Isolatie van regiospecifieke Microglia van één volwassen muis hersen halfrond voor diepe eencellige RNA-sequencing

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

We bieden een protocol voor isolatie van Microglia uit verschillende ontleed gebieden van een volwassen muis hersen halfrond, gevolgd door semi-geautomatiseerde bibliotheek voorbereiding voor diepe eencellige RNA-sequencing van volledige lengte transcriptomes. Deze methode zal helpen om functionele heterogeniteit van Microglia in gezondheid en ziekte te verhelmaken.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhou, L., Li, Q. Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing. J. Vis. Exp. (154), e60347, doi:10.3791/60347 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Als Resident macrofagen in het centrale zenuwstelsel, Microglia actief controle van de ontwikkeling van de hersenen en homeostase, en hun disfuncties kunnen menselijke ziekten stimuleren. Er zijn aanzienlijke vooruitgang geboekt om de moleculaire handtekeningen van homeostatische Microglia en veranderingen van hun genexpressie te onthullen in reactie op milieu stimuli. Met de opkomst en rijping van eencellige genomische methodologieën wordt steeds meer erkend dat heterogene Microglia de verschillende rollen kan onderdoen die ze spelen in verschillende ontwikkelings-en pathologische omstandigheden. Verdere dissectie van dergelijke heterogeniteit kan worden bereikt door efficiënte isolatie van Microglia uit een bepaald gebied van belang, gevolgd door een gevoelige profilering van individuele cellen. Hier bieden we een gedetailleerd protocol voor de snelle isolatie van Microglia uit verschillende hersengebieden in een enkele volwassen muis hersen hemisfeer. We laten ook zien hoe je deze gesorteerde Microglia gebruikt voor op platen gebaseerde Deep single-cell RNA-sequencing. We bespreken het aanpassingsvermogen van deze methode voor andere scenario's en bieden richtlijnen voor het verbeteren van het systeem voor grootschalige studies.

Introduction

Microglia, dat 5% − 10% van alle neurale cellen vertegenwoordigt, zijn ingezeten macrofagen verspreid over het centrale zenuwstelsel (CNS)1. Beschermd achter de bloed-hersen barrière, typische Microglia in een gezonde volwassen hersenen bevatten vele fijne processen die snel uitbreiden en intrekken om te communiceren met neuronen en andere gliacellen in het parenchym. Microglia kan ook de amoeboïde morfologie aannemen die gepaard gaat met een verhoogde fagocytische functie tijdens specifieke ontwikkelingsstadia of bij immuunproblemen bij letsel en ziekte1,2,3,4. Recente spannende ontdekkingen hebben duidelijk aangetoond dat Microglia geenszins passieve omstanders zijn van hersenen-afgeleide of pathologische signalen, maar spelen cruciale rollen bij het beheersen van de hersenontwikkeling en homeostase, bijvoorbeeld door neuronale overleving te ondersteunen, onrijpe synapsen te snoeien, het bevorderen van oligodendrocyten Lineage cellen differentiatie evenals angiogenese1. Naarmate er meer functies van Microglia worden opgehelderd, wordt de opwinding verder gevoed door onderzoek naar menselijke genetica, waaruit bleek dat veel neurodegeneratieve ziektebestrijdings genen, zoals TREM2, overwegend of uitsluitend worden uitgedrukt door Microglia5,6,7. Gezien hun betekenis in de ontwikkeling en de plausibele rol van de ziekte, is er recentelijk een enorme inspanning geleverd naar ons begrip van microglial genregulatie en-functie in de hoop nieuwe therapeutische doelstellingen voor neurodegeneratieve ziekten van1,8te vinden.

RNA-sequencing (RNA-SEQ) maakt onbevooroordeelde karakterisatie van celtypespecifieke genexpressie mogelijk, die op zijn beurt wetenschappers begeleidt om genfuncties in dichte cellulaire netwerken7te onderzoeken. RNA-SEQ was grotendeels gedaan op bulk monsters, wat leidde tot de ontdekking van een homeostatische microglial gen Signature die hen onderscheidt van andere neurale en immune cellen9. Echter, een dergelijke aanpak kan over het hoofd zien moleculaire en functionele verschillen tussen Microglia, vooral die transitief aanwezig zijn in ontwikkeling, of geassocieerd met veroudering en ziekte. Inderdaad, single-cell RNA-SEQ (scrna-SEQ) biedt de gevoeligheid en resolutie die het veld hebben veranderd door het onthullen van eerder ondergewaardeerde heterogeniteit van Microglia in een verscheidenheid van contexten2,3,10. Bovendien, vanwege de aanwezigheid van andere soortgelijke immuuncellen op de CNS-circulatie-interface, biedt scRNA-SEQ informatie die het ontwerp van nieuwe instrumenten helpt om deze gerelateerde cellen te scheiden en functioneel te ontleden met weinig voorkennis2,11.

Een divers aanbod van scRNA-SEQ platformen zijn uitgevonden, elk geschikt voor bepaalde toepassingen12. In het algemeen zijn op droplet gebaseerde methoden, zoals 10x Genomics, hoger in doorvoer met (tientallen) duizenden cellen die in elke uitvoering worden gesequentieerd, en ze zijn minder selectief voor de invoer die gemengde celpopulaties kan bevatten die een brede categorisatie vereisen. Op plaat gebaseerde methoden bieden een hogere gevoeligheid en lees diepte13,14, meestal gericht op specifieke populaties van celsortering om subtiele verschillen of zeldzame transcripten te onthullen. Gezien het kleine percentage microglial cellen, met name die ontwikkelings-of ziektegebonden subpopulaties, is het vaak wenselijk om Microglia te isoleren van een specifieke regio van belang en diepe en volledige transcriptomische informatie te verkrijgen om hun heterogeniteit te begrijpen.

Hier geven we informatie over hoe Microglia te isoleren van verschillende muizen hersengebieden die worden ontleed van een enkele halve bol, die worden gebruikt voor eencellige (of bulk) RNA-SEQ na een semi-geautomatiseerde plaat-gebaseerde bibliotheek voorbereidingsprocedure. De andere halve bol kan vervolgens worden gebruikt voor histologische validatie. Gestroomlijnd vanaf een eerder gepubliceerde methode9, is dit isolatie protocol bedoeld om de opbrengst van kleine hoeveelheid start materialen te maximaliseren en ondertussen endogene microglial genexpressie profielen te onderhouden. We gebruiken fluorescentie-geactiveerde celsortering (FACS) om Microglia (of andere gerelateerde immuuncellen van belang) te verrijken in 96-well Plates en miniaturiseren de volumes van reagentia voor bibliotheek voorbereiding om de doorvoer te verhogen. We belichten dit gevoelige scRNA-SEQ-platform, hoewel andere op platen gebaseerde strategieën kunnen worden toegepast. Deze methode kan gemakkelijk worden aangepast om Microglia te isoleren van andere ontleed weefsels, zoals letsel of ziekte Foci, en de leeftijd van de muis kan variëren in bijna elke postnatale fase. Efficiënt isoleren van regionale Microglia voor onderzoeken met één cel transcriptomics zal een beter begrip van hun functies in gezondheid en ziekte vergemakkelijken.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedures met betrekking tot knaagdieren aan normen voldoende aan Stanford University richtlijnen, die voldoen aan nationale en staatswetten en beleid. Alle dier procedures zijn goedgekeurd door het administratief panel van Stanford University voor laboratoriumdieren verzorging.

Opmerking: Alle oplossingen en buffer composities zijn beschikbaar in de tabel van de materialen.

1. voorbereiding op de dag van de celisolatie

  1. Bereid de volgende reagentia en chill ze op ijs: medium A (50 mL), magnetisch-geactiveerde celsortering (MCS) buffer (30 mL), FACS buffer (25 mL), fosfaatgebufferde zoutoplossing (PBS; 30 mL), DNase (320 μL) en RNase remmer (30 μL).
    Opmerking: De volumes die hier worden geleverd zijn voldoende om Microglia te isoleren van 4 hersengebieden (bijv. cortex, cerebellum, Hippocampus en striatum) van een hersen halfrond met één muis. Opschalen als er meer weefsels worden gebruikt.
  2. Plaats vier schone 2 mL Dounce homogeniseerders op ijs en voeg 2 mL medium A toe met 80 μL DNase (12.500 eenheden/mL) en 5 μL RNase-remmer in elke Dounce-homogenisator. Chill de zuigers in tubes van 15 mL.
  3. Label vier 6 cm Petri schaaltjes met hersengebieden voor weefsel inzameling en voeg 200 μL koelmedium A toe aan elk gerecht op ijs. Voeg ongeveer 5 mL medium A toe aan een 6 cm Petri schaaltje voor dissectie.
    Opmerking: Zorg er vóór gebruik voor dat alle reagentia steriel zijn en geschikt zijn voor RNA-toepassingen. Bank-en dissectie gereedschappen moeten schoon en besproeid zijn met RNase decontaminatieoplossing (tafel van materialen).

2. hersenregio dissectie

Opmerking: Deze stap moet ~ 30 minuten duren.

  1. Injecteer 400 − 500 μL ketamine/xylazine (24 mg/mL ketamine en 2,4 mg/mL xylazine) in het peritoneum van een juveniele tot volwassen podium muis (> 1 maand oud).
    Opmerking: Een mannelijke muis wordt hier gebruikt ter illustratie, maar beide geslachten zijn geschikt.
  2. Wacht 5 min en knijp een achterpoot om te zorgen voor een gebrek aan terugtrekking.
  3. Gebruik onmiddellijk een 26 G x 3/8 naald om transcardial perfusie uit te voeren met 20 − 30 mL ijskoude PBS totdat de buffer opraakt zonder zichtbaar bloed.
  4. Onthapitate de muis met een chirurgische schaar. Gebruik een kleine schaar om de huid open te snijden om de onder schedel bloot te leggen en snijd vervolgens door het sagittale hechtmiddel, lambdoidal hecht en coronale hecht. Gebruik de tang om beide zijden van het parietale bot en het interpariëtale bot te trekken zonder het weefsel te beschadigen en verplaats de hersenen voorzichtig in de dissectie Petri schaal met medium A.
  5. Gebruik een voorgekoeld blad om de hersenen door middel van de middenlijn in twee hemisferen te snijden.
    Opmerking: De vier hersengebieden die hier worden beschreven vanaf een enkele hemisfeer, leveren voldoende aantallen Microglia op voor eencellige of bulk-RNA-SEQ-toepassingen. De andere hemisfeer kan worden gebruikt voor Immunohistochemie of RNA in situ validatie.
  6. Scheid het cerebellum van de corticale LOB en de hersenstam met #55 Tang en breng het weefsel over in een collectie Petri schaaltje.
  7. Gebruik #55 tang om de hippocampus en het striatum uit de cortex zorgvuldig te ontleden en breng elk weefsel over in een collectie Petri schaaltje.

3. mechanische weefsel dissociatie

Opmerking: Houd cellen en reagentia de hele tijd koel, behalve tijdens kleurings stappen. Deze stap moet ~ 30 minuten duren.

  1. Hak elk hersenweefsel met een scheermesje in < 1 mm3 fijne stukjes.
  2. Gebruik 1 mL Pipet (met tips afgesneden) om weefsel stukken in de voorgekoelde Dounce homogeniseerders over te brengen, elk met 2 mL medium A met DNase en RNase remmer.
  3. Homogeniseer het weefsel door de zuiger langzaam in en uit de Dounce-homogenisator te draaien voor 6 − 10 volledige slagen, totdat er geen zichtbare brokjes aanwezig zijn.
    Opmerking: Douncing doodt neuronen en de meeste andere gliacellen, maar laat microglial cellen vrij intact. Zowel onvoldoende als over-douncing kan leiden tot lage opbrengst van cellen.
  4. Overdracht van gezien weefsels in 50 ml buizen door middel van 70 μm Strainers.
  5. Spoel elke Dounce homogenisator en zuiger met in totaal 6 mL koud medium A en filtreer de spoeloplossing door dezelfde zeef in de corresponderende buis.
  6. Breng de enkelvoudige cel suspensies (ongeveer 8 mL elk) over in 15 mL conische buizen en centrifugeer bij 400 x g gedurende 5 minuten bij 4 °c met rem = 5.

4. myeline verwijderen

Opmerking: Deze stap moet nemen ~ 60 min.

  1. Bereid 1 grote depletie kolom (LD) (voor cortex) en 3 kolommen met grote selectie (LS) (voor de andere 3 regio's) in een magnetisch scheidingsteken (tabel met materialen). Spoel elke kolom af met 3 mL MCS-buffer.
  2. Zodra centrifugeren is voltooid, Pipetteer en gooi het supernatant weg zonder de pellet te storen. Voor de weefsels van de cortex en cerebellum respendeert u cellen in 850 μL MCS-buffer met 1,8 μL RNase-remmer. Voor de weefsels van Hippocampus en striatum worden cellen in 400 μL MCS-buffer met 0,9 μL RNase-remmer hervat.
    Opmerking: De kolommen (LD vs. LS) en het volume dat wordt gebruikt voor resuspensie worden geoptimaliseerd op basis van de hoeveelheid myeline die aanwezig is in het weefsel. Als andere hersengebieden worden aangevallen, moeten deze voorwaarden mogelijk worden aangepast afhankelijk van de grootte van het weefsel en hoeveel myeline kan bestaan. De effectiviteit van het verwijderen van myeline kan worden geschat in stap 4,9.
  3. Voeg 100 μL myeline-verwijderings kralen toe, elk in cellen uit de cortex en de cerebellum en voeg 50 μL myeline-verwijderings kralen toe, elk in cellen van Hippocampus en striatum.
  4. Meng de cellen zachtjes met kralen en inincuberen de buisjes op ijs gedurende 10 minuten.
  5. Breng het volume van de buis met corticale cellen naar 2 mL met MCS-buffer en alle andere naar 1 mL (d.w.z., voeg 1 mL voor corticale cellen toe; 500 μL voor hippocampal-en striatale cellen; u hoeft geen buffer toe te voegen aan cerebellaire-cellen).
  6. Zodra de kolommen leeg zijn van de spoel buffer, plaatst u een buis van 15 mL onder elke kolom. Laad corticale cellen (2 mL) op de LD-kolom en alle andere (1 mL elk) op de LS-kolommen. Gebruik onmiddellijk 1 mL MCS-buffer om de originele buizen te wassen en de oplossing op de corresponderende kolommen te laden.
  7. Was de LD-kolom eenmaal met 1 mL MCS-buffer en was elke LS-kolom twee keer met 1 mL MCS-buffer per wasbeurt. Doorgaan met het verzamelen van de doorstroom oplossing tijdens het wassen.
  8. Filter cellen in ronde bodem FACS buizen door middel van 35 μm zeef doppen.
    Opmerking: Elke buis moet verzamelen ongeveer 4 mL eencellige suspensie van myeline.
  9. Neem eventueel 10 μL celsuspensie en meng deze met 10 μL 0,4% trypeen blauwe oplossing. Onderzoek de cellen onder een 10x heldere veld microscoop om de opbrengst, overlevingskans en het niveau van de resterende myeline te schatten.
    Opmerking: Een succesvolle voorbereiding moet meer dan 90% levende cellen genereren (ronde in vorm en exclusief de blauwe kleurstof) met weinig tot geen myeline puin.
  10. Pellet cellen in de FACS tubes bij 400 x g gedurende 5 minuten bij 4 °c, met rem = 5. Giet langzaam supernatant uit en DEP de rand van de buis op tissuepapier. Respendeer cellen in elke buis met 300 μL FACS buffer.
    Opmerking: Als MCS sorting de voorkeur heeft, kunnen CD11b kralen worden gebruikt om Microglia en andere myeloïde cellen te selecteren na verwijdering van myeline. Deze cellen kunnen vervolgens worden gebruikt voor niet op plaat gebaseerde scRNA-SEQ en in bulk RNA-SEQ. Het voorbehoud van deze alternatieve benadering is dat CD11b kralen Microglia niet scheiden van andere gerelateerde immuuncellen die ook positief zijn voor dit antigeen.

5. kleuring voor het sorteren van fluorescentie-geactiveerde cellen

Opmerking: Deze stap moet nemen ~ 40 min.

  1. Voeg 5 μL muis FC receptoren blok reagens (tabel van materialen) in elke buis. Inbroed voor 5 min op ijs.
  2. Voeg 1 μL CD45-PE-Cy7 en 1 μL CD11b-BV421 toe aan elke buis.
    Opmerking: Antilichamen met andere geconjugeerde fluoroforen mogen worden gebruikt. Antilichamen tegen TMEM119, een specifieke marker voor homeostatische Microglia9, kunnen ook worden opgenomen, maar het wordt aanbevolen om samen met CD45 en CD11b te worden gebruikt, omdat bepaalde Microglia-SUBPOPULATIES TMEM119 oppervlakte expressie kunnen verliezen.
  3. Inbroed de buisjes gedurende 10 min bij kamertemperatuur (RT) op een shaker.
  4. Voeg 2 mL FACS buffer toe om te wassen.
  5. Pellet cellen bij 4 °C, 400 x g gedurende 5 min. Giet langzaam supernatant uit en DEP de rand van de buis op tissuepapier. Respendeer cellen in elke buis met 400 μL FACS buffer met 1 μL RNase remmer en 0,5 μL propidium jodide (PI, 1:1000 verdunning).

6. index FACS sorteren

Opmerking: Deze stap moet nemen ~ 1 h.

  1. Volgende standaard FACS-procedure, tekenen van poorten op basis van Scatter (met uitzondering van puin), enkelvoudige cellen, levende cellen (PI-negatief), Microglia en myeloïde cellen (CD45+, CD11b+).
    Opmerking: Typische microgliale cellen Express CD45 op lagere niveaus in vergelijking met andere aan de rand geassocieerde macrofagen, zoals perivasculaire en Meningeale macrofagen, en daarom gating op CD45 lage CD11b+ moet voldoende zijn als de focus van het onderzoek is genexpressie profielen in deze klassieke Microglia1,2. Bepaalde subgroepen van Microglia kunnen echter een hogere CD45-expressie hebben en dit geldt met name tijdens de ontwikkeling of in ziekte omstandigheden. Om een objectieve analyse van microgliale genexpressie te garanderen, kunnen CD45 hoge en CD45 lage immunophenotypes worden geregistreerd via index sorteerinstelling en beide populaties verzameld voor sequencing en downstream analyse. Daarnaast kan TMEM119 oppervlak expressie worden gebruikt om de homeostatische microglial populatie te targeten (zie stap 5,2) en geanalyseerd samen met CD45 niveaus en de sequentiëren resultaten.
  2. Sorteer enkelvoudige Microglia (met een nozzle van 100 μm) in 96-goed polymerase kettingreactie (PCR)-platen, die elk goed 4 μL lysisbuffer bevatten (Zie het gepubliceerde protocol14 voor meer informatie).
    Opmerking: Het externe RNA Control Consortium (ERCC) RNA Spike-in mix (tabel met materialen) kan worden toegevoegd bij 1:2.4 x 107 in de lysisbuffer voor kwaliteitscontrole en normalisatie doeleinden2.
  3. Draai de platen kort om en spin omlaag met behulp van een bank-top centrifuge.
  4. Vries de monsters onmiddellijk op droogijs. Bewaar de platen bij-80 °C tot de bibliotheek is voorbereid.
    Opmerking: Als alternatief kunnen meer cellen worden verzameld in 1,5 mL tubes met RNA extractiebuffer voor bulk RNA-SEQ. Volgens de ervaring van de auteurs zijn 3.000-cellen voldoende om bibliotheken van goede kwaliteit te genereren na het gepubliceerde protocol2,14.

7. voorbereiding van een bibliotheek met één cel RNA-sequencing

Opmerking: Hier wordt het gepubliceerde protocol14 gevolgd om scrna-SEQ-bibliotheken te genereren met behulp van liquid handling Robotics en enkele modificaties. In dit artikel wordt de procedure slechts kort beschreven en worden de verschillen gemarkeerd. Verwerken van 4 platen tegelijkertijd duurt ongeveer 2,5 dagen.

  1. Ontdooien platen op ijs en het uitvoeren van omgekeerde transcriptie met oligo-dT30VN primer (in de lysisbuffer) om cDNA met thermische fietsers te genereren (tabel 1): 42 °c 90 min; 70 °C 5 min; 4 °C vasthouden. Dan versterken cDNA met een extra exonuclease digestie stap aan het begin (tabel 2) met behulp van de PCR Master Mix en in situ PCR (ispcr) primers (tabel van de materialen) en de volgende PCR-voorwaarde: 37 °c 30 min; 95 °C 3 min; 23 cycli van 98 °C 20 s, 67 °C 15 s, 72 °C 4 min; 72 °C 5 min.
  2. Reinig cDNA met 18 μL magnetische kralen per put (0,7:1 ratio). Inbroed de plaat gedurende 5 minuten op een magnetische standaard en was tweemaal met vers gemaakte 80% ethanol, 80 μL per put elke keer. Na het drogen van de plaat voor 15-20 min, Elueer cDNA met 20 μL elutie buffer per put.
    Opmerking: Voor kwaliteitscontrole gebruikt u een fragment analysator (hoge gevoeligheid volgende-generatie sequencing [NGS] fragment analyse, 1 − 6000 BP) om de grootte verdelingen en de concentraties van cDNA te controleren, en alleen verdere proces monsters met een uitstrijkje tussen 500 − 5000 BP, en hoger dan 0,05 ng/μL.
  3. Om bibliotheken te genereren, meng u 0,4 μL van elk cDNA-monster met 1,2 μL Tn5-tagmentatie reagentia uit de bibliotheek voorbereidings Kit (tabel met materialen) in een 384-put met behulp van een nanoliter-Pipetteer machine, op 55 °c 10 min.
    Opmerking: Hier wordt 1/12,5 van het voorgestelde reactievolume (5 μL monster en 15 μL van tagmentatie reagentia) toegevoegd om de kosten te verlagen en ondertussen de doorvoer te verhogen. Een nanoliter Pipetteer machine (tabel met materialen) wordt gebruikt voor het overbrengen van reagentia (deze en volgende stappen) van en naar 384-well Plates.
  4. Voeg 0,4 μL neutralisatie buffer toe om de tagmentatie reactie bij RT gedurende 5 minuten te stoppen.
  5. Voeg 384 indexen (tabel met materialen, 0,4 μl voorwaarts en 0,4 μl achteruit), 1,2 μL PCR-mix toe aan monsters (elk 2 μL) en versterk de bibliotheken aan de hand van de volgende voorwaarde: 72 °c 3 min; 95 °C 30 s; 10 cycli van 95 °C 10 s, 55 °C 30 s, 72 °C 1 min; 72 °C 5 min.
  6. Zwembad alle afzonderlijke bibliotheken (Neem 1 μL elk) van dezelfde 384-goed plaat samen, en gebruik magnetische kralen (tabel van materialen, 0.7:1 ratio) om de uiteindelijke gepoolde bibliotheken te zuiveren.
  7. Gebruik een fluor meter (tabel met materialen) om de concentraties en een bioanalyzer (tabel met materialen) te meten om de grootte verdelingen van gepoolde bibliotheken vóór de sequencing te onderzoeken. Target de sequentiëren diepte bij 1.000.000 onbewerkte leesbewerkingen per cel.
  8. Volg standaard bioinformatica procedures om sequentiëren te filteren en te trimmen en uitlijning2uit te voeren. Gebruik de tabel Count en metagegevens als invoer voor clustering analyse met de Seurat pakket15.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dit protocol beschrijft een methode voor het isoleren en sorteren van Microglia uit verschillende hersengebieden in één volwassen geperfectiongebruikt hersen halfrond, gevolgd door scRNA-SEQ. We gebruiken douncing om eencellige suspensie te creëren en ook als een eerste stap om Microglia te verrijken. Onvoldoende of over-douncing vermindert de opbrengst. Bovendien bevatten volwassen muis hersenen hoge niveaus van myeline, die ook de sorteerefficiëntie en-opbrengst kunnen verminderen als ze niet goed worden verwijderd. Daarom onderzoeken we de celsuspensie onder Microscoop met behulp van trypan Blue en een hemocytometer om het rendement, de levensvatbaarheid van de cellen en de werkzaamheid van de verwijdering van myeline (stap 4,9) te schatten voordat de antilichaam kleuring wordt uitgevoerd (Figuur 1). Totale aantal cellen op dit punt moet meer dan 30.000 voor cortex, en meer dan 5.000 voor andere weefsels. Meer dan 90% van de cellen moet levensvatbaar zijn met weinig myeline puin.

We gebruiken een FACS machine om Microglia (of myeloïde cellen) te sorteren, die meestal CD45 laag en CD11b positief zijn. In ieder geval voor het corticale weefsel, moet succesvolle isolatie meer dan 80% Microglia uit alle levende enkelvoudige cellen genereren (Figuur 2). De stervende/dode populatie vertegenwoordigt slechts een kleine fractie van het preparaat (ongeveer 10%).

Zodra individuele Microglia worden gevangen in de lysisbuffer, wordt RNA losgelaten en vervolgens omgekeerd omgezet naar cDNA, dat vervolgens wordt versterkt voor 23 cycli. Het is belangrijk om de kwaliteit van deze cDNA-samples-althans een deel ervan-te controleren voordat u bibliotheken maakt. Als een capillair elektroforese platform bieden de fragment analysator en de hoog-gevoelige NGS-fragment Kits (1 − 6000 BP) snelle en nauwkeurige informatie over de grootteverdeling en de hoeveelheid cDNA-moleculen die aanwezig zijn in elke put van een 96-well plate (Figuur 3a). Monsters met een uitstrijkje (500 − 5000 BP) en een bepaalde concentratie drempel (bijvoorbeeld 0,05 ng/μL) kunnen worden gebruikt om bibliotheken te maken. Evenzo moeten de gepoolde bibliotheken worden getest op een bioanalysator vóór de sequencing (Figuur 3B).

We sequenties de monsters tot een diepte van meer dan 1.000.000 RAW-leesbewerkingen per cel, die de detectie kracht van deze scRNA-SEQ-methodologie16verzadigd. Met ongeveer 60% toewijzingspercentage kunnen meer dan 2.000 genen per microglial-cel worden gedetecteerd. We verkregen gepubliceerde gegevens die zijn gegenereerd met behulp van deze isolatiemethode17, en demonstreren de reproduceerbaarheid van onafhankelijke experimenten en gevoeligheid voor het opsporen van Microglia-specifieke genen in de gesequentieerde populatie (Figuur 4).

Figure 1
Figuur 1: schatting van de Microglia-isolatie opbrengst, de levensvatbaarheid van de cellen en de efficiëntie van het verwijderen van myeline. Het linker paneel toonde het heldere veld beeld (4x vergroting) van trypan blauw gekleurd cellen (uit cortex) na het passeren van myeline verwijderen kolommen. Resultaten voor andere regio's zouden er vergelijkbaar uitzien, maar met minder cellen. De overgrote meerderheid (zo niet alle) cellen verscheen helder (niet-bevlekt) en ronde als gevolg van verlies van processen. Het juiste beeld was de zoom-in (20x) van het boxed gebied en er was weinig myeline puin aanwezig. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: poorten gebruikt voor het sorteren van Microglia. Gegevens toonden de gating-strategie voor het sorteren van Microglia uit de cortex, en dezelfde strategie werd gebruikt voor andere regio's. Celpuin werd voor het eerst uitgesloten van de Scatter plot, en enkele cellen werden afgesloten door forward Scatter-gebied (FSC-A)/Forward Scatter-breedte (FSC-W). Levende cellen werden afgesloten door PI-negatieve kleuring, die van ongeveer 90% van alle afzonderlijke cellen waren. Microglia, dat ongeveer 80% van de levende cellen vertegenwoordigt, werden gesorteerd van de CD45 low CD11b + Gate. Een totaal van ~ 30.000 Microglia kan worden geïsoleerd en gesorteerd van het cortex-weefsel (van een halve bol van een 3-maand oude muis). Index sortering werd uitgevoerd op een FACS machine. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3

Figure 3
Figuur 3: representatieve kwaliteitscontrole resultaten voor versterkte cDNA uit een enkele microglial-cel en een uiteindelijke gepoolde bibliotheek. A) metbehulp van een fragment analysator worden alle fragmenten getekend met hun afmetingen op de X-as en de relatieve fluorescentie intensiteit op de Y-as, wat de overvloed van een bepaalde grootte cDNA aangeeft. LM (onderste marker, 1 BP) en UM (bovenste marker, 6.000 BP) zijn laad markeringen met bekende concentraties die worden gebruikt voor het meten van de cDNA-hoeveelheid. Het met succes versterkte cDNA van een representatieve microglial-cel vormt een kromme (groene stippellijn) op de grootte verdelings grafiek of een uitstrijkje (gelabeld haakje) op de gelgrafiek tussen 500 BP en 5.000 BP. Andere gelabelde pieken werden versterkt van ERCC Spike-in moleculen of ribosomaal RNA. De concentratie van cDNA tussen 500 BP en 5.000 BP kan worden gekwantificeerd, en die monsters met concentraties hoger dan 0,05 ng/μL en die dergelijke typische curven vertonen, worden bewaard voor de voorbereiding van de bibliotheek. RFU, relatieve fluorescentie-eenheid. B) representatieve kwaliteitscontrole resultaten op een bioanalysator die de grootteverdeling van een uiteindelijke gepoolde bibliotheek (met ongeveer 380 cellen) weergeeft. Meestal varieert het van 200 BP tot 2.000 BP met een gemiddelde grootte van 400 − 600 BP. De twee scherpe pieken waren het laden van markers. FU, fluorescentie-eenheid. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: scRNA-SEQ analyse van Microglia geïsoleerd uit 4 hersengebieden van twee mannelijke muizen. (A) tsne-plot met onderling vermengd patroon van regionale Microglia (alleen cellen van muis #1 werden gemarkeerd). Ze vormen geen aparte clusters volgens regio oorsprong buiten subtiele verschuiving in geconcentreerde gebieden op de tSNE plot (mogelijk als gevolg van batch-effecten). Deze observatie is consistent met een beperkte regionale heterogeniteit van Microglia op basis van globale genexpressie in de volwassen muizen (zie een recente publicatie2 voor verdere bespreking over dit onderwerp). B) tsne-plot met overlappend patroon van Microglia van twee individuele muizen die onafhankelijk werden verwerkt. Hoewel kleine batch-effecten kunnen bestaan (cellen die zich concentreren in bepaalde delen van het perceel), vormen deze cellen geen afzonderlijke clusters volgens dierlijke oorsprong. Dit resultaat suggereert de reproduceerbaarheid van het protocol voor het vergelijken van gegevens tussen experimenten. C) expressie van Microglia Signature-genen gedetecteerd door scrna-SEQ met een detectiepercentage van meer dan 95% voor specifieke markers, zoals Tmem119 en P2ry12, en een detectiepercentage van meer dan 80% voor bekende transcriptiefactoren zoals Sall1 en PU. 1. De gegevens werden opnieuw geanalyseerd uit gepubliceerde literatuur17. D) de overgrote meerderheid van geïsoleerde Microglia ontbreekt aan expressie van genen die specifiek zijn voor andere celtypen, zoals Tubb3 (neuronen), Aldh1l1 (astrocyten), Gjb1 (oligodendrocyten) en Tie1 (endotheel cellen). E) expressie van genen gerelateerd microglial activatie of stress. Klassieke markeringen, TNF, Il1b, Nos2en Nfkb2, die laag zijn uitgedrukt, worden bovenaan weergegeven. Vroege respons genen, Egr1 en Fos, worden onderaan getoond (zie discussie). Klik hier om een grotere versie van dit cijfer te bekijken.

Reagens Volume (μL)
Celllysis 4
Reverse transcriptase (100 U/μL) 0,95
RNase-remmer 0,25
5x eerste streng buffer 2
Dithiothreitol (DTT; 100 mM) 0,5
Betaïne (5 M) 2
MgCl2 (1 M) 0,06
Sjabloon schakelaar oligo (TSO; 100 μM) 0,1
H2O 0,14
Totale 10

Tabel 1: transcriptie voorwaarde omkeren. Reagens volumes voor een omgekeerde transcriptie reactie zijn aanwezig.

Reagens Volume (μL)
Reverse transcriptie product 10
2x PCR Master Mix 12,5
ISPCR primer (10 μM) 0,25
Lambda exonuclease 0,1125
H2O 2,1375
Totale 25

Tabel 2: PCR-versterkings voorwaarde. Reagens volumes voor één PCR-versterking van cDNA uit een enkele cel worden meegeleverd.

Op plaat basis (dit Protocol) Op droplet gebaseerde (10x Genomics)
Gevoeligheid Meer genen gedetecteerd Minder genen gedetecteerd
Volledige lengte Ja Geen (5 ' of 3 ' end)
Flexibiliteit voor celaantallen/populaties Geschikt voor het karakteriseren van kleine of zeldzame subpopulaties Geschikt voor brede categorisatie van grote celpopulaties
Doorvoer Tot enkele duizenden cellen Honderden tot tienduizenden cellen
Unieke moleculaire identificatie No Ja
Kosten per cel $1 − $5 minder dan $1
Experimentele moeilijkheidsgraad Meer stappen en vereisen meestal vloeistof handling-Robotica Eenvoudig uit te voeren met gecommercialiseerde machines
Celpopulaties Doelwit van FACS sorting Onbevooroordeelde

Tabel 3: vergelijking tussen scRNA-SEQ-methoden op basis van platen en droplet. In dit artikel wordt de op plaat gebaseerde volledige scRNA-SEQ-procedure geleverd, die de voordelen van een hogere gevoeligheid, volledige sequencing en flexibiliteit voor kleine aantallen cellen als invoer heeft. Droplet-gebaseerde methoden bieden de voordelen van hogere doorvoer, lagere kosten, eenvoudig uit te voeren en gegevens in unieke moleculaire identificatoren. Ze zijn complementair afhankelijk van het doel van de experimenten.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Microglia actief interactie met andere celtypen in het CZS, en ze zijn zeer gevoelig voor milieu stimuli. Om ontstekingsreacties en afwijkende veranderingen in hun genexpressie tijdens het isolatie proces te minimaliseren, is dit protocol gestroomlijnd vanuit een eerder gepubliceerde methode9, en het is nu geschikt om Microglia te isoleren van meerdere regio's van een enkele muis hersenhelft parallel. De weefsels en reagentia worden op koude temperatuur gehouden en experimenten worden tijdig uitgevoerd (ongeveer 3,5 h van dissectie tot sortering) met minder wasjes en minder reagentia op basis van beperkte weefsel groottes. We kiezen voor een douncing over andere homogenisatie methoden, zoals enzymatische spijsvertering, omdat mechanische dissociatie kan doden en dus neuronen en andere gliacellen verwijdert, terwijl er weinig schade of activering wordt veroorzaakt aan Microglia9,18. Over-douncing kan echter de opbrengst van Microglia verminderen en moet worden vermeden. Er is eerder aangetoond dat mechanische dissociatie en op kralen gebaseerde myeline-verwijdering gevolgd door FACS-sortering minder activering introduceren bij Microglia, op basis van minimale expressie van klassieke inflammatoire genen, bijvoorbeeld TNF, Il1b, Nos2en Nfkb29 (Figuur 4e). Niettemin kon Microglia nog steeds reageren op de ex vivo condities tijdens dissociatie en sortering door upregulating vroege respons genen zoals Fos en Egr1 (Figuur 4E), die normaliter niet worden uitgedrukt door Microglia in vivo2,19, en dergelijke veranderingen van transcriptomische studies moeten altijd worden gevalideerd op histologie secties.

Hier bieden we procedures voor het isoleren van Microglia van cortex, cerebellum, Hippocampus en striatum van een volwassen muis hersen halfrond, en dit protocol kan gemakkelijk worden aangepast aan andere regio's of stadia. Dit is handig voor situaties, bijvoorbeeld wanneer door de ziekte getroffen Microglia beperkt zijn tot bepaalde hersengebieden die kunnen worden ontleed, of in verouderings studies, waarbij het groeperen van monsters ongeschikt is vanwege significante individuele variaties. Met de beschikbaarheid van antilichamen tegen microglial (of pan aangeboren immuun) epitopen, dit protocol kan ook worden aangepast voor het isoleren van Microglia in rat of menselijke weefsels9. Bij het afstellen voor grotere of oudere weefsels is het belangrijk om het volume van de myeline-verwijderings kralen en het gebruikte type kolommen te overwegen en te testen. Een alternatieve aanpak voor het verwijderen van myeline is door dichtheidsgradiënt centrifugeren in commerciële laagviscositeits media20. Over het algemeen zijn deze twee methoden vergelijkbaar in hun efficiëntie, hoewel de methode voor het centrifugeren van de dichtheidsgradiënt iets hogere opbrengsten kan opleveren, en aan de andere kant is de magnetische kralen methode minder waarschijnlijk om endotoxinen te introduceren, die Microglia21,22kunnen activeren.

Vanwege het kleine percentage Microglia onder de totale hersencellen is het vaak essentieel om Microglia te verrijken of te zuiveren voordat transcriptomische onderzoeken met één cel worden uitgevoerd. We gebruiken FACS als een gevoelige aanpak om zachtmoedig nederig vertegenwoordigde celtypen vast te leggen en Microglia te selecteren op basis van CD11b en CD45 oppervlak expressie. Van een halfrond, we routinematig verkrijgen ~ 30.000 Microglia voor cortex, en ~ 5.000 Microglia voor cerebellum, Hippocampus of striatum. Deze opbrengsten zijn voldoende voor de meeste single-cell toepassingen, evenals bulk RNA-SEQ (3.000 of meer cellen kunnen worden gebruikt). Het is vermeldenswaard dat Microglia kan upregulate CD45 immunoreactivity tijdens de ontwikkeling of ziekte2, in welk geval cellen met zowel lage als hoge niveaus van CD45 moeten worden opgenomen en index gesorteerd voor analyse. Een andere optie voor het verrijken van Microglia is het gebruik van CD11b kralen gemedieerde magnetische-geactiveerde celsortering na het verwijderen van myeline, maar dit zou scRNA-SEQ tot druppel methoden beperken.

Om microglial genexpressie te bestuderen bij één-celresolutie, sorteren we meestal cellen in ten minste 2 − 3 96-boorput platen per monster en voeren bibliotheek voorbereiding uit met vloeistof behandelingsmachines. Het is aangetoond dat deze op platen gebaseerde volledige bibliotheek voorbereidings aanpak een van de meest gevoelige scrna-SEQ-methoden in detectielimiet is, waardoor een nauwkeurige kwantificering van zeldzame transcripten mogelijk is, zoals transcriptiefactoren13,14,16. Vanwege de volledige sequencing is deze aanpak niet onderhevig aan 5 ' of 3 ' bias en kan worden gebruikt om splicing varianten te analyseren (tabel 3). Bovendien, in tegenstelling tot droplet-gebaseerde methoden, die meestal honderden of duizenden cellen in een reactie vereisen, heeft dit op een plaat gebaseerd protocol de flexibiliteit om een klein aantal cellen in elk experiment op te nemen en geleidelijk de bevolkingsgrootte uit te breiden door later meer platen in het ontwerp toe te voegen. Dit is voordelig bij het bestuderen van kleine deelverzamelingen van Microglia in bepaalde omstandigheden, zoals embryonale ontwikkeling.

Hoewel dit protocol reproduceerd hoogwaardige scRNA-SEQ-bibliotheken genereert voor regionale Microglia in de hersenen, is het vaak alleen geschikt voor kleinschalige studies als gevolg van de relatief hoge kosten (ongeveer $5/cel voor de voorbereiding van de bibliotheek, nog steeds goedkoper dan $23/cel als u de uit de plank SmartSeq v4 Kit gebruikt). Verschillende strategieën kunnen helpen de kosten te verlagen en de doorvoer te verhogen. Ten eerste kunnen cellen worden gesorteerd in 384-put-platen met slechts 0,5 μL lysisbuffer, en dit vereist slechts 1/8 volumes van reagentia voor de initiële omgekeerde transcriptie en PCR-versterkings stappen. Ten tweede is het mogelijk om in-House Tn5 transposase te produceren die dezelfde kwaliteit heeft als die in een commercieel verkrijgbare Kit23. Deze twee wijzigingen kunnen de kosten van de bibliotheek-voorbereiding verlagen tot $1/cel. Ten derde kunnen met behulp van aangepaste indexen duizenden cellen samen worden samengevoegd voor sequentiëren op een systeem zonder de sequentie diepte op te offeren (> 1 miljoen Lees/cel)17. Deze verbeteringen, samen met de integratie van geautomatiseerde vloeistof handling robots, zullen hoge doorvoer diepe scRNA-seq van Microglia geïsoleerd uit bijna elke gedefinieerde regio's mogelijk te maken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

We danken Mariko L. Bennett, Liana Nicole Bonanno en Spyros Darmanis voor hun hulp bij de ontwikkeling van dit protocol. We bedanken ook de gedeelde FACS-faciliteit van Stanford, met name Meredith Weglarz en Lisa Nichols; Yen Tran, Michael Eckart van Stanford protein en Nucleic Acid Facility (PAN) voor hun geweldige ondersteuning voor het filmen. Dit werk wordt gefinancierd door de JPB Foundation en Vincent J. Coates Foundation.

Materials

Name Company Catalog Number Comments
5 M Betaine Sigma-Aldrich Cat# B0300-5VL
10 mM dNTP mix Thermo Fisher Scientific Cat# R0192
0.5 M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
10X Hanks’ Balanced Salt Solution Thermo Fisher Scientific Cat# 14185-052
1 M HEPES Thermo Fisher Scientific Cat# 15630080
1X KAPA HIFI Hotstart Master Mix Kapa Biosciences Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap Corning Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp) Advanced Analytical Cat# DNF-474-1000
Bovine Serum Albumin Sigma Aldrich Cat# A8806
DNase I Worthington Cat# LS002007 Working solution: 12500 units/ml
DTT, Molecular Grade Promega Cat# P1171
ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740
Fetal Bovine Serum Thermo Fisher Scientific Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes) Illumina Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes) Illumina Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes) Illumina Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes) Illumina Cat# FC-131-2004
Lambda Exonuclease (5 U/μl) New England BioLabs Cat# M0262S
Mouse Fc block BD Pharmingen Cat# 553142
Myelin removal beads Miltenyl Biotec Cat# 130-096-433
Nextera XT DNA Sample Prep Kit Illumina Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina Cat# 20024907
PBS (10X), pH 7.4 Thermo Fisher Scientific Cat# 70011044
PCRClean DX beads Aline Biosciences Cat# C-1003-50
Propidium Iodide Thermo Fisher Scientific Cat# P3566 Staining: 1:1000
Qubit dsDNA HS Assay Kit Thermal Fisher Scientific Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70) BioLegend Cat# 101236; RRID: AB_11203704 Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11) Thermo Fisher Scientific Cat# 25-0451-82; RRID: AB_469625 Staining: 1:300
Recombinant RNase Inhibitor Takara Bio Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl) Clontech Cat# 639538 Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS buffer Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific VWR 89005-556
Hard-shell 96-well PCR plates Bio-Rad HSP9631
Others
Dumont #55 forceps Fine Science Tools 11295-51
Dounce homogenizer, 2 ml Wheaton 357422
Large depletion column Miltenyi Biotec 130-042-901
Large selection column Miltenyi Biotec 130-042-401
MACS MultiStand Miltenyi Biotec 130-042-303
QuadroMACS Separator Miltenyi Biotec 130-090-976
RNAzap Thermo Fisher Scientific AM9780
Strainer (70 μm) Falcon 352350
Equipment
BD FACSAria II BD Biosciences http://www.bdbiosciences.com/
Bioanalyzer Agilent 2100
Fragment Analyzer Agilent 5300
Mosquito HTS nanoliter pipetting robot TTP Labtech https://www.ttplabtech.com/
Qubit 4 Fluorometer Thermo Fisher Scientific Q33226

DOWNLOAD MATERIALS LIST

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18, (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101, (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169, (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94, (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368, (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368, (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34, (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113, (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50, (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22, (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317 (2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14, (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9, (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65, (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562, (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125, (1), 70 (2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19, (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122 (2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147 (2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3, (13), 121109 (2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8, (1), Bethesda. 79-89 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics