플레이트를 15-20 분 동안 건조 한 후, 잘 당 용출 완충제 20 μL로 cDNA를 용해.
    참고: 품질 관리를 위해 단편 분석기(고감도 차세대 시퀀싱[NGS] 단편 분석, 1-6,000 bp)를 사용하여 cDNA의 크기 분포와 농도를 확인하고 500-5,000 bp 사이의 얼룩이 있는 시료만 추가처리하고 0.05 ng/μL 보다 높은 시료를 처리합니다.
  3. 라이브러리를 생성하려면 각 cDNA 샘플의 0.4 μL을 라이브러리 준비키트(재료 표)에서1.2 μL의 Tn5 태면 시약과 혼합하여 나노리터 파이펫팅 기계의 도움으로 384웰 플레이트에서 55°C 10분.
    참고: 여기서, 제안된 반응 량의 1/12.5(5 μL 샘플 및 태그환재 15μL)가 추가되어 비용을 절감하고 처리량을 증가시다. 나노 리터 파이펫팅 기계(재료 표)는시약 (이 단계 및 다음 단계)을 384 웰 플레이트에서 전송하는 데 사용됩니다.
  4. 0.4 μL의 중화 버퍼를 추가하여 RT에서 태그 반응을 5분 동안 중지합니다.
  5. 384 개의 인덱스를 추가(재료의 표,0.4 μL 앞으로 0.4 μL 역방향), 샘플에 PCR 믹스의 1.2 μL (각각 2 μL), 다음 조건을 사용하여 라이브러리를 증폭 : 72 °C 3 분; 95°C 30s; 95°C 10s, 55°C 30s, 72°C 1분의 10 사이클; 72 °C 5 분
  6. 동일한 384웰 플레이트에서 모든 개별 라이브러리(각 1μL를 가져가라)를 풀하고, 마그네틱 비드(재료표,0.7:1 비율)를 사용하여 최종 풀드 라이브러리를 정화합니다.
  7. 형광계(재료 표)를사용하여 농도를 측정하고 생체 분석기(재료 표)를사용하여 시퀀싱 전에 풀링 된 라이브러리의 크기 분포를 검사합니다. 셀당 100만 개의 원시 읽기에서 시퀀싱 깊이를 타겟팅합니다.
  8. 표준 생물 정보학적 절차를 따라 시퀀싱 읽기를 필터링하고 트리밍하고 정렬2를수행합니다. 카운트 테이블과 메타 데이터를 입력으로 사용하여 Seurat 패키지15를사용하여 클러스터링 분석을 수행합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

이 프로토콜은 scRNA-seq에 선행된 1명의 성인 perfused 뇌 반구에 있는 다른 두뇌 지구에서 microglia를 분리하고 분류하는 방법을 기술합니다. 우리는 단일 세포 현탁액을 만들기 위해 douncing을 사용하고 또한 microglia를 풍부하게하는 첫 번째 단계로. 불충분하거나 과도하게 사용하면 수율이 감소합니다. 또한, 성인 마우스 두뇌는 미엘린의 높은 수준을 포함, 또한 정렬 효율성과 제대로 제거 하지 않을 경우 수율을 줄일 수 있습니다. 따라서, 항체 염색을 수행하기 전에 미엘린 제거의 수율, 세포 생존율 및 효능을 추정하기 위해 트리판 블루 및 혈세포계를 사용하여현미경하에서 세포 현탁액을 검사합니다(단계 4.9). 이 시점에서 총 세포 수는 피 질에 대 한 30,000 이상 이어야 한다, 그리고 이상 5,000 다른 조직에 대 한. 세포의 90% 이상은 작은 미엘린 파편으로 실행 가능해야 합니다.

우리는 일반적으로 CD45 낮고 CD11b 양성인 microglia (또는 골수성 세포)를 분류하기 위해 FACS 기계를 사용합니다. 적어도 피질 조직에 대해 성공적인 격리는 모든 살아있는 단일 세포 중80 % 마이크로 글리아를 생성해야합니다(그림 2). 죽어가는 /죽은 인구는 준비의 작은 부분 (약 10 %)을 나타냅니다.

일단 개별 microglia가 용해 완충액으로 포획되면, RNA는 풀어 놓이고 그 후에 cDNA에 반전되고, 그 후에 23 주기 동안 증폭됩니다. 라이브러리를 만들기 전에 이러한 cDNA 샘플의 품질을 확인하는 것이 중요합니다. 모세관 전기 영동 플랫폼으로서, 단편 분석기 및 고감도 NGS 단편 키트(1−6,000 bp)는 96웰 플레이트의 각 웰에 존재하는 cDNA 분자의 양뿐만 아니라 크기 분포에 대한 빠르고 정확한 정보를제공합니다(그림 3A). 얼룩(500-5,000 bp) 및 특정 농도 임계값(예: 0.05 ng/μL)을 나타내는 샘플을 라이브러리를 만드는 데 사용할 수 있습니다. 마찬가지로, 풀링된 라이브러리는 시퀀싱 전에 바이오 분석기에서 테스트되어야합니다(그림 3B).

우리는 이 scRNA-seq 방법론16의검출 힘을 포화시키는 세포 당 1백만 개 이상의 원시 읽기의 깊이로 견본을 순서를 바릅니다. 대략 60% 매핑 비율로, microglial 세포 당 2,000의 유전자 이상 검출될 수 있습니다. 우리는 이 격리 방법17을사용하여 생성된 출판된 데이터를 획득하고, 서열화된 집단에 걸쳐 마이크로글리아 특이적 유전자를 검출하기 위한 독립적인 실험 및 민감성으로부터의 재현성을 입증하였다(도4).

Figure 1
도 1: 미세글리아 절연 수율의 추정, 세포 생존율 및 미엘린 제거의 효율. 왼쪽 패널은 미엘린 제거 컬럼을 통과한 후 트라이판 블루 스테인드 세포(피질로부터)의 밝은 필드 이미지(4배 배율)를 나타내었다. 다른 지역에 대한 결과는 비슷하지만 셀수가 적습니다. 세포의 대다수 (전부는 아니더라도) 프로세스의 손실 때문에 밝은 (비 염색) 및 둥근 나타났습니다. 오른쪽 이미지는 박스형 영역의 줌인(20배)이고 작은 미엘린 파편이 존재했습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2: 마이크로글리아 정렬에 사용되는 게이트입니다. 데이터는 피질에서 microglia를 분류하기위한 게이팅 전략을 보여주었고, 동일한 전략이 다른 지역에 사용되었습니다. 세포 파편은 먼저 산란플롯에서 제외되었고, 단일 셀은 순방향 산란 영역(FSC-A)/전방 산란 폭(FSC-W)에 의해 게이트되었습니다. 살아있는 세포는 모든 단일 세포의 약 90%로부터 PIP 음성 염색에 의해 게이트되었다. 살아있는 세포의 대략 80%를 나타내는 Microglia는, CD45 낮은 CD11b+ 게이트에서 분류되었습니다. 총 ~ 30,000 microglia (3 개월 된 마우스의 한 반구에서) 피질 조직에서 분리 하 고 정렬 될 수 있습니다. FACS 컴퓨터에서 인덱스 정렬이 수행되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3

Figure 3
그림 3: 단일 마이크로교세포 및 최종 풀화된 라이브러리로부터 증폭된 cDNA에 대한 대표적인 품질 관리 결과. (A)단편 분석기를 사용하여 모든 조각은 X축의 크기와 Y축의 상대 형광 강도로 플롯되어 주어진 크기의 cDNA가 풍부함을 나타냅니다. LM(하부 마커, 1bp) 및 UM(상부 마커, 6,000 bp)은 cDNA 수량을 측정하는 데 사용되는 알려진 농도를 가진 로딩 마커입니다. 대표적인 미세교세포로부터 성공적으로 증폭된 cDNA는 500 bp와 5,000 bp 사이의 겔 그래프상에서 크기 분포 그래프 또는 얼룩(표지된 브래킷)에 곡선(녹색 점선)을 형성한다. 다른 표지된 피크는 ERCC 스파이크인 분자 또는 리보좀 RNA로부터 증폭되었다. 500 bp와 5,000 bp 사이의 cDNA 농도는 정량화 될 수 있으며, 0.05 ng / μL보다 높은 농도를 가진 샘플과 이러한 전형적인 곡선을 보여주는 샘플은 라이브러리 준비를 위해 유지됩니다. RFU, 상대 형광 단위. (B)최종 풀드 라이브러리의 크기 분포를 나타내는 바이오 분석기(약 380셀)에 대한 대표적인 품질 관리 결과. 일반적으로 200bp에서 2,000bp까지의 범위는 평균 크기가 400-600bp입니다. 두 개의 날카로운 피크는 마커를 로드했다. FU, 형광 유닛. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
도 4: 2마리의 수컷 마우스의 4개의 뇌 영역에서 분리된 마이크로글리아의 scRNA-seq 분석. (A)tSNE 플롯은 국소 미세글리아의 혼합 패턴을 보여주는 #1 강조했다). tSNE 플롯의 집중된 영역으로 미묘한 이동을 넘어 영역 기원에 따라 별개의 클러스터를 형성하지 않습니다(배치 효과로 인해 가능). 이러한 관찰은 성인 마우스에서의 글로벌 유전자 발현에 기초한 미세글리아의 제한된 국소 이질성과 일치한다(이 주제에 대한 추가 논의를 위한 최근 간행물2 참조). (B)tSNE 플롯은 독립적으로 처리된 2개의 개별 마우스로부터 마이크로글리아의 중첩 패턴을 나타낸다. 비록 작은 배치 효과 존재할 수 있습니다 (플롯의 특정 영역에 집중 하는 세포), 이 세포 동물 기원에 따라 별개의 클러스터를 형성 하지 않습니다. 이 결과는 실험 간의 데이터를 비교하기 위한 프로토콜의 재현성을 시사한다. (C) Tmem19P2ry12와같은 특정 마커에 대한 검출율을 95% 이상 보여주는 scRNA-seq에 의해 검출된 마이크로글리아 시그니처 유전자의 발현, Sall1Pu.1과같은 알려진 전사 인자에 대한 검출율 80% 이상. 데이터는 출판된 문헌17에서다시 분석되었다. (D)대부분의 분리된 미세글리아는 Tubb3(뉴런), Aldh1l1(성상세포), Gjb1(올리고덴드로시테스), 및 Tie1(내피 세포)과 같은 다른 세포 유형에 특이적인 유전자의 발현이 부족하다. (E)미세교활성화 또는 스트레스와 관련된 유전자의 발현. 고전 마커, Tnf, Il1b, Nos2Nfkb2는낮은 표현으로 상단에 표시됩니다. 조기 반응 유전자인 Egr1Fos는하단에 표시됩니다(토론 참조). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

시약 볼륨(μl)
세포 라해스 4
역전사 (100 U / μL) 0.95
Rnase 억제제 0.25
5x 첫 번째 가닥 버퍼 2
디티오트레이톨 (DTT; 100 mM) 0.5
베타인 (5 M) 2
MgCl2 (1 M) 0.06
템플릿 스위치 올리고(TSO; 100 μM) 0.1
H2O 0.14
10

표 1: 역전사 상태. 1개의 역전사 반응에 대한 시약 부피가 제공된다.

시약 볼륨(μl)
역전사 제품 10
2x PCR 마스터 믹스 12.5
ISPCR 프라이머 (10 μM) 0.25
람다 외핵항제 0.1125
H2O 2.1375
25

표 2: PCR 증폭 조건. 단일 세포로부터 cDNA의 PCR 증폭을 위한 시약 부피가 제공된다.

플레이트 기반(이 프로토콜) 액적 계 (10x 유전체학)
감도 더 많은 유전자 검출 검출된 유전자 수 감소
전체 길이 아니오(5' 또는 3' 끝)
셀 번호/모집단에 대한 유연성 작거나 희귀한 하위 집단의 특성화에 적합 큰 세포 집단의 광범위한 분류에 적합
처리량 최대 수천 개의 셀 수백 에서 수만 개의 셀
고유 분자 식별자 아니요
셀당 비용 $1−$5 $1 미만
실험 난이도 더 많은 단계와 일반적으로 액체 처리 로봇이 필요합니다. 상용화 된 기계로 간단하게 수행
세포 집단 FACS 정렬 대상 편견

표 3: 플레이트 기반 및 액적 기반 scRNA-seq 방법 간의 비교. 이 문서에서는, 플레이트 기반의 전신 scRNA-seq 절차가 제공되며, 이는 입력으로서 소수의 세포에 대한 더 높은 감도, 전체 길이 시퀀싱 및 유연성의 장점을 갖는다. 액적 기반 방법은 높은 처리량, 낮은 비용, 수행하기 쉬운 이점 및 고유한 분자 식별자의 데이터 등의 이점을 제공합니다. 그들은 실험의 목적에 따라 상호 보완적이다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Microglia적극적으로 CNS에 있는 그밖 세포 모형과 상호 작용하고, 환경 자극에 아주 과민합니다. 격리 과정 동안 그들의 유전자 발현에 있는 선동적인 반응 그리고 비정상적인 변경을 극소화하기 위하여, 이 프로토콜은 이전에 간행된 방법9에서능률화되었습니다, 그리고 지금 병렬로 단 하나 마우스 두뇌 반구의 다중 지구에서 microglia를 격리하기 위하여 적당합니다. 조직과 시약은 차가운 온도에서 보관되며 제한된 조직 크기에 따라 세척 횟수가 적고 시약이 적어 적시에 실험이 수행됩니다(해부에서 선별까지 약 3.5시간). 기계적 해리가 마이크로글리아9,18에거의 손상또는 활성화를 일으키면서 신경세포 및 기타 신경교 세포를 죽이고 제거할 수 있기 때문에 효소 소화와 같은 다른 균질화 방법을 선택한다. 과잉 douncing, 그러나, microglia의 수율을 줄일 수 있습니다 및 피해 야 한다. 이전에는 기계적 해리 및 구슬계 미엘린 제거가 FACS 선별에 이어 미세글리아에 덜 활성화되는 것으로 나타났으며, 예를 들어, Tnf, Il1b, Nos2,Nfkb29(도 4E)의고전적 염증 성 유전자의 최소 발현에 기초한다. 그럼에도 불구하고, 마이크로글리아는 여전히 생체내 2,19에서마이크로글리아로 일반적으로 발현되지 않는 FosEgr1(그림 4E)과같은 초기반응 유전자를 상승시킴으로써 해리 및 선별 동안 생체 내 조건에 반응할 수있으며,전사학 연구에서의 이러한 변화는 항상 조직학 섹션에서 검증되어야 한다.

여기에서 우리는 성인 마우스 두뇌 반구에서 피질, 소뇌, 해마 및 striatum에서 microglia를 격리하기 위한 절차를 제공하고, 이 프로토콜은 그밖 지구 또는 단계에 쉽게 적응될 수 있습니다. 이것은 예를 들어, 질병에 영향을 받는 microglia가 해부될 수 있는 뇌의 특정 영역으로 제한되거나, 상당한 개별 변화로 인해 샘플을 풀링하는 것이 부적절한 노화 연구에서 유용합니다. 마이크로 밀리약 (또는 팬 선천성 면역) 에피토프에 대한 항체의 가용성으로, 이 프로토콜은 또한 쥐 또는 인간 조직에서 미세 글리아를 분리하기 위해 적응 될 수있다9. 더 크거나 오래된 조직을 조정할 때, myelin 제거 구슬의 부피 및 사용된 열의 모형을 고려하고 시험하는 것이 중요합니다. 미엘린 제거를 위한 대안적인 접근법은 상업적저점도매부(20)에서밀도 구배 원심분리에 의한 것입니다. 전반적으로 이들 두 가지 방법은 밀도 구배 원심분리 법이 약간 더 높은 수율을 제공할 수 있지만, 반면에 자기 비드 방법은 마이크로글리아21,22를활성화시킬 수 있는 내독소를 도입할 가능성이 적다.

총 뇌 세포 중 microglia의 작은 비율로 인해, 그것은 종종 농축 또는 단일 세포 전사학 연구를 수행 하기 전에 microglia를 정화 하는 것이 필수적이다. 우리는 낮은 표현된 세포 모형을 붙잡기 위하여 민감한 접근으로 FACS를 사용하고, CD11b 및 CD45 표면 표현에 근거를 둔 microglia를 선택합니다. 한 반구에서, 우리는 정기적으로 피질에 대한 ~ 30,000 마이크로 글리아를 얻고, 소뇌, 해마 또는 striatum에 대한 ~ 5,000 마이크로 글리아. 이러한 수율은 대부분의 단일 세포 응용 분야뿐만 아니라 벌크 RNA-seq(3,000개 이상의 세포가 사용될 수 있음)에 충분하다. microglia가 개발 또는 질병2도중 CD45 면역 반응성을 upregulate 수 있다는 것을 언급할 가치가 있습니다, 이 경우 CD45의 낮고 높은 수준을 가진 세포는 기록하고 분석을 위해 분류되어야 합니다. microglia를 풍부하게 하기위한 또 다른 옵션은 myelin 제거 다음 CD11b 비드 매개 자기 활성화 세포 선별을 사용하는 것입니다, 그러나 이것은 scRNA-seq를 액적 방법에 제한할 것입니다.

단세포 분해능에서 microglial 유전자 발현을 연구하기 위해, 우리는 일반적으로 세포를 샘플당 적어도 2-3 96웰 플레이트로 분류하고 액체 처리 기계로 라이브러리 준비를 수행합니다. 이러한 판계 전신 라이브러리 준비 접근법은 검출 한계에서 가장 민감한 scRNA-seq 방법 중 하나이며, 전사 인자13,14,16과같은 희귀 전사체의 정확한 정량화를 가능하게 하는 것으로 나타났다. 전체 길이 시퀀싱으로 인해 이 방법은 5' 또는 3' 바이어스의 적용을 받지 않으며 접합 변형을 분석하는 데 사용할 수있습니다(표 3). 또한, 일반적으로 반응에서 수백 또는 수천 개의 세포를 필요로 하는 액적 기반 방법과 달리, 이 플레이트 기반 프로토콜은 각 실험에서 소수의 세포를 포함하는 유연성을 가지며, 나중에 설계에 더 많은 플레이트를 추가하여 점차적으로 집단 크기를 확장할 수 있다. 이것은 배아 발달과 같은 특정 조건에서 microglia의 작은 부분 세트를 공부할 때 유리합니다.

이 프로토콜은 재현적으로 뇌 지역 microglia에 대한 고품질 scRNA-seq 라이브러리를 생성하는 동안, 그것은 종종 때문에 상대적으로 높은 비용으로 소규모 연구에 적합 (약 $5 / 셀 라이브러리 준비를위한, 여전히 보다 저렴 $23 / 셀 오프 선반 SmartSeq v4 키트를 사용하는 경우). 몇 가지 전략을 통해 비용을 절감하고 처리량을 늘릴 수 있습니다. 첫째, 세포는 용해 완충액의 0.5 μL만큼 적은 384 웰 플레이트로 분류 될 수 있으며, 이것은 초기 역전사 및 PCR 증폭 단계에 대한 1/8 부피의 시약만 필요합니다. 둘째, 시판되는키트(23)에있는 것과 유사한 품질을 가지는 사내 Tn5 트랜스포사아제(transposase)를 생산할 수 있다. 이 두 가지 수정은 라이브러리 준비 비용을 $1/셀로 줄일 수 있습니다. 셋째, 사용자 지정 인덱스를 사용하여 수천 개의 셀을 함께 풀링하여 시퀀싱 깊이(>1백만 읽기/셀)를 희생하지 않고 시스템에서 시퀀싱할 수 있습니다17. 자동화된 액체 처리 로봇의 통합과 함께 이러한 개선은 거의 모든 정의된 영역에서 분리된 마이크로글리아의 고처리량 딥 scRNA-seq를 가능하게 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

우리는 마리코 L. 베넷, 리아나 니콜 보난노, 스파이로스 다르마니스가 이 프로토콜을 개발하는 동안 도움을 준 것에 대해 감사드립니다. 우리는 또한 스탠포드 공유 FACS 시설, 특히 메러디스 웨글라츠와 리사 니콜스 감사합니다; 스탠포드 단백질 과 핵산 시설 (PAN)에서 엔 트랜, 마이클 에카트는 촬영에 대한 큰 지원을위해. 이 작품은 JPB 재단과 빈센트 J. 코트 재단에 의해 지원됩니다.

Materials

Name Company Catalog Number Comments
5 M Betaine Sigma-Aldrich Cat# B0300-5VL
10 mM dNTP mix Thermo Fisher Scientific Cat# R0192
0.5 M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
10X Hanks’ Balanced Salt Solution Thermo Fisher Scientific Cat# 14185-052
1 M HEPES Thermo Fisher Scientific Cat# 15630080
1X KAPA HIFI Hotstart Master Mix Kapa Biosciences Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap Corning Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp) Advanced Analytical Cat# DNF-474-1000
Bovine Serum Albumin Sigma Aldrich Cat# A8806
DNase I Worthington Cat# LS002007 Working solution: 12500 units/ml
DTT, Molecular Grade Promega Cat# P1171
ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740
Fetal Bovine Serum Thermo Fisher Scientific Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes) Illumina Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes) Illumina Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes) Illumina Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes) Illumina Cat# FC-131-2004
Lambda Exonuclease (5 U/μl) New England BioLabs Cat# M0262S
Mouse Fc block BD Pharmingen Cat# 553142
Myelin removal beads Miltenyl Biotec Cat# 130-096-433
Nextera XT DNA Sample Prep Kit Illumina Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina Cat# 20024907
PBS (10X), pH 7.4 Thermo Fisher Scientific Cat# 70011044
PCRClean DX beads Aline Biosciences Cat# C-1003-50
Propidium Iodide Thermo Fisher Scientific Cat# P3566 Staining: 1:1000
Qubit dsDNA HS Assay Kit Thermal Fisher Scientific Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70) BioLegend Cat# 101236; RRID: AB_11203704 Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11) Thermo Fisher Scientific Cat# 25-0451-82; RRID: AB_469625 Staining: 1:300
Recombinant RNase Inhibitor Takara Bio Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl) Clontech Cat# 639538 Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS buffer Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific VWR 89005-556
Hard-shell 96-well PCR plates Bio-Rad HSP9631
Others
Dumont #55 forceps Fine Science Tools 11295-51
Dounce homogenizer, 2 ml Wheaton 357422
Large depletion column Miltenyi Biotec 130-042-901
Large selection column Miltenyi Biotec 130-042-401
MACS MultiStand Miltenyi Biotec 130-042-303
QuadroMACS Separator Miltenyi Biotec 130-090-976
RNAzap Thermo Fisher Scientific AM9780
Strainer (70 μm) Falcon 352350
Equipment
BD FACSAria II BD Biosciences http://www.bdbiosciences.com/
Bioanalyzer Agilent 2100
Fragment Analyzer Agilent 5300
Mosquito HTS nanoliter pipetting robot TTP Labtech https://www.ttplabtech.com/
Qubit 4 Fluorometer Thermo Fisher Scientific Q33226

DOWNLOAD MATERIALS LIST

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18, (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101, (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169, (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94, (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368, (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368, (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34, (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113, (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50, (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22, (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317 (2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14, (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9, (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65, (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562, (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125, (1), 70 (2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19, (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122 (2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147 (2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3, (13), 121109 (2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8, (1), Bethesda. 79-89 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics